UBE2S

Summary

UBE2S (ubiquitin conjugating enzyme E2 S, HGNC:17895) is a protein-coding gene on chromosome 19q13.42, encoding Ubiquitin-conjugating enzyme E2 S (Q16763). Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. It is a selective cancer dependency (DepMap: 41.9% of cell lines).

This gene encodes a member of the ubiquitin-conjugating enzyme family. The encoded protein is able to form a thiol ester linkage with ubiquitin in a ubiquitin activating enzyme-dependent manner, a characteristic property of ubiquitin carrier proteins.

Source: NCBI Gene 27338 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 20 total
• Druggable target: yes
• Cancer dependency (DepMap): dependent in 41.9% of screened cell lines
• MANE Select transcript: NM_014501

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:17895
Approved symbol	UBE2S
Name	ubiquitin conjugating enzyme E2 S
Location	19q13.42
Locus type	gene with protein product
Status	Approved
Aliases	E2-EPF
Ensembl gene	ENSG00000108106
Ensembl biotype	protein_coding
OMIM	610309
Entrez	27338

Gene structure

Transcript identifiers

Ensembl transcripts: 5 — 4 protein_coding, 1 protein_coding_CDS_not_defined

ENST00000264552, ENST00000587845, ENST00000589978, ENST00000592570, ENST00000917162

RefSeq mRNA: 1 — MANE Select: NM_014501 NM_014501

CCDS: CCDS33114

Canonical transcript exons

ENST00000264552 — 4 exons

Exon	Start	End
ENSE00000699548	55404288	55404478
ENSE00000953875	55406815	55406962
ENSE00001303505	55407587	55407788
ENSE00002797515	55399745	55401762

Expression profiles

Bgee: expression breadth ubiquitous, 137 present calls, max score 98.87.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 152.5409 / max 1972.4548, expressed in 1824 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
182803	152.2753	1824
182804	0.2656	84

Top tissues by expression

137 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
ventricular zone	UBERON:0003053	98.87	gold quality
ganglionic eminence	UBERON:0004023	98.76	gold quality
left testis	UBERON:0004533	98.33	gold quality
right testis	UBERON:0004534	98.26	gold quality
testis	UBERON:0000473	97.08	gold quality
cortical plate	UBERON:0005343	95.18	gold quality
stromal cell of endometrium	CL:0002255	94.54	gold quality
prefrontal cortex	UBERON:0000451	93.28	gold quality
superior frontal gyrus	UBERON:0002661	93.16	gold quality
bone marrow	UBERON:0002371	92.71	gold quality
mucosa of transverse colon	UBERON:0004991	91.87	gold quality
frontal cortex	UBERON:0001870	91.83	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	91.38	gold quality
hypothalamus	UBERON:0001898	91.14	gold quality
primary visual cortex	UBERON:0002436	91.12	gold quality
cerebral cortex	UBERON:0000956	91.04	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	90.98	gold quality
Ammon’s horn	UBERON:0001954	90.71	gold quality
anterior cingulate cortex	UBERON:0009835	90.70	gold quality
temporal lobe	UBERON:0001871	90.57	gold quality
amygdala	UBERON:0001876	90.48	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	89.90	gold quality
bone marrow cell	CL:0002092	89.77	gold quality
lymph node	UBERON:0000029	89.74	gold quality
brain	UBERON:0000955	89.64	gold quality
putamen	UBERON:0001874	89.64	gold quality
right frontal lobe	UBERON:0002810	89.64	gold quality
nucleus accumbens	UBERON:0001882	89.57	gold quality
esophagus mucosa	UBERON:0002469	89.49	gold quality
lower esophagus mucosa	UBERON:0035834	89.42	gold quality

Single-cell (SCXA)

Detected in 20 experiment(s), a significant marker in 15.

Experiment	Marker?	Max mean expression
E-MTAB-11121	yes	3268.94
E-MTAB-9435	yes	2107.95
E-HCAD-13	yes	1464.66
E-MTAB-10290	yes	1423.19
E-MTAB-8894	yes	1045.49
E-CURD-79	yes	1012.56
E-MTAB-6505	yes	853.84
E-MTAB-7037	yes	698.36
E-MTAB-8205	yes	531.11
E-GEOD-99795	yes	411.72
E-MTAB-8495	yes	200.92
E-MTAB-6819	yes	136.86
E-MTAB-9467	yes	32.15
E-HCAD-10	yes	26.28
E-MTAB-8559	no	1640.29

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): EGR1, MYC, SRF

miRNA regulators (miRDB)

6 targeting UBE2S, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-4533	100.00	69.48	2758
HSA-MIR-4524A-3P	99.72	66.85	2406
HSA-MIR-4797-5P	99.39	68.01	1354
HSA-MIR-32-3P	99.36	68.20	2517
HSA-MIR-6515-5P	97.08	65.48	1219

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 41.9% of screened cell lines.

Literature-anchored findings (GeneRIF, showing 37)

• E2-EPF UCP expression induced by growth factors or serum increased HIF-1alpha protein level under non-hypoxic conditions, suggesting that the Egr-1/SRF-UCP-VHL pathway is in part responsible for the increased HIF-1alpha protein level (PMID:18780286)
• Results suggest that UCP was significantly associated with poor prognosis of esophageal cancer and may be a new molecular target for therapeutic intervention for esophageal squamous cell carcinoma. (PMID:19083192)
• UBE2S functions with the APC/C in a two-step mechanism to control substrate ubiquitylation that is essential for mitotic exit after prolonged SAC activation, providing a new model for APC/C function in human cells (PMID:19820702)
• UbcH10 and Ube2S constitute a physiological E2-module for anaphase-promoting complex, the activity of which is required for spindle assembly and cell division. (PMID:19822757)
• K11 specificity is determined by an E2 enzyme, UBE2S/E2-EPF, that elongates ubiquitin chains after the substrates are pre-ubiquitinated by UbcH10 or UbcH5. (PMID:20080579)
• These findings reveal deregulation of the oxygen-sensing pathway impinging on the positive feedback mechanism of HIF1-mediated regulation of E2-EPF in papillary renal cell carcinoma. (PMID:21281817)
• Linkage-specific ubiquitin chain formation by Ube2S is the result of substrate-assisted catalysis. (PMID:21376237)
• E2-EPF is overexpressed in cervical cancer and associates with tumor growth (PMID:22895574)
• Study identified APC/C substrates, including the kinase Nek2A, that require Ube2S for degradation. The reconstitution of Nek2A-ubiquitylation revealed that Ube2S does not simply extend a conjugate but instead branches multiple K11-linked chains off the assemblies produced by Ube2C. (PMID:24813613)
• UBE2S is highly expressed in breast cancer (PMID:26245992)
• The anaphase-promoting complex/cyclosome C activity in human cells is tuned by the combinatorial use of three E2 ubiquitin-conjugating enzymes, namely UBE2C, UBE2S, and UBE2D. (PMID:26904940)
• High UBE2S expression is associated with drug resistance in glioblastoma. (PMID:27593939)
• SAG/RBX2 E3 ligase complexes with UBCH10 and UBE2S ubiquitin-conjugating enzymes to ubiquitylate beta-TrCP1 via K11-linkage for degradation. (PMID:27910872)
• Data indicate that UBE2S and APC3 co-regulate the expression level of P21 at G2/M check point via the ubiquitin-proteasome system. (PMID:28257844)
• RNF8- and Ube2S-dependent Lys11-linkage ubiquitin conjugation plays an important role in regulating DNA damage-induced transcriptional silencing, distinct from the role of Lys63-linkage ubiquitin in the recruitment of DNA damage repair proteins 53BP1 and BRCA1. (PMID:28525740)
• Ube2s-promoted beta-Catenin accumulation partially released the dependence on exogenous molecules for the process of embryonic stem (ES) cell differentiation into mesoendoderm lineages. (PMID:29674637)
• Ubiquitin-conjugating enzyme E2S (UBE2S) enhanced the ubiquitination of p53 protein to facilitate its degradation in hepatocellular carcinoma (HCC) cells. (PMID:29928880)
• Data demonstrated that UBE2S was downregulated by endoplasmic reticulum stress caused by HCV. UBE2S interacted with domain I of HCV NS5A and degraded NS5A protein through the Lys11-linked proteasome-dependent pathway. Its overexpression suppressed viral propagation, while its depletion increased viral infectivity. HCV-infected cells are more sensitive to DNA damage, and thus UBE2S may contribute to viral oncogenesis. (PMID:30381483)
• UBE2S expression was efficiently suppressed by lentivirus-mediated shRNA strategy in A549 cells, and UBE2S silencing led to reduced cell proliferation, colony formation, and enhanced apoptosis. (PMID:30545437)
• UBE2S mediates tumor progression via SOX6/beta-Catenin signaling in endometrial cancer (PMID:30690078)
• Data show that intramolecular transfer of ubiquitin from the catalytic cysteine to Lys+5 prevents the E1-mediated reloading of UBE2S with ubiquitin, thus conferring autoinhibition. Lys+5 ubiquitination of UBE2S is regulated in the context of the cell, with reduced levels during mitotic exit; however, this modification does not trigger proteasomal turnover of UBE2S. (PMID:31230944)
• Ube2S regulates Wnt/beta-catenin signaling and promotes the progression of non-small cell lung cancer. (PMID:32038111)
• Ubiquitin chain-elongating enzyme UBE2S activates the RING E3 ligase APC/C for substrate priming. (PMID:32393902)
• Comprehensive Investigation into the Role of Ubiquitin-Conjugating Enzyme E2S in Melanoma Development. (PMID:32603752)
• Ubiquitin-Conjugating Enzyme 2S Enhances Viral Replication by Inhibiting Type I IFN Production through Recruiting USP15 to Deubiquitinate TBK1. (PMID:32814047)
• Dimerization regulates the human APC/C-associated ubiquitin-conjugating enzyme UBE2S. (PMID:33082289)
• UBE2S interacting with TRIM28 in the nucleus accelerates cell cycle by ubiquitination of p27 to promote hepatocellular carcinoma development. (PMID:33589597)
• UBE2S exerts oncogenic activities in urinary bladder cancer by ubiquitinating TSC1. (PMID:34520980)
• UBE2S promotes the progression and Olaparib resistance of ovarian cancer through Wnt/beta-catenin signaling pathway. (PMID:34535173)
• UBE2S activates NF-kappaB signaling by binding with IkappaBalpha and promotes metastasis of lung adenocarcinoma cells. (PMID:34582005)
• Functional conservation and divergence of the helix-turn-helix motif of E2 ubiquitin-conjugating enzymes. (PMID:34942047)
• UBE2S as a novel ubiquitinated regulator of p16 and beta-catenin to promote bone metastasis of prostate cancer. (PMID:35637955)
• UBE2S promotes the development of ovarian cancer by promoting PI3K/AKT/mTOR signaling pathway to regulate cell cycle and apoptosis. (PMID:35658829)
• Knockout of UBE2S inhibits the proliferation of gastric cancer cells and induces apoptosis by FAS-mediated death receptor pathway. (PMID:35863455)
• UBE2S interacting with TRIM21 mediates the K11-linked ubiquitination of LPP to promote the lymphatic metastasis of bladder cancer. (PMID:37422473)
• As a potential predictor of pan-cancer, UBE2S is related to tumor-associated macrophage infiltration. (PMID:37791471)
• [High expression of UBE2S promotes progression of hepatocellular carcinoma by increasing cancer cell stemness]. (PMID:38597436)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	ube2s	ENSDARG00000031775
mus_musculus	Ube2s	ENSMUSG00000060860
mus_musculus	Ube2srt	ENSMUSG00000118653
rattus_norvegicus	Ube2s	ENSRNOG00000016930
drosophila_melanogaster	CG8188	FBGN0030863

Paralogs (24): UBE2T (ENSG00000077152), UBE2A (ENSG00000077721), UBE2K (ENSG00000078140), CDC34 (ENSG00000099804), UBE2I (ENSG00000103275), UBE2W (ENSG00000104343), UBE2R2 (ENSG00000107341), UBE2B (ENSG00000119048), UBE2G1 (ENSG00000132388), UBE2Z (ENSG00000159202), UBE2J2 (ENSG00000160087), AKTIP (ENSG00000166971), UBE2V2 (ENSG00000169139), UBE2C (ENSG00000175063), UBE2O (ENSG00000175931), UBE2U (ENSG00000177414), UBE2N (ENSG00000177889), UBE2F (ENSG00000184182), UBE2G2 (ENSG00000184787), UBE2H (ENSG00000186591), UBE2J1 (ENSG00000198833), PEDS1 (ENSG00000240849), UBE2V1 (ENSG00000244687), UBE2NL (ENSG00000276380)

Protein

Protein identifiers

Ubiquitin-conjugating enzyme E2 S — Q16763 (reviewed: Q16763)

Alternative names: E2 ubiquitin-conjugating enzyme S, E2-EPF, Ubiquitin carrier protein S, Ubiquitin-conjugating enzyme E2-24 kDa, Ubiquitin-conjugating enzyme E2-EPF5, Ubiquitin-protein ligase S

All UniProt accessions (3): Q16763, K7EM75, K7EPJ1

UniProt curated annotations — full annotation on UniProt →

Function. Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. Catalyzes ‘Lys-11’-linked polyubiquitination. Acts as an essential factor of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated ubiquitin ligase that controls progression through mitosis. Acts by specifically elongating ‘Lys-11’-linked polyubiquitin chains initiated by the E2 enzyme UBE2C/UBCH10 on APC/C substrates, enhancing the degradation of APC/C substrates by the proteasome and promoting mitotic exit. Also acts by elongating ubiquitin chains initiated by the E2 enzyme UBE2D1/UBCH5 in vitro; it is however unclear whether UBE2D1/UBCH5 acts as an E2 enzyme for the APC/C in vivo. Also involved in ubiquitination and subsequent degradation of VHL, resulting in an accumulation of HIF1A. In vitro able to promote polyubiquitination using all 7 ubiquitin Lys residues, except ‘Lys-48’-linked polyubiquitination.

Subunit / interactions. Component of the APC/C complex, composed of at least 14 distinct subunits that assemble into a complex of at least 19 chains with a combined molecular mass of around 1.2 MDa. Within this complex, directly interacts with ANAPC2 and ANAPC4. Interacts with CDC20, FZR1/CDH1 and VHL.

Post-translational modifications. Autoubiquitinated by the APC/C complex during G1, leading to its degradation by the proteasome.

Pathway. Protein modification; protein ubiquitination.

Similarity. Belongs to the ubiquitin-conjugating enzyme family.

RefSeq proteins (1): NP_055316* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000608	UBC	Domain
IPR016135	UBQ-conjugating_enzyme/RWD	Homologous_superfamily
IPR023313	UBQ-conjugating_AS	Active_site
IPR050113	Ub_conjugating_enzyme-E2-like	Family

Pfam: PF00179

Enzyme classification (BRENDA):

• EC 2.3.2.23 — E2 ubiquitin-conjugating enzyme (BRENDA: 20 organisms, 93 substrates, 28 inhibitors, 12 Km, 8 kcat entries)
• EC 2.3.2.24 — (E3-independent) E2 ubiquitin-conjugating enzyme (BRENDA: 5 organisms, 56 substrates, 7 inhibitors, 6 Km, 6 kcat entries)

Substrate kinetics (BRENDA)

8 substrates with measured Km, best-characterized 8. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
[UBIQUITIN-CARRIER-PROTEIN UBC2B]-L-CYSTEINE	0.0001	5
[UBE2W]-S-UBIQUITINYL-L-CYSTEINE	0.2203–0.3014	2
[HISTONE H2A]-L-LYSINE	0.0008–0.0028	2
[HISTONE H2B]-L-LYSINE	0.0015–0.012	2
S-UBIQUITINYL-[E1 UBIQUITIN-ACTIVATING ENZYME]-L	1	1
[UBIQUITIN CARRIER PROTEIN UBC4]-L-CYSTEINE	0.0019	1
[CYTOCHROME C]-L-LYSINE	0.125	1
[HISTONE H3]-L-LYSINE	0.0013	1

UniProt features (27 total): helix 8, strand 5, turn 3, mutagenesis site 3, modified residue 2, chain 1, domain 1, sequence conflict 1, region of interest 1, compositionally biased region 1, active site 1

Structure

Experimental structures (PDB)

9 structures.

PDB	Method	Resolution (Å)
6S98	X-RAY DIFFRACTION	1.55
1ZDN	X-RAY DIFFRACTION	1.93
6QHK	X-RAY DIFFRACTION	1.96
7AHF	X-RAY DIFFRACTION	2.15
6S96	X-RAY DIFFRACTION	2.18
5BNB	X-RAY DIFFRACTION	2.49
6QH3	X-RAY DIFFRACTION	2.9
8TAU	ELECTRON MICROSCOPY	3.5
5L9T	ELECTRON MICROSCOPY	6.4

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q16763-F1	82.02	0.66

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1): 95 (glycyl thioester intermediate)

Post-translational modifications (2): 1, 173

Mutagenesis-validated functional residues (3):

Position	Phenotype
95	loss of function.
117	reduced ubiquitination activity.
222	impairs polyubiquitination in the presence of apc/c complex, decreasing affinity for substrate.

Function

Pathways and Gene Ontology

Reactome pathways

19 pathways

ID	Pathway
R-HSA-141430	Inactivation of APC/C via direct inhibition of the APC/C complex
R-HSA-174048	APC/C:Cdc20 mediated degradation of Cyclin B
R-HSA-174084	Autodegradation of Cdh1 by Cdh1:APC/C
R-HSA-174154	APC/C:Cdc20 mediated degradation of Securin
R-HSA-174178	APC/C:Cdh1 mediated degradation of Cdc20 and other APC/C:Cdh1 targeted proteins in late mitosis/early G1
R-HSA-174184	Cdc20:Phospho-APC/C mediated degradation of Cyclin A
R-HSA-176407	Conversion from APC/C:Cdc20 to APC/C:Cdh1 in late anaphase
R-HSA-176408	Regulation of APC/C activators between G1/S and early anaphase
R-HSA-176409	APC/C:Cdc20 mediated degradation of mitotic proteins
R-HSA-176412	Phosphorylation of the APC/C
R-HSA-179409	APC-Cdc20 mediated degradation of Nek2A
R-HSA-2467813	Separation of Sister Chromatids
R-HSA-2559582	Senescence-Associated Secretory Phenotype (SASP)
R-HSA-68867	Assembly of the pre-replicative complex
R-HSA-69017	CDK-mediated phosphorylation and removal of Cdc6
R-HSA-8853884	Transcriptional Regulation by VENTX
R-HSA-8866652	Synthesis of active ubiquitin: roles of E1 and E2 enzymes
R-HSA-9687136	Aberrant regulation of mitotic exit in cancer due to RB1 defects
R-HSA-983168	Antigen processing: Ubiquitination & Proteasome degradation

MSigDB gene sets: 377 (showing top): REACTOME_DNA_REPLICATION, BORCZUK_MALIGNANT_MESOTHELIOMA_UP, RODRIGUES_THYROID_CARCINOMA_ANAPLASTIC_UP, HORIUCHI_WTAP_TARGETS_DN, REACTOME_APC_C_CDH1_MEDIATED_DEGRADATION_OF_CDC20_AND_OTHER_APC_C_CDH1_TARGETED_PROTEINS_IN_LATE_MITOSIS_EARLY_G1, REACTOME_APC_C_CDC20_MEDIATED_DEGRADATION_OF_CYCLIN_B, GNF2_CENPF, REACTOME_CONVERSION_FROM_APC_C_CDC20_TO_APC_C_CDH1_IN_LATE_ANAPHASE, REACTOME_PHOSPHORYLATION_OF_THE_APC_C, RODRIGUES_THYROID_CARCINOMA_POORLY_DIFFERENTIATED_UP, REACTOME_ADAPTIVE_IMMUNE_SYSTEM, BASSO_B_LYMPHOCYTE_NETWORK, REACTOME_CLASS_I_MHC_MEDIATED_ANTIGEN_PROCESSING_PRESENTATION, REACTOME_ANTIGEN_PROCESSING_UBIQUITINATION_PROTEASOME_DEGRADATION, GOBP_ANAPHASE_PROMOTING_COMPLEX_DEPENDENT_CATABOLIC_PROCESS

GO Biological Process (17): protein polyubiquitination (GO:0000209), ubiquitin-dependent protein catabolic process (GO:0006511), exit from mitosis (GO:0010458), free ubiquitin chain polymerization (GO:0010994), anaphase-promoting complex-dependent catabolic process (GO:0031145), protein K29-linked ubiquitination (GO:0035519), protein modification process (GO:0036211), proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161), protein K27-linked ubiquitination (GO:0044314), cell division (GO:0051301), protein K63-linked ubiquitination (GO:0070534), protein K11-linked ubiquitination (GO:0070979), protein K6-linked ubiquitination (GO:0085020), positive regulation of ubiquitin protein ligase activity (GO:1904668), protein ubiquitination (GO:0016567), SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146), protein modification by small protein conjugation (GO:0032446)

GO Molecular Function (8): ubiquitin-protein transferase activity (GO:0004842), ATP binding (GO:0005524), anaphase-promoting complex binding (GO:0010997), ubiquitin conjugating enzyme activity (GO:0061631), nucleotide binding (GO:0000166), protein binding (GO:0005515), transferase activity (GO:0016740), ubiquitin-like protein transferase activity (GO:0019787)

GO Cellular Component (4): nucleus (GO:0005634), nucleoplasm (GO:0005654), anaphase-promoting complex (GO:0005680), cytosol (GO:0005829)

Reactome top-level categories

Rollup of top-13 pathways:

Category	Pathways
APC/C-mediated degradation of cell cycle proteins	4
APC/C:Cdc20 mediated degradation of mitotic proteins	2
APC:Cdc20 mediated degradation of cell cycle proteins prior to satisfation of the cell cycle checkpoint	2
Activation of APC/C and APC/C:Cdc20 mediated degradation of mitotic proteins	2
Inhibition of the proteolytic activity of APC/C required for the onset of anaphase by mitotic spindle checkpoint components	1
Mitotic Anaphase	1
Cellular Senescence	1
DNA Replication Pre-Initiation	1
Switching of origins to a post-replicative state	1
Generic Transcription Pathway	1
Protein ubiquitination	1
Aberrant regulation of mitotic cell cycle due to RB1 defects	1
Class I MHC mediated antigen processing & presentation	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
protein polyubiquitination	5
protein ubiquitination	2
proteasome-mediated ubiquitin-dependent protein catabolic process	2
cellular anatomical structure	2
modification-dependent protein catabolic process	1
mitotic cell cycle phase transition	1
mitotic nuclear division	1
ubiquitin recycling	1
protein polymerization	1
protein metabolic process	1
macromolecule modification	1
ubiquitin-dependent protein catabolic process	1
proteasomal protein catabolic process	1
cellular process	1
positive regulation of ubiquitin-protein transferase activity	1
ubiquitin protein ligase activity	1
regulation of ubiquitin protein ligase activity	1
protein modification by small protein conjugation	1
protein modification by small protein conjugation or removal	1
ubiquitin-like protein transferase activity	1
adenyl ribonucleotide binding	1
purine ribonucleoside triphosphate binding	1
protein-containing complex binding	1
ubiquitin-protein transferase activity	1
ubiquitin-like protein conjugating enzyme activity	1
nucleoside phosphate binding	1
heterocyclic compound binding	1
binding	1
catalytic activity	1
aminoacyltransferase activity	1
catalytic activity, acting on a protein	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
nuclear ubiquitin ligase complex	1
cullin-RING ubiquitin ligase complex	1
cytoplasm	1

Protein interactions and networks

STRING

3608 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
UBE2S	UBA1	P22314	922
UBE2S	UBE3A	P78355	896
UBE2S	ANAPC11	Q9NYG5	889
UBE2S	TRAF6	Q9Y4K3	864
UBE2S	STUB1	Q9UNE7	830
UBE2S	BIRC2	Q13490	830
UBE2S	OTUB1	Q96FW1	823
UBE2S	RBX1	P62877	806
UBE2S	ANAPC10	Q9UM13	805
UBE2S	RNF7	Q9UBF6	779
UBE2S	G3V2F7	G3V2F7	778
UBE2S	SKP1	P34991	776
UBE2S	NEDD4L	Q96PU5	767
UBE2S	CDC20	Q12834	754
UBE2S	UBA6	A0AVT1	747

IntAct

45 interactions, top by confidence:

A	B	Type	Score
CFTR	ESYT2	psi-mi:“MI:0914”(association)	0.710
CFTR	ESYT2	psi-mi:“MI:2364”(proximity)	0.710
YAF2	E2F6	psi-mi:“MI:0914”(association)	0.640
IFTAP	PLK1	psi-mi:“MI:0914”(association)	0.640
UBE2S	GNB2	psi-mi:“MI:0915”(physical association)	0.560
VHL	UBE2S	psi-mi:“MI:0915”(physical association)	0.560
LRRC4C	DVL2	psi-mi:“MI:0914”(association)	0.530
UBE2S	ANAPC2	psi-mi:“MI:0914”(association)	0.520
UBE2S	ANAPC2	psi-mi:“MI:0407”(direct interaction)	0.520
	UBE2S	psi-mi:“MI:0407”(direct interaction)	0.440
UBE2S	CDK20	psi-mi:“MI:0915”(physical association)	0.400
JTB	UBE2S	psi-mi:“MI:0915”(physical association)	0.370
UBE2S	TNPO3	psi-mi:“MI:0915”(physical association)	0.370
UBE2S	RBCK1	psi-mi:“MI:0915”(physical association)	0.370
UBE2S	RNF40	psi-mi:“MI:0914”(association)	0.350
UBE2S	CDC23	psi-mi:“MI:0914”(association)	0.350
DLD	NFKBIE	psi-mi:“MI:0914”(association)	0.350
LRRK2		psi-mi:“MI:0914”(association)	0.350
SERBP1	UBA6	psi-mi:“MI:0914”(association)	0.350

BioGRID (298): UBE2S (Biochemical Activity), ANAPC1 (Reconstituted Complex), ANAPC2 (Reconstituted Complex), ANAPC4 (Reconstituted Complex), CDC27 (Reconstituted Complex), ANAPC5 (Reconstituted Complex), CDC16 (Reconstituted Complex), ANAPC7 (Reconstituted Complex), CDC23 (Reconstituted Complex), ANAPC11 (Reconstituted Complex), FZR1 (Reconstituted Complex), CDC20 (Reconstituted Complex), UBE2S (Reconstituted Complex), UBE2S (Reconstituted Complex), UBE2S (Reconstituted Complex)

ESM2 similar proteins: A0A8I6G705, A1L3K1, B5DFF2, B5DFI8, G3MWR8, O19048, O19137, O88508, P06730, P29338, P57721, P57722, P60335, Q12800, Q13888, Q15365, Q15366, Q16763, Q1LZ53, Q1RML1, Q28D01, Q2TBV5, Q4W5Z4, Q5E9A3, Q5FVR7, Q5NVP9, Q5TDH0, Q61990, Q6AYU1, Q6DH13, Q6P1K8, Q6ZRY4, Q7RTP6, Q8C6G8, Q8CCI5, Q8CJ19, Q8IY57, Q8N488, Q8VC52, Q921J4

Diamond homologs: A1L3K1, A5PKP9, A7SE05, B3MQV3, B3NWW9, B4H9W2, B4IF39, B4JKB7, B4L7V4, B4MA02, B4N208, B4Q2J2, B4R6G1, B5DFI8, B5DKM4, C1C3R6, C3Z724, D3ZDK2, O13685, O74196, O74810, P0CS16, P0CS17, P15731, P15732, P25153, P25865, P25866, P25867, P35128, P35129, P35130, P35131, P35132, P35133, P35134, P35135, P42745, P42746, P43102

SIGNOR signaling

7 interactions.

A	Effect	B	Mechanism
AKT1	“up-regulates quantity by stabilization”	UBE2S	phosphorylation
XRCC6	“up-regulates activity”	UBE2S	relocalization
UBE2S	“up-regulates activity”	APC-c	binding
FZR1	“up-regulates activity”	UBE2S	binding
CDC20	“up-regulates activity”	UBE2S	binding
“Ub:E1 (UBA1 substrate)”	“up-regulates activity”	UBE2S	ubiquitination
“Ub:E1 (UBA6 substrate)”	“up-regulates activity”	UBE2S	ubiquitination

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 44 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Antigen processing: Ubiquitination & Proteasome degradation	7	9.3×	2e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

20 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	12
Likely benign	2
Benign	3

Top pathogenic / likely-pathogenic (0)

SpliceAI

668 predictions. Top by Δscore:

Variant	Effect	Δscore
19:55404285:CACCA:C	donor_loss	1.0000
19:55404286:A:AC	donor_gain	1.0000
19:55404287:C:CT	donor_gain	1.0000
19:55404287:CCA:C	donor_gain	1.0000
19:55404287:CCAG:C	donor_gain	1.0000
19:55404474:CCCCT:C	acceptor_gain	1.0000
19:55404475:CCCT:C	acceptor_gain	1.0000
19:55404475:CCCTC:C	acceptor_gain	1.0000
19:55404476:CCTC:C	acceptor_gain	1.0000
19:55404477:CT:C	acceptor_gain	1.0000
19:55404477:CTCTG:C	acceptor_loss	1.0000
19:55404479:C:CC	acceptor_gain	1.0000
19:55404480:T:C	acceptor_loss	1.0000
19:55404484:G:C	acceptor_gain	1.0000
19:55404484:G:GC	acceptor_gain	1.0000
19:55406810:CTCA:C	donor_loss	1.0000
19:55406811:TCA:T	donor_loss	1.0000
19:55406813:A:AC	donor_gain	1.0000
19:55406813:A:T	donor_loss	1.0000
19:55406813:AC:A	donor_gain	1.0000
19:55406814:C:CA	donor_gain	1.0000
19:55406814:C:CG	donor_loss	1.0000
19:55406814:CC:C	donor_gain	1.0000
19:55406814:CCAGG:C	donor_gain	1.0000
19:55406958:GAGTT:G	acceptor_gain	1.0000
19:55406960:GTT:G	acceptor_gain	1.0000
19:55406961:TT:T	acceptor_gain	1.0000
19:55406962:TCT:T	acceptor_loss	1.0000
19:55406963:C:CC	acceptor_gain	1.0000
19:55406963:C:T	acceptor_loss	1.0000

AlphaMissense

1421 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
19:55401662:G:T	A148D	1.000
19:55401695:A:G	L137P	1.000
19:55401698:A:G	L136P	1.000
19:55401704:C:T	G134D	1.000
19:55401719:A:G	L129P	1.000
19:55401737:G:T	P123H	1.000
19:55401746:A:G	L120P	1.000
19:55401749:A:G	L119P	1.000
19:55401753:A:G	C118R	1.000
19:55401758:A:T	I116N	1.000
19:55404321:C:A	W103C	1.000
19:55404321:C:G	W103C	1.000
19:55404323:A:G	W103R	1.000
19:55404323:A:T	W103R	1.000
19:55404334:A:G	L99P	1.000
19:55404334:A:T	L99H	1.000
19:55404343:A:T	V96D	1.000
19:55404345:G:C	C95W	1.000
19:55404346:C:T	C95Y	1.000
19:55404347:A:G	C95R	1.000
19:55404355:C:A	G92V	1.000
19:55404355:C:T	G92D	1.000
19:55404369:G:C	N87K	1.000
19:55404369:G:T	N87K	1.000
19:55404371:T:C	N87D	1.000
19:55404373:G:T	P86Q	1.000
19:55404375:G:C	H85Q	1.000
19:55404375:G:T	H85Q	1.000
19:55404376:T:C	H85R	1.000
19:55404377:G:C	H85D	1.000

dbSNP variants (sampled 300 via entrez): RS1000045314 (19:55402794 C>T), RS1000271401 (19:55408068 G>A), RS1000480276 (19:55407202 C>A,G,T), RS1000601719 (19:55407059 G>A,T), RS1001210042 (19:55400239 C>T), RS1001266663 (19:55403558 A>C), RS1001662719 (19:55400082 G>A), RS1001779515 (19:55408468 C>A), RS1002032784 (19:55403225 T>C), RS1002083717 (19:55402999 A>G,T), RS1002152677 (19:55407831 C>T), RS1002524695 (19:55407762 C>G,T), RS1003173209 (19:55404764 GTCTGGCTACTTTTTTATTTTAAGAGA>G), RS1003216810 (19:55409436 A>G), RS1003521394 (19:55409690 G>C)

Disease associations

OMIM: gene MIM:610309 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL6196092 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

47 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	affects cotreatment, increases abundance, increases expression	4
bisphenol A	decreases expression, decreases methylation	3
Acetaminophen	increases expression	2
Arsenic	increases abundance, increases expression, affects methylation, affects cotreatment	2
Tretinoin	decreases expression	2
Particulate Matter	decreases expression	2
aristolochic acid I	increases expression	1
triphenyl phosphate	affects expression	1
salinomycin	decreases expression	1
arsenite	affects binding, increases reaction	1
sulforaphane	increases expression	1
zinc chromate	decreases expression, increases abundance	1
manganese chloride	affects cotreatment, increases abundance, increases expression	1
gossypol acetic acid	decreases expression	1
nickel sulfate	increases expression	1
celastrol	decreases expression	1
chromium hexavalent ion	increases abundance, decreases expression	1
CGP 52608	affects binding, increases reaction	1
2-palmitoylglycerol	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
abrine	increases expression	1
licochalcone B	increases expression	1
incobotulinumtoxinA	decreases expression	1
LDN 193189	affects cotreatment, decreases expression	1
Dasatinib	decreases expression	1
Sunitinib	decreases expression	1
Air Pollutants	affects expression, increases abundance	1
Diazinon	increases methylation	1
Doxorubicin	decreases expression	1
Fluorouracil	affects reaction, decreases expression	1

ChEMBL screening assays

1 unique, capped per target: 1 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL6114804	Binding	Inhibition of UBE2S (unknown origin) auto-ubiquitination at 100 uM measured after 45 mins in presence of UBA1/His6-ubiquitin/ATP by SDS-PAGE analysis relative to control	De Novo-Designed APC/C Inhibitors Provide a Rationale for Targeting RING-Type E3 Ubiquitin Ligases. — J Med Chem

Cellosaurus cell lines

1 cell lines: 1 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B3KM	Abcam HEK293T UBE2S KO	Transformed cell line	Female

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.