UBE4B

Summary

UBE4B (ubiquitination factor E4B, HGNC:12500) is a protein-coding gene on chromosome 1p36.22, encoding Ubiquitin conjugation factor E4 B (O95155). Ubiquitin-protein ligase that probably functions as an E3 ligase in conjunction with specific E1 and E2 ligases. It is a selective cancer dependency (DepMap: 15.8% of cell lines).

The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes an additional conjugation factor, E4, which is involved in multiubiquitin chain assembly. This gene is also the strongest candidate in the neuroblastoma tumor suppressor genes. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.

Source: NCBI Gene 10277 — RefSeq curated summary.

At a glance

• GWAS associations: 11
• Clinical variants (ClinVar): 182 total
• Phenotypes (HPO): 99
• Cancer dependency (DepMap): dependent in 15.8% of screened cell lines
• MANE Select transcript: NM_001105562

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:12500
Approved symbol	UBE4B
Name	ubiquitination factor E4B
Location	1p36.22
Locus type	gene with protein product
Status	Approved
Aliases	UBOX3, E4, UFD2, KIAA0684
Ensembl gene	ENSG00000130939
Ensembl biotype	protein_coding
OMIM	613565
Entrez	10277

Gene structure

Transcript identifiers

Ensembl transcripts: 26 — 21 protein_coding, 3 retained_intron, 1 protein_coding_CDS_not_defined, 1 nonsense_mediated_decay

ENST00000253251, ENST00000343090, ENST00000377153, ENST00000462658, ENST00000465408, ENST00000466379, ENST00000470736, ENST00000487244, ENST00000488228, ENST00000672724, ENST00000892379, ENST00000892380, ENST00000892381, ENST00000892382, ENST00000892383, ENST00000892384, ENST00000921026, ENST00000921027, ENST00000921028, ENST00000921029, ENST00000921030, ENST00000921031, ENST00000921032, ENST00000921033, ENST00000921034, ENST00000963443

RefSeq mRNA: 3 — MANE Select: NM_001105562 NM_001105562, NM_001410744, NM_006048

CCDS: CCDS110, CCDS41245, CCDS90857

Canonical transcript exons

ENST00000343090 — 28 exons

Exon	Start	End
ENSE00001049374	10106197	10106583
ENSE00001049375	10146963	10147090
ENSE00001049376	10151326	10151561
ENSE00001049381	10158356	10158482
ENSE00001049383	10102948	10103092
ENSE00001049384	10171138	10171329
ENSE00001049390	10149184	10149282
ENSE00001049393	10105516	10105744
ENSE00001889590	10179895	10181239
ENSE00001902028	10032958	10033694
ENSE00002806202	10137067	10137205
ENSE00002856460	10161142	10161286
ENSE00003468897	10072028	10072214
ENSE00003471584	10178644	10178818
ENSE00003474876	10129392	10129448
ENSE00003519565	10121962	10122076
ENSE00003532490	10132369	10132482
ENSE00003557208	10126794	10126877
ENSE00003579625	10130500	10130616
ENSE00003593951	10168136	10168270
ENSE00003629025	10095461	10095596
ENSE00003633590	10119513	10119613
ENSE00003635485	10134988	10135186
ENSE00003650754	10117459	10117600
ENSE00003656031	10101108	10101195
ENSE00003689882	10179416	10179562
ENSE00003690063	10130715	10130813
ENSE00003787655	10144940	10145039

Expression profiles

Bgee: expression breadth ubiquitous, 294 present calls, max score 95.53.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 29.4869 / max 244.0114, expressed in 1817 samples.

FANTOM5 promoters (3 alternative TSS)

Promoter ID	TPM avg	Samples expressed
547	18.0724	1809
549	10.8129	1684
548	0.6017	353

Top tissues by expression

300 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
buccal mucosa cell	CL:0002336	95.53	gold quality
upper leg skin	UBERON:0004262	94.44	gold quality
hair follicle	UBERON:0002073	94.21	gold quality
cerebellar hemisphere	UBERON:0002245	93.76	gold quality
cerebellar cortex	UBERON:0002129	93.73	gold quality
right hemisphere of cerebellum	UBERON:0014890	93.42	gold quality
cerebellum	UBERON:0002037	93.33	gold quality
mucosa of stomach	UBERON:0001199	93.02	gold quality
gastrocnemius	UBERON:0001388	92.88	gold quality
inferior olivary complex	UBERON:0002127	92.87	gold quality
muscle of leg	UBERON:0001383	92.61	gold quality
tongue squamous epithelium	UBERON:0006919	92.60	gold quality
skin of leg	UBERON:0001511	92.54	gold quality
oviduct epithelium	UBERON:0004804	92.53	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	92.51	gold quality
right adrenal gland cortex	UBERON:0035827	92.49	gold quality
skin of abdomen	UBERON:0001416	92.45	gold quality
corpus callosum	UBERON:0002336	92.16	gold quality
muscle organ	UBERON:0001630	92.03	gold quality
skeletal muscle organ	UBERON:0014892	92.03	gold quality
dorsal motor nucleus of vagus nerve	UBERON:0002870	91.98	gold quality
lower esophagus muscularis layer	UBERON:0035833	91.97	gold quality
medial globus pallidus	UBERON:0002477	91.96	gold quality
lower esophagus	UBERON:0013473	91.96	gold quality
apex of heart	UBERON:0002098	91.95	gold quality
body of pancreas	UBERON:0001150	91.92	gold quality
zone of skin	UBERON:0000014	91.90	gold quality
right adrenal gland	UBERON:0001233	91.90	gold quality
muscle layer of sigmoid colon	UBERON:0035805	91.89	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	91.68	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	7.68

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

90 targeting UBE4B, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-3064-3P	100.00	70.09	1254
HSA-MIR-6867-5P	100.00	82.21	3464
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-8068	99.98	73.85	2376
HSA-MIR-607	99.97	73.62	5593
HSA-MIR-545-3P	99.95	70.74	2783
HSA-MIR-651-3P	99.94	73.48	5177
HSA-MIR-497-5P	99.92	71.83	2674
HSA-MIR-1297	99.91	73.41	3162
HSA-MIR-589-3P	99.91	69.62	2088
HSA-MIR-7-1-3P	99.91	71.53	4384
HSA-MIR-7-2-3P	99.91	71.40	4394
HSA-MIR-15A-5P	99.90	72.80	2787
HSA-MIR-15B-5P	99.90	72.78	2798
HSA-MIR-16-5P	99.90	72.80	2780
HSA-MIR-195-5P	99.90	72.81	2805
HSA-MIR-3671	99.90	73.04	3897
HSA-MIR-424-5P	99.89	71.90	2641
HSA-MIR-6838-5P	99.89	71.94	2690
HSA-MIR-3140-3P	99.88	68.47	2069
HSA-MIR-6124	99.87	69.78	3551
HSA-MIR-374C-5P	99.80	72.06	2910
HSA-MIR-655-3P	99.80	72.19	2909
HSA-MIR-6739-5P	99.80	67.87	2806
HSA-MIR-4668-5P	99.79	70.58	3782
HSA-MIR-26A-5P	99.78	73.52	2303
HSA-MIR-26B-5P	99.78	73.51	2305
HSA-MIR-6885-3P	99.75	70.36	3187
HSA-MIR-148A-3P	99.74	73.77	1700

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 15.8% of screened cell lines.

Literature-anchored findings (GeneRIF, showing 22)

• A splice site mutation was found in UBE4b. UBE4B expression was diminished in the high-stage/poor-outcome tumors.UBE4B stands out as the strongest candidate NBL tumor suppressor gene in the region at this stage. (PMID:12700669)
• E4B serves as a ubiquitin ligase for FEZ1 and thereby regulates its function but not its degradation (PMID:15466860)
• we have identified a novel domain (the MPAC domain: Mitotically Phosphorylated, Apoptotically Cleaved) present at the N-terminus of Ufd2a, which is regulated both by cleavage during cell death, and by phosphorylation during mitosis. (PMID:16870146)
• Our current study provides an insight onto the regulation of DeltaNp63alpha protein levels in response to cisplatin and also suggests that UFD2a might play an important role in the regulation of cisplatin mediated cell death mediated by p63. (PMID:18418053)
• determined structures of E4B U box free and bound to UbcH5c and Ubc4 E2s; findings show E4B U box is a monomer stabilized by a network of hydrogen bonds; findings suggest allosteric regulation of UbcH5c and Ubc4 by E4B U box (PMID:20696396)
• data indicate that amplification and overexpression of UBE4B represent previously undescribed molecular mechanisms of inactivation of p53 in brain tumors (PMID:21317885)
• we found somatic mutations of HERC2, HERC3, TRIP12, UBE2Q1 and UBE4B genes in gastric carcinoma and colorectal carcinomas with microsatellite instability (PMID:22124266)
• The regulated expression of these UFD2a isoforms most likely imparts divergent functions that are important for myogenesis. (PMID:22174917)
• UBE4B-mediated growth factor receptor trafficking may contribute to the poor prognosis of patients who have neuroblastoma tumors with 1p36 deletions. (PMID:22990745)
• We propose a model in which the coordinated action of UBE4B, ESCRT-0, and the deubiquitinating enzyme USP8 enable the endosomal sorting and lysosomal degradation of the EGFR. (PMID:24344129)
• UBE4B regulates p53 in breast cancer (PMID:24587254)
• UBE4B overexpression promotes the oncogenic properties of HCC and is correlated with an unfavorable prognosis in HCC patients. (PMID:25557723)
• UBE4B promotes endogenous phospho-p53(S15) and phospho-p53(S392) degradation in response to gamma irradiation. UBE4B plays an important role in regulating phosphorylated p53 following DNA damage. (PMID:26673821)
• miR-1301 functions as a tumor suppressor that inhibits tumor cell migration and invasion in multiple human cancer cells by regulating the UBE4B-p53 pathway. (PMID:28483517)
• Phosphatase PGAM5 (phosphoglycerate mutase 5) and deubiquitinase OTUB1 (ovarian tumor domain containing ubiquitin aldehyde binding protein 1) were confirmed as E4B substrates, and beta-catenin and CDK4 (cyclin-dependent kinase 4) were confirmed as CHIP substrates. (PMID:29326975)
• neuroblastoma cells with low UBE4B levels were significantly more sensitive to combined EGFR and STAT5 inhibition than parental cells. These findings may have potential therapeutic implications for patients with 1p36 chromosome LOH and low tumor UBE4B expression. (PMID:31475882)
• UBE4B, a microRNA-9 target gene, promotes autophagy-mediated Tau degradation. (PMID:34078905)
• UBE4B promotes the development of lung adenocarcinoma by enhancing proliferation, migration and glycolysis via PP2A/AKT signaling. (PMID:35220170)
• Upregulated UBE4B expression correlates with poor prognosis and tumor immune infiltration in hepatocellular carcinoma. (PMID:36470669)
• A novel protein encoded by circUBE4B promotes progression of esophageal squamous cell carcinoma by augmenting MAPK/ERK signaling. (PMID:37264022)
• UBE4B interacts with the ITCH E3 ubiquitin ligase to induce Ku70 and c-FLIPL polyubiquitination and enhanced neuroblastoma apoptosis. (PMID:37957138)
• UBE4B regulates p27 expression in A549 NSCLC cells through regulating the interaction of HuR and the p27 5’ UTR. (PMID:38211530)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	ube4b	ENSDARG00000037017
mus_musculus	Ube4b	ENSMUSG00000028960
rattus_norvegicus	Ube4b	ENSRNOG00000014986
drosophila_melanogaster	Ube4B	FBGN0032467
caenorhabditis_elegans		WBGENE00006734

Paralogs (1): UBE4A (ENSG00000110344)

Protein

Protein identifiers

Ubiquitin conjugation factor E4 B — O95155 (reviewed: O95155)

Alternative names: Homozygously deleted in neuroblastoma 1, RING-type E3 ubiquitin transferase E4 B, Ubiquitin fusion degradation protein 2

All UniProt accessions (4): O95155, B1AQ61, K7EP75, K7ERA7

UniProt curated annotations — full annotation on UniProt →

Function. Ubiquitin-protein ligase that probably functions as an E3 ligase in conjunction with specific E1 and E2 ligases. May also function as an E4 ligase mediating the assembly of polyubiquitin chains on substrates ubiquitinated by another E3 ubiquitin ligase. May regulate myosin assembly in striated muscles together with STUB1 and VCP/p97 by targeting myosin chaperone UNC45B for proteasomal degradation.

Subunit / interactions. Interacts with VCP/p97. Interacts with STUB1/CHIP and UNC45B.

Subcellular location. Cytoplasm. Nucleus.

Tissue specificity. Expressed in differentiated myotubes (at protein level). Highest expression in ovary, testis, heart and skeletal muscle. Expression is low in colon, thymus and peripheral blood leukocytes. Almost undetectable in lung and spleen.

Post-translational modifications. Proteolytically cleaved by caspases during apoptosis. Cleaved efficiently at Asp-123 by caspase-6 and granzyme B. Cleaved with approximately 10-fold less efficiency at Asp-109 by caspase-3 and caspase-7.

Domain organisation. The U-box domain is required for the ubiquitin protein ligase activity.

Pathway. Protein modification; protein ubiquitination.

Miscellaneous. Expressed exclusively in mature striated muscle cells.

Similarity. Belongs to the ubiquitin conjugation factor E4 family.

Isoforms (4)

UniProt ID	Names	Canonical?
O95155-1	1	yes
O95155-2	2
O95155-3	3
O95155-4	4, UFD2a-7/7a, UFD2A-III

RefSeq proteins (3): NP_001099032, NP_001397673, NP_006039 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR003613	Ubox_domain	Domain
IPR013083	Znf_RING/FYVE/PHD	Homologous_superfamily
IPR019474	Ub_conjug_fac_E4_core	Domain
IPR045132	UBE4	Family

Pfam: PF04564, PF10408

Enzyme classification (BRENDA):

• EC 2.3.2.27 — RING-type E3 ubiquitin transferase (BRENDA: 28 organisms, 138 substrates, 10 inhibitors, 1 Km, 1 kcat entries)
• EC 2.3.2.B12 — (BRENDA: organisms, substrates, inhibitors, Km, kcat entries)

Substrate kinetics (BRENDA)

1 substrates with measured Km, best-characterized 1. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
[UBE2W]-S-UBIQUITINYL-L-CYSTEINE	0.3014	1

UniProt features (48 total): modified residue 15, compositionally biased region 8, splice variant 4, helix 4, turn 4, region of interest 3, mutagenesis site 3, site 2, strand 2, chain 1, domain 1, sequence variant 1

Structure

Experimental structures (PDB)

4 structures.

PDB	Method	Resolution (Å)
5O75	X-RAY DIFFRACTION	1.48
3L1X	X-RAY DIFFRACTION	2.6
3L1Z	X-RAY DIFFRACTION	3.17
2KRE	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O95155-F1	76.57	0.52

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (2): 109–110 (cleavage; by caspase-3 and caspase-7); 123–124 (cleavage; by caspase-6 and granzyme b)

Post-translational modifications (15): 1, 23, 31, 84, 88, 90, 101, 103, 105, 124, 238, 383, 803, 969, 1265

Mutagenesis-validated functional residues (3):

Position	Phenotype
109	abolishes cleavage by caspase-3 and caspase-7.
121	abolishes cleavage by caspase-6. no effect on cleavage by granzyme b.
123	abolishes cleavage by caspase-6 and granzyme b.

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 552 (showing top): GOBP_CARDIAC_CHAMBER_DEVELOPMENT, GOBP_RESPONSE_TO_NITROGEN_COMPOUND, GOBP_MUSCLE_TISSUE_DEVELOPMENT, MORF_MSH3, GOBP_HEART_TRABECULA_MORPHOGENESIS, GOBP_CARDIAC_CHAMBER_MORPHOGENESIS, TGCTGCT_MIR15A_MIR16_MIR15B_MIR195_MIR424_MIR497, GOBP_RESPONSE_TO_ENDOPLASMIC_RETICULUM_STRESS, MORF_BRCA1, MORF_ATRX, MAZ_Q6, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, GOBP_MACROMOLECULE_CATABOLIC_PROCESS, DARWICHE_SKIN_TUMOR_PROMOTER_DN, DARWICHE_PAPILLOMA_RISK_LOW_DN

GO Biological Process (13): protein polyubiquitination (GO:0000209), ventricular trabecula myocardium morphogenesis (GO:0003222), ubiquitin-dependent protein catabolic process (GO:0006511), protein monoubiquitination (GO:0006513), granzyme-mediated apoptotic signaling pathway (GO:0008626), response to UV (GO:0009411), neuron projection development (GO:0031175), ERAD pathway (GO:0036503), proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161), protein autoubiquitination (GO:0051865), protein ubiquitination (GO:0016567), protein catabolic process (GO:0030163), response to endoplasmic reticulum stress (GO:0034976)

GO Molecular Function (7): ATP binding (GO:0005524), enzyme binding (GO:0019899), ubiquitin-ubiquitin ligase activity (GO:0034450), ubiquitin-protein transferase activity (GO:0004842), protein binding (GO:0005515), transferase activity (GO:0016740), ubiquitin protein ligase activity (GO:0061630)

GO Cellular Component (3): ubiquitin ligase complex (GO:0000151), nucleus (GO:0005634), cytoplasm (GO:0005737)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
protein ubiquitination	4
proteasomal protein catabolic process	2
ventricular cardiac muscle tissue morphogenesis	1
heart trabecula morphogenesis	1
modification-dependent protein catabolic process	1
apoptotic signaling pathway	1
granzyme-mediated programmed cell death signaling pathway	1
response to light stimulus	1
neuron development	1
plasma membrane bounded cell projection organization	1
response to endoplasmic reticulum stress	1
response to chemical	1
ubiquitin-dependent protein catabolic process	1
protein modification by small protein conjugation	1
macromolecule catabolic process	1
protein metabolic process	1
cellular response to stress	1
adenyl ribonucleotide binding	1
purine ribonucleoside triphosphate binding	1
protein binding	1
ubiquitin protein ligase activity	1
ubiquitin-like protein transferase activity	1
binding	1
catalytic activity	1
ubiquitin-protein transferase activity	1
ubiquitin-like protein ligase activity	1
intracellular protein-containing complex	1
transferase complex	1
intracellular membrane-bounded organelle	1
intracellular anatomical structure	1
cellular anatomical structure	1

Protein interactions and networks

STRING

2514 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
UBE4B	VCP	P55072	979
UBE4B	NMNAT1	Q9HAN9	894
UBE4B	AFG2A	Q8NB90	893
UBE4B	STUB1	Q9UNE7	889
UBE4B	MDM2	Q00987	879
UBE4B	UBQLN1	Q9UMX0	869
UBE4B	UBQLN2	Q9UHD9	850
UBE4B	RAD23A	P54725	818
UBE4B	UFD1	Q92890	814
UBE4B	NPLOC4	Q8TAT6	759
UBE4B	NMNAT2	Q9BZQ4	739
UBE4B	PSMD4	P55036	711
UBE4B	ANKZF1	Q9H8Y5	706
UBE4B	HGS	O14964	700
UBE4B	UBE2J1	Q9Y385	696

IntAct

41 interactions, top by confidence:

A	B	Type	Score
ARL4C	RGS12	psi-mi:“MI:0914”(association)	0.640
TUBA4A	TXNDC9	psi-mi:“MI:0914”(association)	0.640
VCP	PRKN	psi-mi:“MI:0914”(association)	0.530
ANKRD22	ESYT2	psi-mi:“MI:0914”(association)	0.530
UBL7	UBE4B	psi-mi:“MI:0915”(physical association)	0.500
ATXN3	UBE4B	psi-mi:“MI:0407”(direct interaction)	0.440
	UBE4B	psi-mi:“MI:0915”(physical association)	0.400
EYA3	UBE4B	psi-mi:“MI:0915”(physical association)	0.400
ESR1	UBE4B	psi-mi:“MI:0915”(physical association)	0.370
CDKN2A	ACTN4	psi-mi:“MI:0914”(association)	0.350
UBXN1	PJA2	psi-mi:“MI:0914”(association)	0.350
Nsfl1c	UBR5	psi-mi:“MI:0914”(association)	0.350
Nsfl1c	UBE4B	psi-mi:“MI:0914”(association)	0.350
CTDP1	ESYT2	psi-mi:“MI:0914”(association)	0.350
RAF1	EIF3F	psi-mi:“MI:0914”(association)	0.350
PCDHA8	TMEM223	psi-mi:“MI:0914”(association)	0.350
DUSP16	MEIOC	psi-mi:“MI:0914”(association)	0.350
LRRC73	THAP12	psi-mi:“MI:0914”(association)	0.350
UBL7	DCX	psi-mi:“MI:0914”(association)	0.350
RAD23B	UBE4B	psi-mi:“MI:0914”(association)	0.350
CDC25A	UBE4B	psi-mi:“MI:0914”(association)	0.350
OR7A5	UBE4B	psi-mi:“MI:0914”(association)	0.350
NLRP10	UBE4B	psi-mi:“MI:0914”(association)	0.350
AMZ1	IFT56	psi-mi:“MI:0914”(association)	0.350
LRRC73	SLC27A2	psi-mi:“MI:0914”(association)	0.350
PCDHA8	C2CD2L	psi-mi:“MI:0914”(association)	0.350
ACKR3	PDE2A	psi-mi:“MI:0914”(association)	0.350
CXCR3	RIMOC1	psi-mi:“MI:0914”(association)	0.350
FPR1	NBAS	psi-mi:“MI:0914”(association)	0.350

BioGRID (201): TRIP12 (Reconstituted Complex), UBE4B (Affinity Capture-MS), RAD23A (Reconstituted Complex), UBE4B (Affinity Capture-MS), UBE4B (Affinity Capture-MS), UBE4B (Affinity Capture-Western), UBE4B (Affinity Capture-Western), FOXK1 (Co-fractionation), STUB1 (Co-fractionation), UBE4B (Co-fractionation), UBE4B (Co-fractionation), UBQLN1 (Co-fractionation), UBE4B (Affinity Capture-MS), UBE4B (Two-hybrid), UBE4B (Affinity Capture-MS)

ESM2 similar proteins: A0JP85, A1A5H6, A2AGH6, A5GFY4, A5YKK6, B1AY13, B4KJ11, E9Q8I9, O75448, O94915, O95155, P55824, Q0KK59, Q23658, Q24134, Q2PW47, Q2QCI8, Q4V8B3, Q5F3M0, Q5RCU2, Q5RFA0, Q5TBA9, Q60PC0, Q6GLR7, Q6GYQ0, Q6PI53, Q6ZQ08, Q7ZYV9, Q80TJ1, Q80X82, Q80YV3, Q8BHR2, Q8BL99, Q8IXH7, Q8R0Z2, Q8R1A4, Q922L6, Q92797, Q93074, Q96N67

Diamond homologs: O95155, P54860, Q09349, Q9ES00, Q9HE05, Q9LF41, O94941, A6HD62, Q5ZHY5, Q9SF15, Q9SVC6, Q9UNE7, Q9WUD1, A0AUS0, A2ZLU6, C6L7U1, D1FP53, D1FP57, E4NKF8, O22193, O23225, P0C6E7, Q0DR28, Q0IMG9, Q0WUF6, Q10FT0, Q3E9F5, Q3E9F6, Q3E9F7, Q5FVN8, Q5PNY6, Q5UQ40, Q5VRH9, Q5WA76, Q5ZMC3, Q681N2, Q683D5, Q6EUK7, Q84TG3, Q8GUG9

SIGNOR signaling

6 interactions.

A	Effect	B	Mechanism
Ub:E2	“up-regulates activity”	UBE4B	ubiquitination
UBE4B	“down-regulates quantity by destabilization”	ATXN3	polyubiquitination
UBE4B	“down-regulates quantity by destabilization”	PTTG1	polyubiquitination
UBE4B	“down-regulates quantity by destabilization”	TP53	polyubiquitination
UBE4B	“down-regulates quantity by destabilization”	MAPT	ubiquitination
UBE4B	“up-regulates activity”	FEZ1	polyubiquitination

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 59 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

GO biological processes:

GO term	Partners	Fold	FDR
positive regulation of cytosolic calcium ion concentration	6	13.0×	4e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

182 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	130
Likely benign	9
Benign	6

Top pathogenic / likely-pathogenic (0)

SpliceAI

6765 predictions. Top by Δscore:

Variant	Effect	Δscore
1:10049306:A:T	donor_gain	1.0000
1:10049317:C:G	donor_gain	1.0000
1:10072026:A:AG	acceptor_gain	1.0000
1:10072027:G:GG	acceptor_gain	1.0000
1:10072211:TCAGG:T	donor_loss	1.0000
1:10072212:CAGGT:C	donor_loss	1.0000
1:10072214:GGT:G	donor_loss	1.0000
1:10072215:GTAAG:G	donor_loss	1.0000
1:10072216:T:A	donor_loss	1.0000
1:10101105:A:AG	acceptor_gain	1.0000
1:10101106:A:G	acceptor_gain	1.0000
1:10101196:GTTG:G	donor_gain	1.0000
1:10102943:A:AG	acceptor_gain	1.0000
1:10102943:ACCAG:A	acceptor_gain	1.0000
1:10102944:C:G	acceptor_gain	1.0000
1:10102946:A:AG	acceptor_gain	1.0000
1:10102946:AG:A	acceptor_gain	1.0000
1:10102947:G:GC	acceptor_loss	1.0000
1:10102947:G:GG	acceptor_gain	1.0000
1:10102947:GG:G	acceptor_gain	1.0000
1:10102947:GGA:G	acceptor_gain	1.0000
1:10102947:GGAGC:G	acceptor_gain	1.0000
1:10103089:GAAG:G	donor_gain	1.0000
1:10105511:A:AG	acceptor_gain	1.0000
1:10105513:CAGTA:C	acceptor_loss	1.0000
1:10105514:A:AG	acceptor_gain	1.0000
1:10105514:AGTA:A	acceptor_loss	1.0000
1:10105515:G:GA	acceptor_gain	1.0000
1:10105515:G:T	acceptor_loss	1.0000
1:10105515:GT:G	acceptor_gain	1.0000

AlphaMissense

8583 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
1:10117551:T:C	L430P	1.000
1:10122036:T:C	L505P	1.000
1:10135079:T:A	V706D	1.000
1:10137199:T:C	L786P	1.000
1:10144974:T:A	W800R	1.000
1:10144974:T:C	W800R	1.000
1:10144976:G:C	W800C	1.000
1:10144976:G:T	W800C	1.000
1:10145035:T:C	L820P	1.000
1:10146980:G:C	K827N	1.000
1:10146980:G:T	K827N	1.000
1:10151430:C:A	A932D	1.000
1:10151442:A:T	E936V	1.000
1:10151450:T:C	F939L	1.000
1:10151452:T:A	F939L	1.000
1:10151452:T:G	F939L	1.000
1:10151544:T:C	L970P	1.000
1:10151552:T:C	F973L	1.000
1:10151554:T:A	F973L	1.000
1:10151554:T:G	F973L	1.000
1:10151555:T:G	Y974D	1.000
1:10158359:T:A	V977D	1.000
1:10158361:G:A	E978K	1.000
1:10158362:A:T	E978V	1.000
1:10158363:G:C	E978D	1.000
1:10158363:G:T	E978D	1.000
1:10158370:G:A	G981R	1.000
1:10158370:G:C	G981R	1.000
1:10158371:G:A	G981E	1.000
1:10158379:A:C	S984R	1.000

dbSNP variants (sampled 300 via entrez): RS1000017579 (1:10108318 C>G,T), RS1000021108 (1:10033425 C>G,T), RS1000031579 (1:10088462 G>A), RS1000092755 (1:10044387 G>A), RS1000117606 (1:10156521 C>T), RS1000154737 (1:10108049 G>T), RS1000162771 (1:10105886 T>A,C), RS1000170115 (1:10031202 G>T), RS1000174583 (1:10071163 C>T), RS1000183725 (1:10062179 A>G,T), RS1000192700 (1:10175341 CAGCACCTACTTAGAAAATAAA>C), RS1000213185 (1:10114099 C>G,T), RS1000226587 (1:10120825 A>C,G), RS1000236240 (1:10061900 ATCT>A), RS1000256182 (1:10154275 T>A)

Disease associations

OMIM: gene MIM:613565 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

99 total (30 of 99 shown, HPO-id order):

HPO	Term
HP:0000028	Cryptorchidism
HP:0000047	Hypospadias
HP:0000055	Abnormal female external genitalia morphology
HP:0000077	Abnormality of the kidney
HP:0000107	Renal cyst
HP:0000126	Hydronephrosis
HP:0000135	Hypogonadism
HP:0000160	Narrow mouth
HP:0000248	Brachycephaly
HP:0000252	Microcephaly
HP:0000270	Delayed cranial suture closure
HP:0000286	Epicanthus
HP:0000307	Pointed chin
HP:0000343	Long philtrum
HP:0000358	Posteriorly rotated ears
HP:0000405	Conductive hearing impairment
HP:0000407	Sensorineural hearing impairment
HP:0000431	Wide nasal bridge
HP:0000457	Depressed nasal ridge
HP:0000464	Abnormality of the neck
HP:0000486	Strabismus
HP:0000490	Deeply set eye
HP:0000504	Abnormality of vision
HP:0000505	Visual impairment
HP:0000518	Cataract
HP:0000534	Abnormal eyebrow morphology
HP:0000639	Nystagmus
HP:0000648	Optic atrophy
HP:0000708	Atypical behavior
HP:0000717	Autism

GWAS associations

11 associations (top):

Study	Trait	p-value
GCST000752_1	Hepatocellular carcinoma	2.000000e-18
GCST003818_38	Resting heart rate	1.000000e-07
GCST006061_147	Atrial fibrillation	1.000000e-10
GCST006061_148	Atrial fibrillation	1.000000e-10
GCST012146_7	Hemoglobin levels	2.000000e-06
GCST012227_1125	Hip circumference adjusted for BMI	3.000000e-08
GCST012490_114	Femur bone mineral density x serum urate levels interaction	1.000000e-08
GCST012490_578	Femur bone mineral density x serum urate levels interaction	4.000000e-11
GCST90020028_650	Hip circumference adjusted for BMI	5.000000e-12
GCST90020028_651	Hip circumference adjusted for BMI	4.000000e-09
GCST90020028_652	Hip circumference adjusted for BMI	7.000000e-09

EFO canonical traits (3, from GWAS)

EFO ID	Trait name
EFO:0004509	hemoglobin measurement
EFO:0008039	BMI-adjusted hip circumference
EFO:0004531	urate measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

40 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	increases mutagenesis, affects methylation, decreases expression, increases methylation	4
bisphenol A	decreases expression, increases expression	2
aristolochic acid I	decreases expression	1
FR900359	affects phosphorylation	1
triphenyl phosphate	affects expression	1
decabromobiphenyl ether	increases expression	1
beta-lapachone	increases expression	1
arsenite	decreases reaction, affects binding	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
butyraldehyde	decreases expression	1
tetrabromobisphenol A	decreases expression	1
benzo(e)pyrene	decreases methylation	1
coumarin	increases phosphorylation	1
perfluoro-n-nonanoic acid	increases expression	1
perfluorohexanesulfonic acid	increases expression	1
abrine	decreases expression	1
pentabrominated diphenyl ether 100	increases expression	1
hexabrominated diphenyl ether 153	increases expression	1
7-(benzylamino)-1,3,4,8-tetrahydropyrrolo(4,3,2-de)quinolin-8(1H)-one	decreases expression	1
Temozolomide	decreases expression	1
Arsenic Trioxide	increases expression	1
Leflunomide	decreases expression	1
Acetaminophen	decreases expression	1
Vehicle Emissions	increases abundance, increases expression	1
Caffeine	affects phosphorylation	1
Carbamazepine	affects expression	1
Cisplatin	decreases expression	1
Doxorubicin	decreases expression	1
Ivermectin	decreases expression	1
Methapyrilene	decreases methylation	1

Cellosaurus cell lines

2 cell lines: 2 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_TW00	HAP1 UBE4B (-) 1	Cancer cell line	Male
CVCL_TW01	HAP1 UBE4B (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.