UFSP1

Summary

UFSP1 (UFM1 specific peptidase 1, HGNC:33821) is a protein-coding gene on chromosome 7q22.1, encoding Ufm1-specific protease 1 (Q6NVU6). Thiol-dependent isopeptidase that specifically mediate the processing of UFM1 precursors as well as the deconjugation of UFM1 from target proteins.

This gene encodes a protein that is similar to other Ufm1-specific proteases. Studies in mouse determined that Ufsp1 releases Ufm1 (ubiquitin-fold modifier 1) from its bound conjugated complexes which also makes it into an active form. Because the human UFSP1 protein is shorter on the N-terminus and lacks a conserved Cys active site, it is predicted to be non-functional.

Source: NCBI Gene 402682 — RefSeq curated summary.

At a glance

• GWAS associations: 28
• Clinical variants (ClinVar): 44 total
• MANE Select transcript: NM_001430944

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:33821
Approved symbol	UFSP1
Name	UFM1 specific peptidase 1
Location	7q22.1
Locus type	gene with protein product
Status	Approved
Aliases	UFSP
Ensembl gene	ENSG00000176125
Ensembl biotype	protein_coding
OMIM	611481
Entrez	402682

Gene structure

Transcript identifiers

Ensembl transcripts: 2 — 2 protein_coding

ENST00000388761, ENST00000672365

RefSeq mRNA: 2 — MANE Select: NM_001430944 NM_001015072, NM_001430944

CCDS: CCDS34710

Canonical transcript exons

ENST00000672365 — 1 exons

Exon	Start	End
ENSE00001503871	100888721	100889715

Expression profiles

Bgee: expression breadth ubiquitous, 130 present calls, max score 91.40.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 3.6998 / max 50.4105, expressed in 1433 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
85251	3.6998	1433

Top tissues by expression

132 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	91.40	gold quality
hindlimb stylopod muscle	UBERON:0004252	72.87	gold quality
stromal cell of endometrium	CL:0002255	72.74	gold quality
gastrocnemius	UBERON:0001388	72.21	gold quality
muscle of leg	UBERON:0001383	71.65	gold quality
mucosa of transverse colon	UBERON:0004991	71.05	gold quality
right adrenal gland cortex	UBERON:0035827	70.53	gold quality
granulocyte	CL:0000094	69.57	gold quality
right adrenal gland	UBERON:0001233	69.26	gold quality
left adrenal gland cortex	UBERON:0035825	68.99	gold quality
left adrenal gland	UBERON:0001234	68.64	gold quality
skeletal muscle tissue	UBERON:0001134	68.40	gold quality
right lobe of liver	UBERON:0001114	67.07	gold quality
muscle tissue	UBERON:0002385	66.46	gold quality
apex of heart	UBERON:0002098	66.41	gold quality
lower esophagus muscularis layer	UBERON:0035833	66.38	gold quality
lower esophagus	UBERON:0013473	66.37	gold quality
adrenal gland	UBERON:0002369	66.29	gold quality
left coronary artery	UBERON:0001626	66.23	gold quality
right coronary artery	UBERON:0001625	66.14	gold quality
body of pancreas	UBERON:0001150	65.82	gold quality
islet of Langerhans	UBERON:0000006	65.67	gold quality
pancreas	UBERON:0001264	65.54	gold quality
fundus of stomach	UBERON:0001160	65.47	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	65.41	gold quality
adult mammalian kidney	UBERON:0000082	64.88	gold quality
left uterine tube	UBERON:0001303	64.88	gold quality
esophagus	UBERON:0001043	64.45	gold quality
muscle layer of sigmoid colon	UBERON:0035805	64.25	gold quality
liver	UBERON:0002107	64.13	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	0.84

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

9 targeting UFSP1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4795-3P	100.00	74.62	4024
HSA-MIR-126-5P	100.00	72.71	3180
HSA-MIR-6799-5P	99.14	65.72	2093
HSA-MIR-4277	98.34	67.17	1323
HSA-MIR-4797-3P	97.48	67.14	989
HSA-MIR-3173-5P	97.35	65.82	1282
HSA-MIR-6799-3P	97.35	65.60	1302
HSA-MIR-4264	96.35	64.76	1480
HSA-MIR-4740-3P	91.27	64.89	113

Literature-anchored findings (GeneRIF, showing 2)

• Human UFSP1 translated from an upstream near-cognate initiation codon functions as an active UFM1-specific protease. (PMID:35525273)
• Human UFSP1 is an active protease that regulates UFM1 maturation and UFMylation. (PMID:35926457)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	ufsp1	ENSDARG00000061610
mus_musculus	Ufsp1	ENSMUSG00000051502
rattus_norvegicus	Ufsp1	ENSRNOG00000051006
drosophila_melanogaster	Ufsp1	FBGN0050157

Paralogs (1): UFSP2 (ENSG00000109775)

Protein

Protein identifiers

Ufm1-specific protease 1 — Q6NVU6 (reviewed: Q6NVU6)

All UniProt accessions (2): A0AAR1ZLH9, Q6NVU6

UniProt curated annotations — full annotation on UniProt →

Function. Thiol-dependent isopeptidase that specifically mediate the processing of UFM1 precursors as well as the deconjugation of UFM1 from target proteins. Mainly responsible for the maturation of the UFM1 precursor, a prerequisite for conjugation reactions.

Subcellular location. Cytoplasm. Cytosol.

Similarity. Belongs to the peptidase C78 family.

RefSeq proteins (2): NP_001015072, NP_001417873* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR012462	UFSP1/2_DUB_cat	Domain

Pfam: PF07910

UniProt features (6 total): active site 3, chain 1, sequence variant 1, mutagenesis site 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q6NVU6-F1	92.27	0.80

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (3): 45; 167; 169

Mutagenesis-validated functional residues (1):

Position	Phenotype
45	abolished isopeptidase activity.

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 53 (showing top): GSE45365_CD8A_DC_VS_CD11B_DC_IFNAR_KO_MCMV_INFECTION_DN, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_UP, GRAESSMANN_RESPONSE_TO_MC_AND_DOXORUBICIN_UP, GOBP_PROTEIN_MATURATION, GOMF_CYSTEINE_TYPE_PEPTIDASE_ACTIVITY, GOBP_POST_TRANSLATIONAL_PROTEIN_MODIFICATION, GOBP_PROTEOLYSIS, GOMF_PEPTIDASE_ACTIVITY, GOMF_UBIQUITIN_LIKE_PROTEIN_PEPTIDASE_ACTIVITY, GOBP_PROTEIN_UFMYLATION, ALKBH3_TARGET_GENES, DIDO1_TARGET_GENES, GREB1_TARGET_GENES, MEF2D_TARGET_GENES, SALL4_TARGET_GENES

GO Biological Process (3): proteolysis (GO:0006508), protein maturation (GO:0051604), protein ufmylation (GO:0071569)

GO Molecular Function (5): cysteine-type peptidase activity (GO:0008234), deUFMylase activity (GO:0071567), protein binding (GO:0005515), peptidase activity (GO:0008233), hydrolase activity (GO:0016787)

GO Cellular Component (2): cytosol (GO:0005829), cytoplasm (GO:0005737)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
protein metabolic process	2
cellular anatomical structure	2
gene expression	1
protein modification by small protein conjugation	1
peptidase activity	1
cysteine-type peptidase activity	1
ubiquitin-like protein peptidase activity	1
binding	1
hydrolase activity	1
catalytic activity, acting on a protein	1
catalytic activity	1
cytoplasm	1
intracellular anatomical structure	1

Protein interactions and networks

STRING

350 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
UFSP1	UFM1	P61960	985
UFSP1	UBA5	Q9GZZ9	815
UFSP1	UFC1	Q9Y3C8	810
UFSP1	UFL1	O94874	808
UFSP1	DDRGK1	Q96HY6	787
UFSP1	CDK5RAP3	Q96JB5	586
UFSP1	TRIP4	Q15650	468
UFSP1	ODR4	Q5SWX8	449
UFSP1	HSPA12A	O43301	440
UFSP1	SLC12A9	Q9BXP2	425
UFSP1	TIGD4	Q8IY51	405
UFSP1	GRAMD1B	Q3KR37	392
UFSP1	NEDD8	Q15843	377
UFSP1	SLC35F1	Q5T1Q4	370
UFSP1	ARRDC2	Q8TBH0	346
UFSP1	PPIL1	Q9Y3C6	346

IntAct

127 interactions, top by confidence:

A	B	Type	Score
VAC14	UFSP1	psi-mi:“MI:0915”(physical association)	0.560
UFSP1	UBQLN2	psi-mi:“MI:0915”(physical association)	0.560
UFSP1	COG6	psi-mi:“MI:0915”(physical association)	0.560
UFSP1	TCF7L2	psi-mi:“MI:0915”(physical association)	0.560
UFSP1	GLYCTK	psi-mi:“MI:0915”(physical association)	0.560
ZIC1	UFSP1	psi-mi:“MI:0915”(physical association)	0.560
UFSP1	WWOX	psi-mi:“MI:0915”(physical association)	0.560
SNRPC	UFSP1	psi-mi:“MI:0915”(physical association)	0.560
TLX3	UFSP1	psi-mi:“MI:0915”(physical association)	0.560
CREB5	UFSP1	psi-mi:“MI:0915”(physical association)	0.560
C10orf55	UFSP1	psi-mi:“MI:0915”(physical association)	0.560
UFSP1	MSRB3	psi-mi:“MI:0915”(physical association)	0.560
FOXH1	UFSP1	psi-mi:“MI:0915”(physical association)	0.560
CSTF2	UFSP1	psi-mi:“MI:0915”(physical association)	0.560
UFSP1	RUSC1	psi-mi:“MI:0915”(physical association)	0.560
UFSP1	HSF4	psi-mi:“MI:0915”(physical association)	0.560
UFSP1	MYOZ3	psi-mi:“MI:0915”(physical association)	0.560
UFSP1	FANCL	psi-mi:“MI:0915”(physical association)	0.560
UFSP1	FAM222B	psi-mi:“MI:0915”(physical association)	0.560
UFSP1	VAX2	psi-mi:“MI:0915”(physical association)	0.560
VPS37C	UFSP1	psi-mi:“MI:0915”(physical association)	0.560
UFSP1	SPG21	psi-mi:“MI:0915”(physical association)	0.560
UFSP1	RBPMS2	psi-mi:“MI:0915”(physical association)	0.560
PITX1	UFSP1	psi-mi:“MI:0915”(physical association)	0.560
UFSP1	CIDEC	psi-mi:“MI:0915”(physical association)	0.560
POGZ	UFSP1	psi-mi:“MI:0915”(physical association)	0.560
VGLL3	UFSP1	psi-mi:“MI:0915”(physical association)	0.560
LASP1	UFSP1	psi-mi:“MI:0915”(physical association)	0.560
POU6F2	UFSP1	psi-mi:“MI:0915”(physical association)	0.560
UFSP1	SMARCC1	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (48): UFSP1 (Affinity Capture-MS), UFSP1 (Affinity Capture-RNA), UFSP1 (Two-hybrid), UFSP1 (Two-hybrid), UFSP1 (Two-hybrid), UFSP1 (Two-hybrid), UFSP1 (Two-hybrid), UFSP1 (Two-hybrid), UFSP1 (Two-hybrid), UFSP1 (Two-hybrid), UFSP1 (Two-hybrid), UFSP1 (Two-hybrid), UFSP1 (Two-hybrid), UFSP1 (Two-hybrid), UFSP1 (Two-hybrid)

ESM2 similar proteins: A0A1D5AG16, A0A1U8QK63, A1L251, A3KPF2, A5DEF7, A6ZRL7, A7KAI3, I1R9A6, I1S489, M2XHU6, O13979, O14349, O15056, O55207, P53867, Q00706, Q2TXG3, Q3SWY8, Q3T9Z9, Q4R4A2, Q4V6M7, Q5AV07, Q5U2S3, Q5XIB4, Q5ZIF3, Q68FJ9, Q6CQ60, Q6NVU6, Q754C9, Q759K3, Q75E61, Q7T347, Q7YTB0, Q8CIG3, Q8S929, Q8TGA1, Q8TGA2, Q96AP4, Q99K23, Q9CZP0

Diamond homologs: Q0INW1, Q2M1D1, Q3B8N0, Q4V6M7, Q5RCS9, Q5XIB4, Q5ZIF3, Q61UA0, Q6NVU6, Q7T347, Q94218, Q99K23, Q9CZP0, Q9NUQ7, Q9STL8, Q9VUR0

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 40 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

GO biological processes:

GO term	Partners	Fold	FDR
central nervous system development	5	16.0×	1e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

44 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	43
Likely benign	1
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

219 predictions. Top by Δscore:

Variant	Effect	Δscore
7:100889579:T:TA	donor_gain	0.9500
7:100889484:C:A	donor_gain	0.9100
7:100889543:T:TA	donor_gain	0.8800
7:100889540:T:TA	donor_gain	0.8400
7:100889580:C:A	donor_gain	0.8300
7:100889483:T:TA	donor_gain	0.8200
7:100889177:C:A	donor_gain	0.7500
7:100889154:C:A	donor_gain	0.7100
7:100889560:G:GT	donor_gain	0.6400
7:100889476:G:C	donor_gain	0.6300
7:100888929:CCT:C	donor_gain	0.6000
7:100889153:C:CA	donor_gain	0.6000
7:100889490:G:C	donor_gain	0.6000
7:100889657:A:AC	donor_gain	0.6000
7:100889384:T:TA	donor_gain	0.5800
7:100889273:T:TA	donor_gain	0.5600
7:100888945:C:T	donor_gain	0.5300
7:100889021:T:TA	donor_gain	0.5300
7:100889045:C:CA	donor_gain	0.5300
7:100888875:TAAGG:T	acceptor_gain	0.5200
7:100888923:CACT:C	donor_loss	0.5200
7:100888924:ACTC:A	donor_loss	0.5200
7:100888925:CT:C	donor_loss	0.5200
7:100888926:TCAC:T	donor_loss	0.5200
7:100888927:CA:C	donor_loss	0.5200
7:100888928:A:AT	donor_loss	0.5200
7:100888929:C:CT	donor_loss	0.5200
7:100889058:TGG:T	donor_gain	0.5200
7:100889101:ACCC:A	donor_gain	0.5200
7:100889102:CCCC:C	donor_gain	0.5200

AlphaMissense

1388 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
7:100888900:G:C	F124L	0.985
7:100888900:G:T	F124L	0.985
7:100888902:A:G	F124L	0.985
7:100888936:C:A	W112C	0.954
7:100888936:C:G	W112C	0.954
7:100889090:A:T	V61D	0.953
7:100888938:A:G	W112R	0.946
7:100888938:A:T	W112R	0.946
7:100889260:C:A	K4N	0.944
7:100889260:C:G	K4N	0.944
7:100889248:G:C	F8L	0.940
7:100889248:G:T	F8L	0.940
7:100889250:A:G	F8L	0.940
7:100889216:T:A	E19V	0.934
7:100888915:A:C	F119L	0.933
7:100888915:A:T	F119L	0.933
7:100888917:A:G	F119L	0.933
7:100889111:A:G	F54S	0.929
7:100889110:G:C	F54L	0.924
7:100889110:G:T	F54L	0.924
7:100889112:A:G	F54L	0.924
7:100889230:C:A	W14C	0.918
7:100889230:C:G	W14C	0.918
7:100889056:C:A	K72N	0.917
7:100889056:C:G	K72N	0.917
7:100888894:G:C	N126K	0.910
7:100888894:G:T	N126K	0.910
7:100889205:A:G	C23R	0.906
7:100889232:A:G	W14R	0.905
7:100889232:A:T	W14R	0.905

dbSNP variants (sampled 300 via entrez): RS1001371809 (7:100890193 G>A,C,T), RS1001462526 (7:100888307 G>GC), RS1001781956 (7:100890465 G>A), RS1002048627 (7:100888560 G>A,C), RS1003155208 (7:100891475 G>T), RS1003824943 (7:100890699 C>A,T), RS1005158947 (7:100889887 G>A), RS1005230944 (7:100889715 T>C,G), RS1005728419 (7:100890771 C>T), RS1005924961 (7:100889736 G>A,C,T), RS1006105662 (7:100891156 G>A,T), RS1006693552 (7:100889925 C>A,T), RS1007240405 (7:100890159 A>G), RS1008053169 (7:100888738 A>G), RS1008072762 (7:100889264 TCGCCCATGTCCTCCAGGGC>T)

Disease associations

OMIM: gene MIM:611481 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

28 associations (top):

Study	Trait	p-value
GCST000731_3	Resting heart rate	2.000000e-08
GCST001684_4	Plasminogen activator inhibitor type 1 levels (PAI-1)	6.000000e-13
GCST003818_36	Resting heart rate	1.000000e-41
GCST005789_13	Resting heart rate	7.000000e-15
GCST005845_4	Heart rate increase in response to exercise	3.000000e-16
GCST005847_9	Heart rate response to recovery post exercise (20 sec)	3.000000e-21
GCST005848_15	Heart rate response to recovery post exercise (50 sec)	4.000000e-23
GCST005849_14	Heart rate response to recovery post exercise (40 sec)	6.000000e-24
GCST005850_6	Heart rate response to recovery post exercise (30 sec)	8.000000e-23
GCST007250_7	Nonunion in individuals with fractures	3.000000e-07
GCST008103_164	Bipolar disorder	7.000000e-06
GCST010796_3335	Electrocardiogram morphology (amplitude at temporal datapoints)	1.000000e-08
GCST010796_3336	Electrocardiogram morphology (amplitude at temporal datapoints)	1.000000e-09
GCST010796_3337	Electrocardiogram morphology (amplitude at temporal datapoints)	1.000000e-09
GCST010796_3338	Electrocardiogram morphology (amplitude at temporal datapoints)	9.000000e-09
GCST010796_3339	Electrocardiogram morphology (amplitude at temporal datapoints)	3.000000e-08
GCST010796_3340	Electrocardiogram morphology (amplitude at temporal datapoints)	3.000000e-08
GCST010796_3341	Electrocardiogram morphology (amplitude at temporal datapoints)	2.000000e-08
GCST010796_3342	Electrocardiogram morphology (amplitude at temporal datapoints)	3.000000e-08
GCST010796_3343	Electrocardiogram morphology (amplitude at temporal datapoints)	2.000000e-08
GCST010796_3344	Electrocardiogram morphology (amplitude at temporal datapoints)	6.000000e-09
GCST010796_3345	Electrocardiogram morphology (amplitude at temporal datapoints)	8.000000e-10
GCST010796_5245	Electrocardiogram morphology (amplitude at temporal datapoints)	8.000000e-10
GCST010796_5330	Electrocardiogram morphology (amplitude at temporal datapoints)	1.000000e-08
GCST010796_5331	Electrocardiogram morphology (amplitude at temporal datapoints)	2.000000e-09
GCST010796_5332	Electrocardiogram morphology (amplitude at temporal datapoints)	3.000000e-09
GCST010796_5333	Electrocardiogram morphology (amplitude at temporal datapoints)	3.000000e-09
GCST010796_5334	Electrocardiogram morphology (amplitude at temporal datapoints)	1.000000e-09

EFO canonical traits (5, from GWAS)

EFO ID	Trait name
EFO:0004792	plasminogen activator inhibitor 1 measurement
EFO:0009184	heart rate response to exercise
EFO:0009185	heart rate response to recovery post exercise
EFO:0009707	fractures, ununited
EFO:0004327	electrocardiography

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

13 total (human), top 13 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sotorasib	affects cotreatment, increases expression	1
ferrous chloride	decreases expression	1
di-n-butylphosphoric acid	affects expression	1
jinfukang	increases expression	1
trametinib	affects cotreatment, increases expression	1
NVP-BKM120	affects cotreatment, increases expression	1
Sunitinib	increases expression	1
Benzo(a)pyrene	affects methylation, decreases methylation	1
Dimethyl Sulfoxide	affects expression	1
Smoke	decreases expression	1
Thiram	decreases expression	1
Urethane	decreases expression	1
Valproic Acid	increases methylation	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.