UNG

Summary

UNG (uracil DNA glycosylase, HGNC:12572) is a protein-coding gene on chromosome 12q24.11, encoding Uracil-DNA glycosylase (P13051). Uracil-DNA glycosylase that hydrolyzes the N-glycosidic bond between uracil and deoxyribose in single- and double-stranded DNA (ssDNA and dsDNA) to release a free uracil residue and form an abasic (apurinic/apyrimidinic; AP) site.

This gene encodes one of several uracil-DNA glycosylases. One important function of uracil-DNA glycosylases is to prevent mutagenesis by eliminating uracil from DNA molecules by cleaving the N-glycosylic bond and initiating the base-excision repair (BER) pathway. Uracil bases occur from cytosine deamination or misincorporation of dUMP residues. Alternative promoter usage and splicing of this gene leads to two different isoforms: the mitochondrial UNG1 and the nuclear UNG2. The UNG2 term was used as a previous symbol for the CCNO gene (GeneID 10309), which has been confused with this gene, in the literature and some databases.

Source: NCBI Gene 7374 — RefSeq curated summary.

At a glance

• Gene–disease (curated): hyper-IgM syndrome type 5 (Strong, GenCC)
• GWAS associations: 4
• Clinical variants (ClinVar): 306 total — 15 pathogenic, 7 likely-pathogenic
• Phenotypes (HPO): 11
• Druggable target: yes
• MANE Select transcript: NM_080911

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:12572
Approved symbol	UNG
Name	uracil DNA glycosylase
Location	12q24.11
Locus type	gene with protein product
Status	Approved
Aliases	UDG, UNG1, UNG2, HIGM4
Ensembl gene	ENSG00000076248
Ensembl biotype	protein_coding
OMIM	191525
Entrez	7374

Gene structure

Transcript identifiers

Ensembl transcripts: 18 — 10 protein_coding, 7 nonsense_mediated_decay, 1 retained_intron

ENST00000242576, ENST00000336865, ENST00000446767, ENST00000539287, ENST00000540158, ENST00000699559, ENST00000699560, ENST00000699561, ENST00000699562, ENST00000699563, ENST00000699564, ENST00000699565, ENST00000699566, ENST00000699567, ENST00000931116, ENST00000931117, ENST00000931118, ENST00000931119

RefSeq mRNA: 2 — MANE Select: NM_080911 NM_003362, NM_080911

CCDS: CCDS9124, CCDS9125

Canonical transcript exons

ENST00000242576 — 7 exons

Exon	Start	End
ENSE00000754701	109099189	109099284
ENSE00000754703	109101902	109101999
ENSE00001130047	109097597	109097811
ENSE00003495683	109109829	109110992
ENSE00003589074	109098432	109098638
ENSE00003623858	109103433	109103611
ENSE00003662571	109102839	109102927

Expression profiles

Bgee: expression breadth ubiquitous, 293 present calls, max score 99.54.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 39.3928 / max 273.3020, expressed in 1769 samples.

FANTOM5 promoters (7 alternative TSS)

Promoter ID	TPM avg	Samples expressed
127912	22.5042	1265
127915	11.9902	1745
127913	3.8601	948
127918	0.3467	165
127916	0.3206	151
127914	0.1923	82
127917	0.1788	55

Top tissues by expression

301 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
secondary oocyte	CL:0000655	99.54	gold quality
oocyte	CL:0000023	99.04	gold quality
right adrenal gland cortex	UBERON:0035827	95.87	gold quality
right adrenal gland	UBERON:0001233	95.77	gold quality
endometrium epithelium	UBERON:0004811	95.48	gold quality
adrenal tissue	UBERON:0018303	95.04	gold quality
ventricular zone	UBERON:0003053	94.99	gold quality
adrenal cortex	UBERON:0001235	94.86	gold quality
embryo	UBERON:0000922	94.70	gold quality
left adrenal gland	UBERON:0001234	94.64	gold quality
renal medulla	UBERON:0000362	94.61	gold quality
ganglionic eminence	UBERON:0004023	94.48	gold quality
left adrenal gland cortex	UBERON:0035825	94.35	gold quality
adrenal gland	UBERON:0002369	94.20	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	94.15	gold quality
mucosa of transverse colon	UBERON:0004991	93.58	gold quality
nipple	UBERON:0002030	93.04	gold quality
penis	UBERON:0000989	92.43	gold quality
sperm	CL:0000019	91.62	gold quality
gastrocnemius	UBERON:0001388	91.58	gold quality
cervix squamous epithelium	UBERON:0006922	91.33	silver quality
pharyngeal mucosa	UBERON:0000355	91.32	gold quality
rectum	UBERON:0001052	91.29	gold quality
muscle of leg	UBERON:0001383	90.99	gold quality
male germ cell	CL:0000015	90.47	silver quality
skin of abdomen	UBERON:0001416	90.44	gold quality
apex of heart	UBERON:0002098	90.42	gold quality
hindlimb stylopod muscle	UBERON:0004252	90.36	gold quality
skin of leg	UBERON:0001511	90.22	gold quality
gingival epithelium	UBERON:0001949	90.04	gold quality

Single-cell (SCXA)

Detected in 8 experiment(s), a significant marker in 3.

Experiment	Marker?	Max mean expression
E-MTAB-10432	yes	135.01
E-MTAB-9388	yes	11.36
E-ANND-3	yes	7.54
E-MTAB-6911	no	528.39
E-MTAB-7008	no	455.23
E-MTAB-6524	no	181.24
E-MTAB-6142	no	152.65
E-CURD-112	no	3.84

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): E2F1, E2F4, MYC, SP1, TCF3, TFAP2A, TP53

miRNA regulators (miRDB)

42 targeting UNG, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-548AN	99.97	70.91	2817
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-5688	99.96	73.23	4504
HSA-MIR-495-3P	99.96	72.81	4197
HSA-MIR-3682-5P	99.93	67.97	1163
HSA-MIR-145-5P	99.92	71.13	1836
HSA-MIR-652-5P	99.91	67.49	505
HSA-MIR-30A-3P	99.87	69.74	2928
HSA-MIR-30D-3P	99.87	69.92	2917
HSA-MIR-30E-3P	99.87	69.68	2942
HSA-MIR-4668-5P	99.79	70.58	3782
HSA-MIR-1299	99.77	71.24	2389
HSA-MIR-3617-5P	99.75	69.41	1968
HSA-MIR-641	99.75	69.35	1975
HSA-MIR-6762-3P	99.66	66.94	1188
HSA-MIR-3679-3P	99.64	69.88	1599
HSA-MIR-875-3P	99.63	69.47	2548
HSA-MIR-3120-3P	99.54	70.28	2669
HSA-MIR-186-3P	99.51	66.24	1685
HSA-MIR-3128	99.50	67.85	1258
HSA-MIR-3678-3P	99.31	67.10	1432
HSA-MIR-324-3P	99.26	66.31	1034
HSA-MIR-877-3P	99.09	68.10	1637
HSA-MIR-6814-5P	99.03	66.68	1273
HSA-MIR-6760-5P	98.87	66.73	1515
HSA-MIR-4684-3P	98.24	69.91	1075
HSA-MIR-6882-3P	98.23	67.01	1119

Literature-anchored findings (GeneRIF, showing 40)

• crystal structure of free and DNA-bound enzyme (PMID:12136137)
• UNG2 is the major enzyme for removal of deaminated cytosine outside of replication foci in single stranded DNA (PMID:12161446)
• Data report the characterization of a functional homologue (ung1) from Schizosaccharomyces pombe of the human uracil-DNA-glycosylase 2 (UNG2) gene. (PMID:12810074)
• Nuclear uracil-DNA glycosylase expression was induced in activated B cells. (PMID:12958596)
• crystallization reveals example of geometric strain, least atomic motion, and electrophile migration in biological catalysis (PMID:14580190)
• Showed that UDG1A protein levels decrease during the S phase of the cell cycle and that it’s in the ubiquitin-conjugated form when proteolysis is inhibited by inhibitors of proteosomal dependent protein degradation. (PMID:15084312)
• While nuclear base excision repair protein levels and activities were generally not altered in rho(0) cells, AP endonuclease activity was substantially reduced in nuclear and in whole cell extracts (PMID:15107486)
• Data demonstrate that p53-induced phosphatase PPM1D interacts with the nuclear isoform of uracil DNA glycosylase, UNG2, and suppresses base excision repair. (PMID:15327777)
• Data show that uracil-DNA glycosylase uses a processive search mechanism to locate successive uracil residues, and Arg(276) mutations did not alter this attribute. (PMID:15339922)
• B cells from hyper-IgM patients carrying UNG mutations lack ability to remove uracil from ssDNA and have elevated genomic uracil. (PMID:15967827)
• The results indicated that there was a correlation between high level of UNG expression and the carcinogenesis of esophageal squamous cell carcinoma. (PMID:15969084)
• Mutations at Arg276 effectively transform UNG into a single-stranded DNA-specific uracil-DNA glycosylase. (PMID:15970468)
• The results of this study support the premise that UNG can be used as a potential therapeutic target and also demonstrate that protein transduction can be used to modulate UNG activity. (PMID:16005850)
• purified preparations of UNG2 and PCNA were used to demonstrate that UNG2 physically associates with PCNA. (PMID:16216562)
• UNG2 binds to the carboxyl terminus of latency-associated nuclear antigen of Kaposi’s sarcoma-associated herpesvirus and retains its enzymatic activity in the complex.[UNG2] (PMID:16928741)
• An additional determinant of fluorodeoxyuridine toxicity in the base excision repair pathway. (PMID:16951200)
• A novel missense variant C262T was found in familial colorectal cancer DNA suggesting a limited role for this gene in the devlopment of CRC. (PMID:17029639)
• The upregulation of mRNA for mitochondrial UNG1 after oxidative stress indicates that it may have an important role in repair of oxidized pyrimidines. (PMID:17101234)
• the degradation of APOBEC3G-edited viral DNA mediated by virion-associated UNG2 and APE during or after reverse transcription could be partially responsible for the potent anti-HIV-1 effect by APOBEC3G in the absence of vif (PMID:17272283)
• the interaction with DDB1 mediates Vpr-induced apoptosis and UNG2/SMUG1 degradation and impairs the repair of UV-damaged DNA, which could account for G(2) arrest and apoptosis (PMID:17360488)
• SMUG1 and UNG2 coordinate the initial steps in base excision repair of U:G mismatches by different molecular mechanisms. (PMID:17537817)
• for the human and Escherichia coli UNG enzymes, discrimination of thymine and uracil is initiated by thermally induced opening of T*A and U*A base pairs and not by active participation of the enzyme (PMID:17704764)
• More global salt bridges are found in human uracil DNA glycosylase (UDG) and are more stabilizing when compared to cod UDG, possibly playing a role in maintaining overall stability and reducing conformational entropy. (PMID:18004790)
• Phosphorylation regulates cellular turnover of the UNG2 protein, association with replication protein A (RPA), and modulates catalytic activity. (PMID:18079698)
• The binding free energies obtained reveal that the Michaelis-Menten complex is more stable for cod UNG, due to enhanced electrostatic properties, suggesting that energetic fine-tuning of electrostatics can be utilized for enzymatic temperature adaptation. (PMID:18196298)
• AID and Ung generate staggered double-strand DNA breaks (DSBs) not only by cleaving intact double-strand DNA, but also by processing blunt DSB ends. (PMID:18760480)
• Human ribosomal protein S3 (hRpS3) interacts with uracil-DNA glycosylase (hUNG) and stimulates its glycosylase activity. (PMID:18973764)
• in the absence of CD40-CD154 interactions, there is a marked reduction in SHM and, specifically, mutations of AICDA-targeted G residues in RGYW motifs along with a decrease in transversions normally related to UNG2 activity. (PMID:19023113)
• the Vpr-induced decrease of UNG2 level is mainly related to a transcriptional effect (PMID:19625402)
• siRNA-mediated knockdown of UNG expression significantly reduced the uracil-excising activity of UNG in human prostate cancer cells, which was associated with DNA damage. (PMID:19671688)
• Data indicate that the activity of UDG likely requires “trapping” transiently exposed states arising from the rotational dynamics of DNA on histones. (PMID:20176960)
• X4 and R5 HIV-1 have distinct post-entry requirements for uracil DNA glycosylase during infection of primary cells (PMID:20371602)
• XRCC1 complexes performed complete repair of uracil with higher efficacy than UNG2 complexes. (PMID:20466601)
• UNG specifically interacts with Vpr forming a heterotrimeric complex with DCAF1. (PMID:20870715)
• UNG2 colocalizes with CENP-A and H2AX phosphorylation at centromeres in normally cycling cells. (PMID:21399697)
• analysis of species specific differences between mouse and humans in regulation of SMUG1 and UNG2 (PMID:21454529)
• Study of the role of histidine-148 provides additional support for inclusion of this amino acid in the list of residues (aspartate-145 and His-268) essential to the chemical step of the UNG2 complete mechanism. (PMID:21473605)
• the first thermal stability analysis of Atlantic cod cUNG and human UNG by differential scanning calorimetry, is reported. (PMID:21959147)
• measured paramagnetic relaxation enhancements reveal dynamic hot spots in uracil DNA glycosylase that are highly correlated with substrate binding and recognition (PMID:22077282)
• A comparison of haplotype frequencies between the case and the control revealed that rheumatoid arthritis patients with the Ht2 haplotype are at additional risk for rheumatoid arthritis development (PMID:22138674)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	unga	ENSDARG00000042527
danio_rerio	ungb	ENSDARG00000094922
mus_musculus	Ung	ENSMUSG00000029591
rattus_norvegicus	Ung	ENSRNOG00000000692
caenorhabditis_elegans		WBGENE00013241

Protein

Protein identifiers

Uracil-DNA glycosylase — P13051 (reviewed: P13051)

All UniProt accessions (13): P13051, A0A8V8TNE1, A0A8V8TNJ5, A0A8V8TNW2, A0A8V8TNW7, A0A8V8TPS1, A0A8V8TPS7, A0A8V8TQ66, A0A8V8TQ70, E5KTA5, E5KTA6, F5GYA2, Q68DM5

UniProt curated annotations — full annotation on UniProt →

Function. Uracil-DNA glycosylase that hydrolyzes the N-glycosidic bond between uracil and deoxyribose in single- and double-stranded DNA (ssDNA and dsDNA) to release a free uracil residue and form an abasic (apurinic/apyrimidinic; AP) site. Excises uracil residues arising as a result of misincorporation of dUMP residues by DNA polymerase during replication or due to spontaneous or enzymatic deamination of cytosine. Mediates error-free base excision repair (BER) of uracil at replication forks. According to the model, it is recruited by PCNA to S-phase replication forks to remove misincorporated uracil at U:A base mispairs in nascent DNA strands. Via trimeric RPA it is recruited to ssDNA stretches ahead of the polymerase to allow detection and excision of deaminated cytosines prior to replication. The resultant AP sites temporarily stall replication, allowing time to repair the lesion. Mediates mutagenic uracil processing involved in antibody affinity maturation. Processes AICDA-induced U:G base mispairs at variable immunoglobulin (Ig) regions leading to the generation of transversion mutations. Operates at switch sites of Ig constant regions where it mediates Ig isotype class switch recombination. Excises AICDA-induced uracil residues forming AP sites that are subsequently nicked by APEX1 endonuclease. The accumulation of staggered nicks in opposite strands results in double strand DNA breaks that are finally resolved via non-homologous end joining repair pathway.

Subunit / interactions. Monomer. Interacts with RPA2 subunit of the RPA trimer; this interaction mediates UNG2 recruitment to RPA-coated single-stranded DNA at stalled replication forks. Interacts with PCNA; this interaction mediates UNG2 recruitment to S-phase replication foci. Interacts (via N-terminus) with FAM72A. (Microbial infection) Interacts with HIV-1 Vpr.

Subcellular location. Mitochondrion Nucleus.

Post-translational modifications. Processed by mitochondrial serine or cysteine peptidases to yield a mature dominant form that lacks N-terminal 29 amino acid residues and another minor form that lacks N-terminal 77 amino acid residues. The catalytic activity of UNG1 delta29 is not product-inhibited by AP sites.

Disease relevance. Immunodeficiency with hyper-IgM 5 (HIGM5) [MIM:608106] A rare immunodeficiency syndrome characterized by normal or elevated serum IgM levels with absence of IgG, IgA, and IgE. It results in a profound susceptibility to bacterial infections. The disease is caused by variants affecting the gene represented in this entry.

Induction. Up-regulated upon B cell activation. Up-regulated in response to oxidative damage.

Similarity. Belongs to the uracil-DNA glycosylase (UDG) superfamily. UNG family.

Isoforms (2)

UniProt ID	Names	Canonical?
P13051-1	2, UNG2	yes
P13051-2	1, UNG1

RefSeq proteins (2): NP_003353, NP_550433* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR002043	UDG_fam1	Family
IPR005122	Uracil-DNA_glycosylase-like	Domain
IPR018085	Ura-DNA_Glyclase_AS	Active_site
IPR036895	Uracil-DNA_glycosylase-like_sf	Homologous_superfamily

Pfam: PF03167

Enzyme classification (BRENDA):

• EC 3.2.2.27 — uracil-DNA glycosylase (BRENDA: 47 organisms, 259 substrates, 76 inhibitors, 79 Km, 70 kcat entries)

Substrate kinetics (BRENDA)

15 substrates with measured Km, best-characterized 15. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
URACIL-CONTAINING CALF THYMUS DNA	0.0004–0.0028	18
URACIL-MISMATCHED DOUBLE-STRANDED DNA	—	18
URACIL-MISMATCHED SINGLE-STRANDED DNA	0.0005–0.0022	8
DOUBLE STRANDED DNA CONTAINING G-U MISMATCH	0.0002–0.001	4
DUMP DNA	0.0004–0.0028	4
URACIL-MISMATCHED DOUBLE-STRANDED DNA WITH U-G M	—	4
URACIL-CONTAINING DOUBLE-STRANDED DNA	0.0001	2
URACIL-CONTAINING SINGLE-STRANDED DNA	—	2
URACIL-MISMATCHED DOUBLE-STRANDED DNA WITH U-A M	0.0007–0.004	2
5-HYDROXYMETHYLURACIL-MISMATCHED DOUBLE-STRANDED	0.0046	1
5-HYDROXYMETHYLURACIL-MISMATCHED DOUBLE-STRANDED	0.0027	1
5-HYDROXYMETHYLURACIL-MISMATCHED SINGLE-STRANDED	0.0038	1
GGACTTCUCTCCTTTCCAGA/TCTGGAAAGGAGGGAAGTCC DUPLEX	0.0003	1
TCCCTTCUCTCCTTTCCTTC/TCCCTTCUCTCCTTTCCTTC DUPLEX	0.0004	1
URACIL-MISMATCHED DOUBLE-STRANDED DNA WITH A-U M	—	0

Catalyzed reactions (Rhea), 2 shown:

• a 2’-deoxyuridine in double-stranded DNA + H2O = a 2’-deoxyribose 5’-monophosphate in double-stranded DNA + uracil (RHEA:81455)
• a 2’-deoxyuridine in single-stranded DNA + H2O = a 2’-deoxyribose 5’-monophosphate in single-stranded DNA + uracil (RHEA:81459)

UniProt features (89 total): mutagenesis site 23, helix 13, binding site 11, turn 9, site 7, strand 7, modified residue 6, region of interest 4, sequence variant 3, compositionally biased region 2, chain 1, splice variant 1, short sequence motif 1, active site 1

Structure

Experimental structures (PDB)

24 structures.

PDB	Method	Resolution (Å)
3FCI	X-RAY DIFFRACTION	1.27
2HXM	X-RAY DIFFRACTION	1.3
3TKB	X-RAY DIFFRACTION	1.5
1AKZ	X-RAY DIFFRACTION	1.57
3FCK	X-RAY DIFFRACTION	1.64
3FCL	X-RAY DIFFRACTION	1.7
9LNQ	X-RAY DIFFRACTION	1.74
9LNP	X-RAY DIFFRACTION	1.76
1EMH	X-RAY DIFFRACTION	1.8
6VBA	X-RAY DIFFRACTION	1.8
3FCF	X-RAY DIFFRACTION	1.84
1Q3F	X-RAY DIFFRACTION	1.9
1SSP	X-RAY DIFFRACTION	1.9
1UGH	X-RAY DIFFRACTION	1.9
1YUO	X-RAY DIFFRACTION	1.95
1EMJ	X-RAY DIFFRACTION	2
2OYT	X-RAY DIFFRACTION	2
2SSP	X-RAY DIFFRACTION	2.25
5AYR	X-RAY DIFFRACTION	2.4
2OXM	X-RAY DIFFRACTION	2.5
4SKN	X-RAY DIFFRACTION	2.9
5JK7	X-RAY DIFFRACTION	3.49
7V7C	ELECTRON MICROSCOPY	3.7
1DPU	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P13051-F1	86.52	0.75

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (8): 10 (essential for recruitment to s-phase replication foci); 11 (essential for recruitment to s-phase replication foci); 77 (essential for recruitment to stalled replication forks); 84 (essential for recruitment to stalled replication forks); 88 (essential for ung2 recruitment to nuclear foci); 154 (proton acceptor); 29–30 (cleavage); 77–78 (cleavage)

Ligand- & substrate-binding residues (11): 167; 178; 213; 256; 277; 277; 279; 282; 285; 153; 157

Post-translational modifications (6): 12, 14, 23, 60, 64, 295

Mutagenesis-validated functional residues (23):

Position	Phenotype
10	loss of interaction with pcna; when associated with a-11. loss of interaction with pcna and rpa2; when associated with a
11	loss of interaction with pcna; when associated with a-10. loss of interaction with pcna and rpa2; when associated with a
18	impairs nuclear sorting.
19	impairs nuclear sorting.
49	decreases nuclear sorting; when associated with n-50 or e-50.
50	decreases nuclear sorting; when associated with n-49 or e-49.
73	impairs the interaction with rpa2.
76	impairs the interaction with rpa2.
77	impairs the interaction with rpa2. loss of interaction with pcna and rpa2; when associated with a-10, a-11 and d-84.
78	impairs the interaction with rpa2.
84	impairs the interaction with rpa2. loss of interaction with pcna and rpa2; when associated with a-10, a-11 and d-77.
88	impairs the interaction with rpa2.
154	loss of uracil-dna glycosylase activity.
156	acquires thymine-dna glycosylase activity.
213	acquires cytosine-dna glycosylase activity.
281	markedly decreases uracil-dna glycosylase activity. decreases the affinity for dump-carrying ssdna and dsdna. loss of ur
281	decreases uracil dna glycosylase activity. increases the affinity for dump-carrying ssdna and dsdna.
13	markedly decreases mitochondrial sorting; when associated with t-14.
14	markedly decreases mitochondrial sorting; when associated with g-13.
26	decreases mitochondrial sorting; when associated with g-27, g-28 and v-29.
27	decreases mitochondrial sorting; when associated with v-26, g-28 and v-29.
28	decreases mitochondrial sorting; when associated with v-26, g-27 and v-29.
29	decreases mitochondrial sorting; when associated with v-26, g-27 and g-28.

Function

Pathways and Gene Ontology

Reactome pathways

4 pathways

ID	Pathway
R-HSA-110328	Recognition and association of DNA glycosylase with site containing an affected pyrimidine
R-HSA-110329	Cleavage of the damaged pyrimidine
R-HSA-110357	Displacement of DNA glycosylase by APEX1
R-HSA-9821002	Chromatin modifications during the maternal to zygotic transition (MZT)

MSigDB gene sets: 368 (showing top): GSE18804_SPLEEN_MACROPHAGE_VS_BRAIN_TUMORAL_MACROPHAGE_DN, E2F_Q4, TONKS_TARGETS_OF_RUNX1_RUNX1T1_FUSION_MONOCYTE_UP, MODULE_52, E2F_Q4_01, HORIUCHI_WTAP_TARGETS_DN, HNF3ALPHA_Q6, E2F4DP1_01, GOBP_B_CELL_ACTIVATION, FISCHER_G1_S_CELL_CYCLE, GOBP_CARBOHYDRATE_DERIVATIVE_CATABOLIC_PROCESS, GENTILE_RESPONSE_CLUSTER_D3, GOBP_ORGANOPHOSPHATE_METABOLIC_PROCESS, MORF_HDAC2, MODULE_16

GO Biological Process (10): single strand break repair (GO:0000012), base-excision repair (GO:0006284), somatic hypermutation of immunoglobulin genes (GO:0016446), negative regulation of apoptotic process (GO:0043066), depyrimidination (GO:0045008), isotype switching (GO:0045190), base-excision repair, AP site formation via deaminated base removal (GO:0097510), DNA repair (GO:0006281), DNA damage response (GO:0006974), somatic recombination of immunoglobulin gene segments (GO:0016447)

GO Molecular Function (7): damaged DNA binding (GO:0003684), uracil DNA N-glycosylase activity (GO:0004844), ribosomal small subunit binding (GO:0043024), protein binding (GO:0005515), hydrolase activity (GO:0016787), hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799), DNA N-glycosylase activity (GO:0019104)

GO Cellular Component (3): nucleus (GO:0005634), nucleoplasm (GO:0005654), mitochondrion (GO:0005739)

Reactome top-level categories

Rollup of top-3 pathways:

Category	Pathways
Depyrimidination	2
Resolution of Abasic Sites (AP sites)	1
Maternal to zygotic transition (MZT)	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
DNA repair	2
somatic diversification of immunoglobulins	2
base-excision repair, AP site formation	2
deaminated base DNA N-glycosylase activity	2
intracellular membrane-bounded organelle	2
somatic diversification of immune receptors via somatic mutation	1
apoptotic process	1
regulation of apoptotic process	1
negative regulation of programmed cell death	1
DNA modification	1
pyrimidine deoxyribonucleotide catabolic process	1
somatic recombination of immunoglobulin genes involved in immune response	1
B cell activation involved in immune response	1
DNA metabolic process	1
DNA damage response	1
cellular response to stress	1
somatic diversification of immune receptors via germline recombination within a single locus	1
DNA binding	1
ribosome binding	1
binding	1
catalytic activity	1
hydrolase activity, acting on glycosyl bonds	1
hydrolase activity, hydrolyzing N-glycosyl compounds	1
catalytic activity, acting on DNA	1
nuclear lumen	1
cellular anatomical structure	1
cytoplasm	1

Protein interactions and networks

STRING

1598 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
UNG	SMUG1	Q53HV7	950
UNG	LIG1	P18858	942
UNG	APEX1	P27695	913
UNG	TDG	Q13569	906
UNG	AICDA	Q9GZX7	902
UNG	REV1	Q9UBZ9	899
UNG	XRCC1	P18887	864
UNG	POLQ	O75417	852
UNG	OGG1	P78554	846
UNG	POLB	P06746	799
UNG	POLH	Q9Y253	799
UNG	NTHL1	P78549	796
UNG	APOBEC1	P41238	794
UNG	POLM	Q9NP87	773
UNG	MSH6	P52701	757

IntAct

27 interactions, top by confidence:

A	B	Type	Score
OPG044	DDX3X	psi-mi:“MI:0914”(association)	0.730
RPA2	UNG	psi-mi:“MI:0915”(physical association)	0.670
UNG	RPA2	psi-mi:“MI:0915”(physical association)	0.670
RPA2	UNG	psi-mi:“MI:0407”(direct interaction)	0.670
UNG	RPA2	psi-mi:“MI:0407”(direct interaction)	0.670
UNG	UGI	psi-mi:“MI:0407”(direct interaction)	0.440
H3C1	SMCHD1	psi-mi:“MI:2364”(proximity)	0.410
CAPN11	UNG	psi-mi:“MI:0915”(physical association)	0.370
SEZ6L2	UNG	psi-mi:“MI:0915”(physical association)	0.370
vpr	UNG	psi-mi:“MI:0915”(physical association)	0.370
Ppp2r2d	KLF4	psi-mi:“MI:0914”(association)	0.350
PPP2R2D	BAG2	psi-mi:“MI:0914”(association)	0.350
CAMK2D	SETD1A	psi-mi:“MI:0914”(association)	0.350
STYX	BANF1	psi-mi:“MI:0914”(association)	0.350
PPP2CA	ENSA	psi-mi:“MI:0914”(association)	0.350
UQCRFS1	VWA8	psi-mi:“MI:0914”(association)	0.350
TGM1	DNM1L	psi-mi:“MI:0914”(association)	0.350
SLC25A25	HAX1	psi-mi:“MI:0914”(association)	0.350
FECH	POTEF	psi-mi:“MI:0914”(association)	0.350
vpr	GEMIN2	psi-mi:“MI:0914”(association)	0.350
vpr	UNG	psi-mi:“MI:0403”(colocalization)	0.270
H2BC10	SMCHD1	psi-mi:“MI:2364”(proximity)	0.270
UNG		psi-mi:“MI:0915”(physical association)	0.000

BioGRID (77): UNG (Biochemical Activity), PCNA (Reconstituted Complex), UNG (Reconstituted Complex), UNG (Two-hybrid), RPA2 (Two-hybrid), UNG (Affinity Capture-Western), VPRBP (Affinity Capture-Western), DDB1 (Affinity Capture-Western), vpr (Affinity Capture-Western), UNG (Proximity Label-MS), UNG (Proximity Label-MS), UNG (Affinity Capture-MS), UNG (Affinity Capture-MS), UNG (Affinity Capture-MS), UNG (Affinity Capture-Western)

ESM2 similar proteins: A0MTA1, A1YES6, A1YFZ3, A2T6Y4, A2T7I6, A5WVX1, B4FAT0, O54747, O94903, P0A2X3, P0A2X4, P13051, P23196, P26882, P27695, P28339, P28340, P28352, P36776, P43138, P52431, P97283, P97931, Q08752, Q08DF7, Q0J705, Q0V9S0, Q16775, Q32LH4, Q3B7M2, Q3T0G5, Q3TIU4, Q4P1V1, Q4R5U5, Q4R6C1, Q59HJ6, Q5R4Z1, Q5XIP6, Q5ZI23, Q653S9

Diamond homologs: A0M1V1, A0RLI1, A0RM89, A1QYK3, A3M500, A5FFT1, A5UBC0, A5W8H2, A6L7T5, A6M317, A6UDC0, A6VAM7, A7GVE5, A7I0A8, A7ZA24, A7ZAZ4, A8MM35, A9VSJ0, B0KV50, B0RWT2, B0VD25, B0VMZ7, B1J4J3, B1YFL0, B2HZE0, B2RHL6, B2SJF5, B2TQZ9, B2V017, B3ERG6, B5RKV2, B5RQN2, B6YR15, B7GMM1, B7H3L4, B7HG60, B7HYF9, B7I526, B7IRS8, B7JHM3

SIGNOR signaling

26 interactions.

A	Effect	B	Mechanism
GSK3B	“down-regulates quantity by destabilization”	UNG	phosphorylation
GSK3A	“down-regulates quantity by destabilization”	UNG	phosphorylation
UNG	“down-regulates quantity by destabilization”	5-fluorouracil	“chemical modification”
UNG	up-regulates	DNA_repair
Cullin4-RBX1-DDB1	“down-regulates quantity by destabilization”	UNG	ubiquitination
CyclinD/CDK4	“up-regulates activity”	UNG	phosphorylation
CyclinA2/CDK2	“up-regulates activity”	UNG	phosphorylation
CyclinB/CDK1	“up-regulates activity”	UNG	phosphorylation
CyclinE/CDK2	“up-regulates activity”	UNG	phosphorylation
PPM1D	“down-regulates activity”	UNG	dephosphorylation
UNG	up-regulates	Base-excision_repair

Disease & clinical

Clinical variants and AI predictions

ClinVar

306 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	15
Likely pathogenic	7
Uncertain significance	142
Likely benign	106
Benign	19

Top pathogenic / likely-pathogenic (22)

Variant ID	HGVS	Classification
1064649	NM_080911.3(UNG):c.294del (p.Ser97_Trp98insTer)	Pathogenic
1074636	NM_080911.3(UNG):c.730C>T (p.Gln244Ter)	Pathogenic
12290	NM_080911.3(UNG):c.392del (p.Pro131fs)	Pathogenic
12291	NM_080911.3(UNG):c.572_573del (p.Glu191fs)	Pathogenic
12292	NM_080911.3(UNG):c.752T>C (p.Phe251Ser)	Pathogenic
12293	NM_080911.3(UNG):c.428_429del (p.Ile143fs)	Pathogenic
1452551	NM_080911.3(UNG):c.366_369del (p.Arg122fs)	Pathogenic
1687471	NM_080911.3(UNG):c.649dup (p.Thr217fs)	Pathogenic
2048165	NM_080911.3(UNG):c.250dup (p.Arg84fs)	Pathogenic
2068429	NM_080911.3(UNG):c.162del (p.Gln55fs)	Pathogenic
2083377	NM_080911.3(UNG):c.39del (p.Ser14fs)	Pathogenic
2735958	NM_080911.3(UNG):c.569_570del (p.Ile190fs)	Pathogenic
3650570	NM_080911.3(UNG):c.682del (p.Glu228fs)	Pathogenic
3653806	NM_080911.3(UNG):c.348del (p.Phe117fs)	Pathogenic
578381	NM_080911.3(UNG):c.685C>T (p.Arg229Ter)	Pathogenic
1508776	NM_080911.3(UNG):c.623-2A>G	Likely pathogenic
2787212	NM_080911.3(UNG):c.133-2A>G	Likely pathogenic
3574190	NM_080911.3(UNG):c.294G>A (p.Trp98Ter)	Likely pathogenic
3574191	NM_080911.3(UNG):c.454G>T (p.Gly152Ter)	Likely pathogenic
3574192	NM_080911.3(UNG):c.551_552del (p.Lys184fs)	Likely pathogenic
4751175	NM_080911.3(UNG):c.533+1G>T	Likely pathogenic
546720	NM_080911.3(UNG):c.309del (p.Ser103fs)	Likely pathogenic

SpliceAI

922 predictions. Top by Δscore:

Variant	Effect	Δscore
12:109097730:G:GT	donor_gain	1.0000
12:109098636:AAGGT:A	donor_loss	1.0000
12:109098637:AGG:A	donor_loss	1.0000
12:109098638:GGTAA:G	donor_loss	1.0000
12:109102825:T:TA	acceptor_gain	1.0000
12:109102826:G:A	acceptor_gain	1.0000
12:109103427:GTATA:G	acceptor_loss	1.0000
12:109103430:TA:T	acceptor_loss	1.0000
12:109103431:A:AC	acceptor_loss	1.0000
12:109103431:A:AG	acceptor_gain	1.0000
12:109103432:G:A	acceptor_loss	1.0000
12:109103432:G:GG	acceptor_gain	1.0000
12:109103432:GGT:G	acceptor_gain	1.0000
12:109103610:GG:G	donor_gain	1.0000
12:109103611:GG:G	donor_gain	1.0000
12:109097795:A:T	donor_gain	0.9900
12:109097809:GCG:G	donor_gain	0.9900
12:109098611:G:GT	donor_gain	0.9900
12:109098639:G:GG	donor_gain	0.9900
12:109099187:A:AG	acceptor_gain	0.9900
12:109099188:G:GG	acceptor_gain	0.9900
12:109099206:A:AG	acceptor_gain	0.9900
12:109099207:G:GG	acceptor_gain	0.9900
12:109099207:GAA:G	acceptor_gain	0.9900
12:109099282:GAT:G	donor_gain	0.9900
12:109099285:G:GG	donor_gain	0.9900
12:109102823:T:A	acceptor_gain	0.9900
12:109102837:A:AG	acceptor_gain	0.9900
12:109102838:G:GA	acceptor_gain	0.9900
12:109103431:AG:A	acceptor_gain	0.9900

AlphaMissense

2046 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
12:109103501:T:A	W231R	1.000
12:109103501:T:C	W231R	1.000
12:109099258:T:A	W137R	0.999
12:109099258:T:C	W137R	0.999
12:109101912:T:A	V149D	0.999
12:109101925:G:C	Q153H	0.999
12:109101925:G:T	Q153H	0.999
12:109101927:A:G	D154G	0.999
12:109101927:A:T	D154V	0.999
12:109101932:T:C	Y156H	0.999
12:109101956:G:T	G164W	0.999
12:109101957:G:A	G164E	0.999
12:109101963:G:A	C166Y	0.999
12:109101964:C:G	C166W	0.999
12:109101965:T:C	F167L	0.999
12:109101967:T:A	F167L	0.999
12:109101967:T:G	F167L	0.999
12:109101968:A:C	S168R	0.999
12:109101970:T:A	S168R	0.999
12:109101970:T:G	S168R	0.999
12:109101998:A:C	S178R	0.999
12:109102839:T:A	S178R	0.999
12:109102839:T:G	S178R	0.999
12:109102915:T:A	W204R	0.999
12:109102915:T:C	W204R	0.999
12:109103503:G:C	W231C	0.999
12:109103503:G:T	W231C	0.999
12:109103570:T:A	W254R	0.999
12:109103570:T:C	W254R	0.999
12:109103583:C:A	A258D	0.999

dbSNP variants (sampled 300 via entrez): RS1000324242 (12:109106044 A>G), RS1000335199 (12:109108407 C>T), RS1000647847 (12:109098962 G>A), RS1000655490 (12:109107568 C>T), RS1000880238 (12:109100244 T>C), RS1000960479 (12:109096305 G>T), RS1001000745 (12:109098711 C>T), RS1001537323 (12:109106445 TC>T), RS1001594931 (12:109102422 G>A), RS1001610826 (12:109106677 T>C), RS1001766343 (12:109108107 G>A,T), RS1001868064 (12:109098218 C>T), RS1001910231 (12:109107952 T>C), RS1001997549 (12:109103384 G>C), RS1002108643 (12:109109555 C>T)

Disease associations

OMIM: gene MIM:191525 | disease phenotypes: MIM:608106

GenCC curated gene-disease

Disease	Classification	Inheritance
hyper-IgM syndrome type 5	Strong	Autosomal recessive

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
hyper-IgM syndrome type 5	Moderate	AR

Mondo (2): hyper-IgM syndrome type 5 (MONDO:0011971), hereditary breast ovarian cancer syndrome (MONDO:0003582)

Orphanet (2): Hyper-IgM syndrome type 5 (Orphanet:101092), Hereditary breast and/or ovarian cancer syndrome (Orphanet:145)

HPO phenotypes

11 total (11 of 11 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000031	Epididymitis
HP:0002716	Lymphadenopathy
HP:0002718	Recurrent bacterial infections
HP:0002720	Decreased circulating IgA concentration
HP:0002721	Immunodeficiency
HP:0002959	Impaired Ig class switch recombination
HP:0003496	Increased circulating IgM level
HP:0004315	Decreased circulating IgG concentration
HP:0011463	Childhood onset
HP:0200117	Recurrent upper and lower respiratory tract infections

GWAS associations

4 associations (top):

Study	Trait	p-value
GCST006940_3	Neurociticism	2.000000e-15
GCST006943_15	Feeling miserable	5.000000e-09
GCST006946_12	Worry too long after an embarrassing experience	6.000000e-10
GCST006950_27	Feeling worry	4.000000e-10

EFO canonical traits (3, from GWAS)

EFO ID	Trait name
EFO:0007660	neuroticism measurement
EFO:0009598	feeling miserable measurement
EFO:0009589	worry measurement

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D061325	Hereditary Breast and Ovarian Cancer Syndrome	C04.588.180.483; C04.588.322.455.431; C04.700.517; C12.050.351.500.056.630.705.431; C12.050.351.937.418.685.431; C12.100.250.056.630.705.431; C12.900.418.685.431; C16.320.700.517; C17.800.090.500.483; C19.344.410.431; C19.391.630.705.431

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL3277 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

ChEMBL bioactivities

3 potent at pChembl≥5 of 17 total, top 3 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
5.89	IC50	1300	nM	CHEMBL1213370
5.10	IC50	8000	nM	CHEMBL74742
5.00	IC50	1e+04	nM	CHEMBL308968

PubChem BioAssay actives

4 with measured affinity, of 35 total; 3 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
3-[(E)-3-[(2,4-dioxo-1H-pyrimidin-6-yl)methylamino]propoxyiminomethyl]benzoic acid	1799405: UNG Inhibition Assay from Article 10.1038/nchembio.163: “Impact of linker strain and flexibility in the design of a fragment-based inhibitor.”	ic50	1.3000	uM
6-(4-octylanilino)-1H-pyrimidine-2,4-dione	215481: Inhibitory potency against HSV-1 Uracil-DNA glycosylase	ic50	8.0000	uM
1-(2-hydroxyethyl)-6-(4-octylanilino)pyrimidine-2,4-dione	215481: Inhibitory potency against HSV-1 Uracil-DNA glycosylase	ic50	10.0000	uM

CTD chemical–gene interactions

109 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression, increases expression	5
Estradiol	increases phosphorylation, affects expression, increases expression	4
Valproic Acid	decreases expression, affects expression	4
bisphenol A	decreases reaction, affects expression, decreases expression, increases expression	3
Benzo(a)pyrene	decreases expression, decreases methylation	3
Cyclosporine	decreases expression, increases expression	3
Cadmium Chloride	decreases expression, increases abundance	3
mono-(2-ethylhexyl)phthalate	increases expression	2
cobaltous chloride	decreases expression	2
Acetaminophen	affects expression, decreases expression	2
Carbamazepine	affects expression	2
Doxorubicin	decreases expression	2
Fluorouracil	affects expression, affects response to substance	2
Phenylmercuric Acetate	affects cotreatment, decreases expression	2
Tretinoin	decreases expression	2
FR900359	decreases phosphorylation	1
pradimicin-IRD	decreases expression	1
triphenyl phosphate	affects expression	1
uranyl acetate	affects expression	1
4-biphenylamine	decreases expression	1
pyrithione zinc	increases expression	1
cinnamaldehyde	decreases expression	1
beta-lapachone	decreases expression	1
arsenite	affects expression	1
afimoxifene	decreases expression	1
nickel chloride	decreases expression	1
zinc chromate	decreases expression, increases abundance	1
fludarabine	affects cotreatment, decreases expression	1
3,4-dihydroxy-1,2-epoxy-1,2,3,4-tetrahydrobenz(a)anthracene	increases expression	1
periodate-oxidized adenosine	affects expression	1

ChEMBL screening assays

7 unique, capped per target: 6 binding, 1 functional

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1220462	Binding	Inhibition of human uracil DNA glycosylase using fluorescent DNA substrate	Impact of linker strain and flexibility in the design of a fragment-based inhibitor. — Nat Chem Biol
CHEMBL5665453	Functional	Inhibition of UNG by quantifying inhibition of UNG-mediated cleavage and dissociation of quenched duplex DNA oligonucleotides, measured as fluorescence at 594 nm. To generate a functional strand incision and increase turn-over this assay is	Enzyme Inhibitor Single Concentration assay results for EUbOPEN Chemogenomics Library

Cellosaurus cell lines

5 cell lines: 5 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B2KF	Abcam HeLa UNG KO	Cancer cell line	Female
CVCL_TW38	HAP1 UNG (-) 1	Cancer cell line	Male
CVCL_TW39	HAP1 UNG (-) 2	Cancer cell line	Male
CVCL_TW40	HAP1 UNG (-) 3	Cancer cell line	Male
CVCL_TW41	HAP1 UNG (-) 4	Cancer cell line	Male

Clinical trials (associated diseases)

51 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT02562170	PHASE4	COMPLETED	Protexa® Versus TiLoopBra® in Immediate Breast Reconstruction- A Pilot Study
NCT00673335	PHASE3	COMPLETED	Letrozole in Preventing Breast Cancer in Postmenopausal Women With a BRCA1 or BRCA2 Mutation
NCT00685256	PHASE3	COMPLETED	Standard Genetic Counseling With or Without a Decision Guide in Improving Communication Between Mothers Undergoing BRCA1/2 Testing and Their Minor-Age Children
NCT03162276	PHASE3	UNKNOWN	Trial of Inquiry Based Stress Reduction (IBSR) Program for BRCA1/2 Mutation Carriers
NCT00253539	PHASE2	COMPLETED	Arzoxifene or Tamoxifen in Preventing Breast Cancer in Premenopausal Women at High Risk for Breast Cancer
NCT00305695	PHASE2	COMPLETED	Zoledronate or Observation in Maintaining Bone Mineral Density in Patients Who Are Undergoing Surgery to Remove Both Ovaries
NCT00321633	PHASE2	COMPLETED	Carboplatin or Docetaxel in Treating Women With Metastatic Genetic Breast Cancer
NCT01333748	PHASE2	COMPLETED	Search Allelic Imbalance of Expression of BRCA Genes in Hereditary Risk of Breast and/or Ovarian Cancer
NCT01367639	PHASE2	COMPLETED	Trial of Inquiry Based Stress Reduction (IBSR) Program for BRCA1/2 Mutation Carriers
NCT00535119	PHASE1	COMPLETED	Veliparib, Carboplatin, and Paclitaxel in Treating Patients With Advanced Solid Cancer
NCT00892736	PHASE1	COMPLETED	Veliparib in Treating Patients With Malignant Solid Tumors That Do Not Respond to Previous Therapy
NCT03832985	EARLY_PHASE1	COMPLETED	Pediatric Reporting of Adult-Onset Genomic Results
NCT00005095	Not specified	RECRUITING	Specimen and Data Study for Ovarian Cancer Early Detection and Prevention
NCT00609505	Not specified	COMPLETED	Telemedicine vs. Face-to-Face Cancer Genetic Counseling
NCT01273909	Not specified	UNKNOWN	Outcomes After Perforator Flap Reconstruction for Breast Reconstruction and/or Lymphedema Treatment
NCT01445275	Not specified	WITHDRAWN	Cost of Cancer Risk Management in Women at Elevated Genetic Risk for Ovarian Cancer Who Participated on GOG-0199
NCT01608074	Not specified	ACTIVE_NOT_RECRUITING	Radical Fimbriectomy for Young BRCA Mutation Carriers
NCT02087592	Not specified	COMPLETED	Feasibility of Lifestyle Intervention in BRCA1/2 Mutation Carriers
NCT02302742	Not specified	RECRUITING	Triple Negative Breast Cancer and Germline Hereditary Breast and Ovarian Cancer Mutation Carrier Registry
NCT02324062	Not specified	COMPLETED	Cancer Genetics Hereditary Cancer Panel Testing
NCT02516540	Not specified	UNKNOWN	Efficacy of Lifestyle Intervention in BRCA1/2 Mutation Carriers
NCT02653105	Not specified	ACTIVE_NOT_RECRUITING	Women at Risk of Breast Cancer and OLFM4
NCT02705924	Not specified	TERMINATED	Impact of a Psychoeducational Intervention on Expectations and Coping in Young Women Exposed to a High HBOC Risk
NCT02760849	Not specified	ACTIVE_NOT_RECRUITING	Surgery in Preventing Ovarian Cancer in Patients With Genetic Mutations
NCT02786147	Not specified	COMPLETED	Identification and Referral of Women at Risk for Hereditary Breast/Ovarian Cancer
NCT02956681	Not specified	COMPLETED	Statewide Communication to Reach Diverse Low Income Women
NCT03015376	Not specified	UNKNOWN	Inherited Susceptible Genes Among Epithelial Ovarian Cancer
NCT03050268	Not specified	RECRUITING	Familial Investigations of Childhood Cancer Predisposition
NCT03075540	Not specified	COMPLETED	Enhancing At-risk Latina Women’s Use of Genetic Counseling for Hereditary Breast and Ovarian Cancer
NCT03124212	Not specified	RECRUITING	Cascade Genetic Testing for Hereditary Breast/Ovarian Cancer and Lynch Syndrome in Switzerland
NCT03246841	Not specified	ACTIVE_NOT_RECRUITING	Investigation of Tumour Spectrum of Germline Mutations in Breast and Ovarian Cancer Genes.
NCT03294343	Not specified	UNKNOWN	Risk-Reducing Surgeries for Hereditary Ovarian Cancer
NCT03421327	Not specified	COMPLETED	Genetic Risk: Whether, When, and How to Tell Adolescents
NCT03510689	Not specified	COMPLETED	Genetics and Heart Health After Cancer Therapy
NCT03511690	Not specified	COMPLETED	Testing an Intelligent Tutoring System to Enhance Genetic Risk Assessment
NCT03784859	Not specified	COMPLETED	Tissue Expansion in Breast Reconstruction Without Drains
NCT03979612	Not specified	UNKNOWN	Evaluation of the Adhesion to the GENEPY Network
NCT04197856	Not specified	ACTIVE_NOT_RECRUITING	Direct Information to At-risk Relatives
NCT04407611	Not specified	COMPLETED	Scalable Communication Modalities for Returning Genetic Research Results
NCT04508764	Not specified	TERMINATED	Implementation of the Families Accelerating Cascade Testing Toolkit (FACTT) for Hereditary Breast and Ovarian Cancer and Lynch Syndrome