UTP25

Summary

UTP25 (UTP25 small subunit processome component, HGNC:28440) is a protein-coding gene on chromosome 1q32.2, encoding U3 small nucleolar RNA-associated protein 25 homolog (Q68CQ4). Component of the ribosomal small subunit processome for the biogenesis of ribosomes, functions in pre-ribosomal RNA (pre-rRNA) processing. It is a selective cancer dependency (DepMap: 87.5% of cell lines).

Enables RNA binding activity. Involved in several processes, including protein catabolic process; protein destabilization; and protein localization to nucleolus. Located in nucleolus.

Source: NCBI Gene 27042 — RefSeq curated summary.

At a glance

• GWAS associations: 5
• Clinical variants (ClinVar): 126 total
• Cancer dependency (DepMap): dependent in 87.5% of screened cell lines
• MANE Select transcript: NM_014388

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:28440
Approved symbol	UTP25
Name	UTP25 small subunit processome component
Location	1q32.2
Locus type	gene with protein product
Status	Approved
Aliases	MGC29875, DEF
Ensembl gene	ENSG00000117597
Ensembl biotype	protein_coding
OMIM	619663
Entrez	27042

Gene structure

Transcript identifiers

Ensembl transcripts: 5 — 5 protein_coding

ENST00000457820, ENST00000491415, ENST00000852869, ENST00000852870, ENST00000915424

RefSeq mRNA: 1 — MANE Select: NM_014388 NM_014388

CCDS: CCDS1493

Canonical transcript exons

ENST00000491415 — 12 exons

Exon	Start	End
ENSE00000792137	209830108	209830147
ENSE00000792138	209830803	209831043
ENSE00000792139	209833185	209833358
ENSE00000792140	209835075	209835163
ENSE00000792141	209836801	209837211
ENSE00000792142	209838909	209839128
ENSE00000792143	209840853	209841055
ENSE00000792144	209842265	209842447
ENSE00000792145	209842583	209842695
ENSE00000792146	209843451	209843696
ENSE00001443261	209827972	209828170
ENSE00001933838	209851204	209857565

Expression profiles

Bgee: expression breadth ubiquitous, 280 present calls, max score 90.02.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 20.0498 / max 642.6341, expressed in 1785 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
8370	20.0498	1785

Top tissues by expression

292 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
endothelial cell	CL:0000115	90.02	gold quality
germinal epithelium of ovary	UBERON:0001304	82.97	gold quality
epithelium of nasopharynx	UBERON:0001951	82.85	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	82.68	gold quality
cartilage tissue	UBERON:0002418	81.79	gold quality
cervix squamous epithelium	UBERON:0006922	81.45	gold quality
epithelial cell of pancreas	CL:0000083	80.76	gold quality
hair follicle	UBERON:0002073	80.49	gold quality
amniotic fluid	UBERON:0000173	79.44	gold quality
squamous epithelium	UBERON:0006914	78.50	gold quality
stromal cell of endometrium	CL:0002255	78.49	gold quality
cortical plate	UBERON:0005343	78.29	gold quality
tibia	UBERON:0000979	78.10	gold quality
esophagus squamous epithelium	UBERON:0006920	78.01	gold quality
cauda epididymis	UBERON:0004360	77.86	gold quality
pancreatic ductal cell	CL:0002079	77.85	silver quality
caput epididymis	UBERON:0004358	77.36	gold quality
oviduct epithelium	UBERON:0004804	77.02	gold quality
islet of Langerhans	UBERON:0000006	76.80	gold quality
epithelium of esophagus	UBERON:0001976	76.72	gold quality
gingival epithelium	UBERON:0001949	76.48	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	76.34	gold quality
pericardium	UBERON:0002407	76.25	gold quality
ventricular zone	UBERON:0003053	76.04	gold quality
adrenal tissue	UBERON:0018303	75.56	gold quality
bronchial epithelial cell	CL:0002328	75.52	gold quality
tibialis anterior	UBERON:0001385	75.31	gold quality
cranial nerve II	UBERON:0000941	75.29	gold quality
mucosa of paranasal sinus	UBERON:0005030	75.10	gold quality
calcaneal tendon	UBERON:0003701	74.99	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	5.29

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): BRD1

miRNA regulators (miRDB)

205 targeting UTP25, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3134	100.00	66.43	777
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-7110-3P	100.00	73.18	2486
HSA-MIR-8485	100.00	77.57	4731
HSA-MIR-200B-3P	100.00	73.31	2693
HSA-MIR-200C-3P	100.00	73.35	2685
HSA-MIR-429	100.00	73.44	2698
HSA-MIR-4795-3P	100.00	74.62	4024
HSA-MIR-6833-3P	100.00	70.63	3197
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-6867-5P	100.00	82.21	3464
HSA-MIR-371B-5P	99.99	75.34	4759
HSA-MIR-186-5P	99.99	70.83	3707
HSA-MIR-3662	99.99	73.82	5684
HSA-MIR-513B-5P	99.99	69.96	2150
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-12136	99.98	72.81	5713
HSA-MIR-616-5P	99.98	75.58	4775
HSA-MIR-373-5P	99.98	75.36	4753
HSA-MIR-548N	99.98	71.94	4170
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-3688-3P	99.97	72.02	2834
HSA-MIR-3065-5P	99.97	71.56	3281
HSA-MIR-302C-5P	99.97	72.56	3642
HSA-MIR-548AA	99.96	70.64	3753
HSA-MIR-548AP-3P	99.96	70.64	3753
HSA-MIR-548T-3P	99.96	70.64	3753
HSA-MIR-2110	99.96	66.68	1930
HSA-MIR-4267	99.96	66.53	2368
HSA-MIR-3682-5P	99.93	67.97	1163

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 87.5% of screened cell lines.

Literature-anchored findings (GeneRIF, showing 4)

• characterization of the related zebrafish protein (PMID:16322560)
• Colonic tissue from patients with Hirschsprung’s disease showed lower expression levels of digestive-organ expansion factor (DIEXF). (PMID:25007945)
• DEF is highly expressed in human neuroblastoma, and its depletion in human neuroblastoma cell lines induces apoptosis. (PMID:28263972)
• Tissue and cancer-specific expression of DIEXF is epigenetically mediated by an Alu repeat. (PMID:32041475)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	utp25	ENSDARG00000017696
mus_musculus	Utp25	ENSMUSG00000016181
rattus_norvegicus	Utp25	ENSRNOG00000004789
drosophila_melanogaster	CG3735	FBGN0034933
caenorhabditis_elegans		WBGENE00012756

Protein

Protein identifiers

U3 small nucleolar RNA-associated protein 25 homolog — Q68CQ4 (reviewed: Q68CQ4)

Alternative names: Digestive organ expansion factor homolog, UTP25 small subunit processor component

All UniProt accessions (2): H7C2R4, Q68CQ4

UniProt curated annotations — full annotation on UniProt →

Function. Component of the ribosomal small subunit processome for the biogenesis of ribosomes, functions in pre-ribosomal RNA (pre-rRNA) processing. Essential for embryonic development in part through the regulation of p53 pathway. Controls the expansion growth of digestive organs and liver. Also involved in the sympathetic neuronal development. Mediates, with CAPN3, the proteasome-independent degradation of p53/TP53.

Subunit / interactions. Interacts with CAPN3; the interaction is required for CAPN3 translocation to the nucleolus.

Subcellular location. Nucleus. Nucleolus.

Tissue specificity. Expressed in colon.

Post-translational modifications. Phosphorylated. Phosphorylation is required to promote p53/TP53 degradation in the nucleolus which promotes cell cycle progression and liver development.

Induction. Down-regulated by the miRNA MIR195.

Similarity. Belongs to the UTP25 family.

RefSeq proteins (1): NP_055203* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR010678	UTP25	Family
IPR027417	P-loop_NTPase	Homologous_superfamily
IPR053939	UTP25_C	Domain
IPR053940	UTP25_NTPase-like	Domain

Pfam: PF06862, PF22916

UniProt features (18 total): modified residue 7, region of interest 4, compositionally biased region 3, sequence variant 2, chain 1, sequence conflict 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q68CQ4-F1	78.78	0.54

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (7): 52, 58, 60, 62, 64, 10, 50

Function

Pathways and Gene Ontology

Reactome pathways

2 pathways

ID	Pathway
R-HSA-6790901	rRNA modification in the nucleus and cytosol
R-HSA-6791226	Major pathway of rRNA processing in the nucleolus and cytosol

MSigDB gene sets: 227 (showing top): GOBP_RIBOSOME_BIOGENESIS, BORCZUK_MALIGNANT_MESOTHELIOMA_UP, GOBP_MATURATION_OF_SSU_RRNA, CHUANG_OXIDATIVE_STRESS_RESPONSE_UP, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, GRAESSMANN_RESPONSE_TO_MC_AND_DOXORUBICIN_DN, GOBP_MACROMOLECULE_CATABOLIC_PROCESS, WEI_MYCN_TARGETS_WITH_E_BOX, GOBP_PROTEIN_DESTABILIZATION, GOBP_RIBOSOMAL_SMALL_SUBUNIT_BIOGENESIS, GOBP_MATURATION_OF_SSU_RRNA_FROM_TRICISTRONIC_RRNA_TRANSCRIPT_SSU_RRNA_5_8S_RRNA_LSU_RRNA, GOBP_REGULATION_OF_PROTEIN_STABILITY, DODD_NASOPHARYNGEAL_CARCINOMA_UP, FREAC4_01, GOBP_PROTEIN_LOCALIZATION_TO_ORGANELLE

GO Biological Process (7): maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462), protein catabolic process (GO:0030163), protein destabilization (GO:0031648), positive regulation of embryonic development (GO:0040019), embryonic organ development (GO:0048568), protein localization to nucleolus (GO:1902570), rRNA processing (GO:0006364)

GO Molecular Function (4): RNA binding (GO:0003723), rRNA binding (GO:0019843), U3 snoRNA binding (GO:0034511), protein binding (GO:0005515)

GO Cellular Component (4): nucleoplasm (GO:0005654), nucleolus (GO:0005730), small-subunit processome (GO:0032040), nucleus (GO:0005634)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
rRNA processing in the nucleus and cytosol	2

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
embryo development	2
nuclear lumen	2
maturation of SSU-rRNA	1
macromolecule catabolic process	1
protein metabolic process	1
regulation of protein stability	1
regulation of embryonic development	1
positive regulation of developmental process	1
positive regulation of multicellular organismal process	1
animal organ development	1
protein localization to nucleus	1
RNA processing	1
rRNA metabolic process	1
ribosome biogenesis	1
nucleic acid binding	1
RNA binding	1
snoRNA binding	1
binding	1
cellular anatomical structure	1
intracellular membraneless organelle	1
nucleolus	1
preribosome	1
t-UTP complex	1
nuclear protein-containing complex	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

1546 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
UTP25	UTP3	Q9NQZ2	744
UTP25	MPHOSPH10	O00566	729
UTP25	IRF6	O14896	717
UTP25	DDX49	Q9Y6V7	714
UTP25	PDCD11	Q14690	680
UTP25	BYSL	Q13895	667
UTP25	ABT1	Q9ULW3	663
UTP25	ESF1	Q9H501	639
UTP25	WDR36	Q8NI36	622
UTP25	RCL1	Q9Y2P8	606
UTP25	UTP18	Q9Y5J1	605
UTP25	DHX8	Q14562	597
UTP25	NOP14	P78316	579
UTP25	NOM1	Q5C9Z4	563
UTP25	PWP2	Q15269	545

IntAct

102 interactions, top by confidence:

A	B	Type	Score
MAPKAPK3	MAPK11	psi-mi:“MI:0914”(association)	0.870
MED17	MED19	psi-mi:“MI:0914”(association)	0.840
CEP70	UTP25	psi-mi:“MI:0915”(physical association)	0.830
UTP25	CEP70	psi-mi:“MI:0915”(physical association)	0.830
UTP25	RUFY1	psi-mi:“MI:0915”(physical association)	0.740
RUFY1	UTP25	psi-mi:“MI:0915”(physical association)	0.740
UTP25	MIPOL1	psi-mi:“MI:0915”(physical association)	0.670
MIPOL1	UTP25	psi-mi:“MI:0915”(physical association)	0.670
UTP25	RUFY1	psi-mi:“MI:0915”(physical association)	0.670
UTP25	AP2M1	psi-mi:“MI:0915”(physical association)	0.670
IMP3	MPHOSPH10	psi-mi:“MI:0914”(association)	0.670
FGL1	LCMT2	psi-mi:“MI:0914”(association)	0.640
MAGEA11	UTP25	psi-mi:“MI:0915”(physical association)	0.560
UTP25	MID2	psi-mi:“MI:0915”(physical association)	0.560
UTP25	MAGEA11	psi-mi:“MI:0915”(physical association)	0.560
MID2	UTP25	psi-mi:“MI:0915”(physical association)	0.560
UTP25	MEOX2	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (130): DIEXF (Two-hybrid), DIEXF (Two-hybrid), RUFY1 (Two-hybrid), CEP70 (Two-hybrid), MIPOL1 (Two-hybrid), DIEXF (Affinity Capture-MS), DIEXF (Affinity Capture-MS), DIEXF (Affinity Capture-MS), DIEXF (Two-hybrid), DIEXF (Co-fractionation), DIEXF (Co-fractionation), MYO18A (Co-fractionation), DIEXF (Affinity Capture-MS), DIEXF (Affinity Capture-MS), DIEXF (Affinity Capture-MS)

ESM2 similar proteins: A0AVT1, A4QN59, A6H630, A6QXC6, A7SBF0, A7SKJ3, F4JZC2, O01757, O70467, P49958, P87115, Q09454, Q0J7N5, Q10206, Q17QF2, Q4KLT3, Q58EM4, Q5AWA2, Q5M9G7, Q5TYS0, Q5XI55, Q5ZIE6, Q5ZJM3, Q5ZKI2, Q5ZLG3, Q642T7, Q655R6, Q68CQ4, Q6DE00, Q6DJA3, Q6NTR1, Q6NUA1, Q6PEH4, Q7SXP2, Q8C7R4, Q8GWT4, Q8GXR5, Q8JFW4, Q8K224, Q922H1

Diamond homologs: A1CQH8, A1D3E2, A2QQ09, A3LXV1, A4R0E6, A5DFC2, A5E1F6, A6RT94, A6ZVI6, A7EZP8, A7THH1, B0XQ54, B2B4I8, B2W0B1, B3LTT8, B6H768, B6JX19, B6Q702, B8LVD6, B9WM88, C0NQU6, C0SG20, C1G2D1, C1GPD0, C4JTH6, C4R2K0, C4XWY8, C4YMA4, C5DMP2, C5DPB7, C5G0N1, C5GAH0, C5JMX0, C5M3P0, C5P5Z4, C6HQ17, C7GKL8, C7YRJ1, C8ZAF8, D1Z6B1

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 94 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Signaling by NTRK1 (TRKA)	5	16.7×	3e-03
rRNA modification in the nucleus and cytosol	5	15.9×	3e-03
Signaling by NTRKs	5	15.4×	3e-03
Diseases of signal transduction by growth factor receptors and second messengers	7	6.7×	6e-03

GO biological processes:

GO term	Partners	Fold	FDR
ribosomal small subunit biogenesis	6	15.5×	1e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

126 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	108
Likely benign	2
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

2194 predictions. Top by Δscore:

Variant	Effect	Δscore
1:209828180:G:T	donor_gain	1.0000
1:209830797:TTTTA:T	acceptor_loss	1.0000
1:209830799:TTA:T	acceptor_loss	1.0000
1:209830800:TA:T	acceptor_loss	1.0000
1:209830801:A:AG	acceptor_gain	1.0000
1:209830801:A:AT	acceptor_loss	1.0000
1:209830802:G:GG	acceptor_gain	1.0000
1:209830802:GT:G	acceptor_gain	1.0000
1:209830802:GTC:G	acceptor_gain	1.0000
1:209830802:GTCA:G	acceptor_gain	1.0000
1:209831039:AGAGA:A	donor_gain	1.0000
1:209831040:GAGA:G	donor_gain	1.0000
1:209831040:GAGAG:G	donor_gain	1.0000
1:209831041:AGA:A	donor_gain	1.0000
1:209831042:GA:G	donor_gain	1.0000
1:209831042:GAG:G	donor_gain	1.0000
1:209831044:G:C	donor_loss	1.0000
1:209831044:G:GG	donor_gain	1.0000
1:209831045:T:G	donor_loss	1.0000
1:209833316:G:GT	donor_gain	1.0000
1:209833370:GT:G	donor_gain	1.0000
1:209835164:G:GG	donor_gain	1.0000
1:209836799:A:AG	acceptor_gain	1.0000
1:209836799:AGT:A	acceptor_gain	1.0000
1:209836800:G:GA	acceptor_gain	1.0000
1:209836800:GT:G	acceptor_gain	1.0000
1:209836800:GTG:G	acceptor_gain	1.0000
1:209837208:CAAGG:C	donor_loss	1.0000
1:209837210:AGGTG:A	donor_loss	1.0000
1:209837213:T:A	donor_loss	1.0000

AlphaMissense

5042 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
1:209838931:G:C	R362P	0.998
1:209839119:T:C	F425L	0.998
1:209839121:C:A	F425L	0.998
1:209839121:C:G	F425L	0.998
1:209840904:C:G	S445W	0.998
1:209840931:G:A	G454D	0.998
1:209842323:G:C	R515P	0.998
1:209843552:G:C	R628P	0.998
1:209839021:T:C	F392S	0.997
1:209840853:G:A	G428E	0.997
1:209841037:G:C	Q489H	0.997
1:209841037:G:T	Q489H	0.997
1:209838913:T:C	L356P	0.996
1:209839113:G:C	D423H	0.996
1:209840907:A:T	D446V	0.996
1:209840922:C:T	S451F	0.996
1:209841040:C:A	N490K	0.996
1:209841040:C:G	N490K	0.996
1:209841041:T:A	W491R	0.996
1:209841041:T:C	W491R	0.996
1:209842365:G:C	R529P	0.996
1:209843672:C:T	T668I	0.996
1:209837204:G:C	R352T	0.995
1:209837204:G:T	R352M	0.995
1:209839120:T:C	F425S	0.995
1:209840922:C:A	S451Y	0.995
1:209843546:G:C	R626P	0.995
1:209839114:A:T	D423V	0.994
1:209839128:G:A	G428R	0.994
1:209839128:G:C	G428R	0.994

dbSNP variants (sampled 300 via entrez): RS1000127283 (1:209845973 C>T), RS1000296113 (1:209835473 A>G), RS1000331843 (1:209855322 G>A), RS1000517735 (1:209842293 C>G), RS1000564380 (1:209844036 GT>G), RS1000745860 (1:209854949 ATCTTCATTACCAAATTTCTACTCCACACT>A), RS1000790681 (1:209848887 T>C), RS1001018397 (1:209844346 T>C), RS1001333845 (1:209855308 T>G), RS1001394189 (1:209855885 G>A), RS1001503288 (1:209849505 G>A,T), RS1001672786 (1:209843089 A>G), RS1001869963 (1:209828969 T>G), RS1001885024 (1:209832325 T>A), RS1001885872 (1:209857686 G>A,C)

Disease associations

OMIM: gene MIM:619663 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

5 associations (top):

Study	Trait	p-value
GCST003996_12	Monobrow	2.000000e-11
GCST004131_1	Inflammatory bowel disease	1.000000e-08
GCST004132_85	Crohn’s disease	7.000000e-07
GCST004166_10	Nonsyndromic cleft lip with cleft palate	9.000000e-19
GCST004866_6	Alopecia areata	2.000000e-06

EFO canonical traits (2, from GWAS)

EFO ID	Trait name
EFO:0007906	synophrys measurement
EFO:0003959	cleft lip

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

43 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects expression, decreases expression, decreases methylation	4
Arsenic	increases expression, increases methylation, affects cotreatment, increases abundance	2
Phenylmercuric Acetate	affects cotreatment, increases expression	2
Cyclosporine	increases expression	2
aristolochic acid I	increases expression	1
triphenyl phosphate	affects expression	1
bisphenol A	decreases expression	1
arsenite	increases methylation	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
sodium arsenite	affects cotreatment, increases abundance, increases expression	1
zinc chromate	increases abundance, increases expression	1
manganese chloride	affects cotreatment, increases abundance, increases expression	1
potassium chromate(VI)	decreases expression	1
chromium hexavalent ion	increases abundance, increases expression	1
perfluoro-n-nonanoic acid	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
dorsomorphin	affects cotreatment, increases expression	1
(+)-JQ1 compound	decreases expression	1
Sunitinib	increases expression	1
Leflunomide	increases expression	1
Acetaminophen	decreases expression	1
Air Pollutants	decreases expression, increases abundance	1
Benzo(a)pyrene	affects methylation	1
Cisplatin	decreases expression	1
Dichlorodiphenyl Dichloroethylene	increases expression	1
Doxorubicin	decreases expression	1
Estradiol	increases expression	1
Ethyl Methanesulfonate	decreases expression	1
Hydrogen Peroxide	affects expression	1
Lead	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.