VCY

Summary

VCY (variable charge Y-linked, HGNC:12668) is a protein-coding gene on chromosome Yq11.221, encoding Testis-specific basic protein Y 1 (O14598). May mediate a process in spermatogenesis or may play a role in sex ratio distortion.

The protein encoded by this gene is a member of a family of human VCX/Y genes. This gene family has multiple members on both X and Y chromosomes, and all are expressed exclusively in male germ cells. Members of the VCX/Y family share a high degree of sequence identity, with the exception that a 30-bp unit is tandemly repeated in X-linked members but occurs only once in Y-linked members. VCX/Y genes encode small and highly charged proteins of unknown function. This gene encodes a small, positively charged protein. The presence of a putative bipartite nuclear localization signal suggests that this gene encodes a nuclear protein. The genome has two identical copies of this gene within a palindromic region; this record represents the more centromeric copy.

Source: NCBI Gene 9084 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 2 total
• Phenotypes (HPO): 4
• MANE Select transcript: NM_004679

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:12668
Approved symbol	VCY
Name	variable charge Y-linked
Location	Yq11.221
Locus type	gene with protein product
Status	Approved
Aliases	BPY1, VCY1A, VCY1
Ensembl gene	ENSG00000129864
Ensembl biotype	protein_coding
OMIM	400012
Entrez	9084

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding

ENST00000250825

RefSeq mRNA: 1 — MANE Select: NM_004679 NM_004679

CCDS: CCDS56617

Canonical transcript exons

ENST00000250825 — 2 exons

Exon	Start	End
ENSE00001622417	13985772	13986146
ENSE00001940528	13986339	13986473

Expression profiles

Bgee: expression breadth tissue_specific, 7 present calls, max score 93.49.

Top tissues by expression

117 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	93.49	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	89.94	gold quality
right testis	UBERON:0004534	88.52	gold quality
left testis	UBERON:0004533	87.15	gold quality
testis	UBERON:0000473	86.82	gold quality
bone marrow cell	CL:0002092	38.94	gold quality
colonic epithelium	UBERON:0000397	37.20	gold quality
ventricular zone	UBERON:0003053	36.48	gold quality
cortical plate	UBERON:0005343	36.47	gold quality
ganglionic eminence	UBERON:0004023	35.49	gold quality
skeletal muscle tissue	UBERON:0001134	33.38	gold quality
bone marrow	UBERON:0002371	33.16	gold quality
hindlimb stylopod muscle	UBERON:0004252	32.15	gold quality
muscle tissue	UBERON:0002385	31.06	gold quality
sural nerve	UBERON:0015488	30.93	gold quality
stromal cell of endometrium	CL:0002255	29.87	gold quality
prefrontal cortex	UBERON:0000451	29.04	gold quality
duodenum	UBERON:0002114	28.14	gold quality
liver	UBERON:0002107	28.04	gold quality
lymph node	UBERON:0000029	27.57	gold quality
tonsil	UBERON:0002372	27.05	gold quality
islet of Langerhans	UBERON:0000006	26.55	gold quality
vermiform appendix	UBERON:0001154	26.42	gold quality
gall bladder	UBERON:0002110	25.98	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	25.89	gold quality
placenta	UBERON:0001987	25.81	gold quality
urinary bladder	UBERON:0001255	25.72	gold quality
leukocyte	CL:0000738	25.56	gold quality
monocyte	CL:0000576	25.36	gold quality
primary visual cortex	UBERON:0002436	24.61	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-GEOD-134144	yes	1042.76
E-ANND-3	no	0.11

Regulation

Is transcription factor: no

Literature-anchored findings (GeneRIF, showing 2)

• Human VCX/Y, SPANX, and CSAG2 gene families together with the murine SPANX gene and the CYPT family may share a common ancestor. (PMID:17342728)
• Identified members of the VCX/Y gene family as novel CT antigens. (PMID:24970476)

Cross-species orthologs

0 orthologs

Paralogs (5): VCY1B (ENSG00000129862), VCX3A (ENSG00000169059), VCX2 (ENSG00000177504), VCX (ENSG00000182583), VCX3B (ENSG00000205642)

Protein

Protein identifiers

Testis-specific basic protein Y 1 — O14598 (reviewed: O14598)

Alternative names: Basic charge, Y-linked 1, Variably charged protein Y

All UniProt accessions (1): O14598

UniProt curated annotations — full annotation on UniProt →

Function. May mediate a process in spermatogenesis or may play a role in sex ratio distortion.

Tissue specificity. Expressed exclusively in testis.

Similarity. Belongs to the VCX/VCY family.

RefSeq proteins (1): NP_004670* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR026653	VCX/VCY1	Family

Pfam: PF15231

UniProt features (4 total): compositionally biased region 2, chain 1, region of interest 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O14598-F1	64.07	0.00

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 20 (showing top): YAGI_AML_WITH_INV_16_TRANSLOCATION, GAZDA_DIAMOND_BLACKFAN_ANEMIA_PROGENITOR_DN, GOBP_HEAD_DEVELOPMENT, MODULE_104, MODULE_13, chrYq11, MODULE_41, HP_ABNORMALITY_OF_REPRODUCTIVE_SYSTEM_PHYSIOLOGY, HP_DECREASED_FERTILITY, HP_INFERTILITY, HP_Y_LINKED_INHERITANCE, HP_ADULT_ONSET, HP_YOUNG_ADULT_ONSET, HP_DECREASED_FERTILITY_IN_MALES, HP_ABNORMAL_MALE_REPRODUCTIVE_SYSTEM_PHYSIOLOGY

GO Biological Process (1): brain development (GO:0007420)

GO Molecular Function (1): protein binding (GO:0005515)

GO Cellular Component (0):

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
central nervous system development	1
animal organ development	1
head development	1
binding	1

Protein interactions and networks

STRING

188 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
VCY	BPY2	O14599	946
VCY	CDY2A	Q9Y6F7	933
VCY	CDY1	Q9Y6F8	918
VCY	PRY	O14603	912
VCY	TSPY1	P09002	728
VCY	HSFY1	Q96LI6	720
VCY	DAZ1	Q9NQZ3	720
VCY	DAZ2	Q13117	703
VCY	RBMY1A1	P0DJD3	700
VCY	CDYL	Q9Y232	698
VCY	TMSB4Y	O14604	666
VCY	E7ERQ6	E7ERQ6	662
VCY	TGIF2LY	Q8IUE0	621
VCY	CDYL2	Q8N8U2	606
VCY	PRKY	O43930	598

IntAct

9 interactions, top by confidence:

A	B	Type	Score
	DDX3X	psi-mi:“MI:0914”(association)	0.630
SH3GL3	VCY	psi-mi:“MI:0915”(physical association)	0.560
VCY	WDR45B	psi-mi:“MI:0914”(association)	0.350
VCY	GPX4	psi-mi:“MI:0914”(association)	0.350
	EBAG9	psi-mi:“MI:0914”(association)	0.350
SMC5	DKFZp686H10254	psi-mi:“MI:2364”(proximity)	0.270

BioGRID (8): VCY (Reconstituted Complex), NTMT1 (Affinity Capture-MS), WDR45B (Affinity Capture-MS), GPX4 (Affinity Capture-MS), VCY (Cross-Linking-MS (XL-MS)), VCY (Cross-Linking-MS (XL-MS)), ATP5B (Cross-Linking-MS (XL-MS)), APP (Reconstituted Complex)

ESM2 similar proteins: A0A1B0GTR3, A0A7H0DN82, A7RR34, E9PVX6, O14598, O60356, O60829, O94243, P04605, P04614, P05909, P0C1K0, P0C765, P0C766, P0DPH9, P17285, P17759, P18098, P19416, P20290, P24109, P46012, P46583, Q06428, Q07555, Q08561, Q09821, Q1L9C7, Q32PF3, Q3KP22, Q5M948, Q5M951, Q5MJ08, Q5RCI9, Q6P8I4, Q758T8, Q76632, Q7M2N1, Q7TP40, Q80WR5

Diamond homologs: O14598, Q9H320, Q9H321, Q9H322, Q9NNX9

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

2 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	0
Likely benign	0
Benign	2

Top pathogenic / likely-pathogenic (0)

SpliceAI

38 predictions. Top by Δscore:

Variant	Effect	Δscore
Y:13986335:TCAC:T	donor_loss	1.0000
Y:13986336:CACCT:C	donor_loss	1.0000
Y:13986337:A:AC	donor_gain	1.0000
Y:13986338:C:CC	donor_gain	1.0000
Y:13986338:CCTT:C	donor_gain	1.0000
Y:13986142:GTAGT:G	acceptor_gain	0.9900
Y:13986143:TAGT:T	acceptor_gain	0.9900
Y:13986145:GT:G	acceptor_gain	0.9900
Y:13986145:GTC:G	acceptor_loss	0.9900
Y:13986147:C:CC	acceptor_gain	0.9900
Y:13986157:A:T	acceptor_gain	0.9900
Y:13986159:C:CT	acceptor_gain	0.9900
Y:13986337:AC:A	donor_gain	0.9900
Y:13986337:ACCTT:A	donor_gain	0.9900
Y:13986338:CC:C	donor_gain	0.9900
Y:13986338:CCT:C	donor_gain	0.9900
Y:13986338:CCTTC:C	donor_gain	0.9900
Y:13986380:T:TA	donor_gain	0.9900
Y:13986143:TAGTC:T	acceptor_gain	0.9800
Y:13986144:AGT:A	acceptor_gain	0.9800
Y:13986144:AGTCT:A	acceptor_gain	0.9800
Y:13986145:GTCTG:G	acceptor_gain	0.9800
Y:13986146:TCTGG:T	acceptor_gain	0.9800
Y:13986156:C:CT	acceptor_gain	0.9800
Y:13986160:A:T	acceptor_gain	0.9800
Y:13986147:C:A	acceptor_gain	0.9700
Y:13986148:T:G	acceptor_gain	0.9600
Y:13986387:T:A	donor_gain	0.9600
Y:13986138:CTTGG:C	acceptor_gain	0.7400
Y:13986139:TTGGT:T	acceptor_gain	0.7400

AlphaMissense

800 scored. Top likely-pathogenic:

dbSNP variants (sampled 11 via entrez): RS111715503 (Y:13985622 C>T), RS112070685 (Y:13985519 G>T), RS113518653 (Y:13988144 A>G), RS1556564366 (Y:13985366 A>C), RS1556564369 (Y:13985420 A>C), RS1556564373 (Y:13985641 T>C), RS1556564376 (Y:13985895 G>A), RS1556564378 (Y:13986443 G>T), RS1569517539 (Y:13985666 GCCTCCCTCCCTCCCCACACACCACCTCTT>G), RS1569517540 (Y:13986034 G>C), RS2520627068 (Y:13987207 CTGTG>C)

Disease associations

OMIM: gene MIM:400012 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

4 total (4 of 4 shown, HPO-id order):

HPO	Term
HP:0000027	Azoospermia
HP:0001450	Y-linked inheritance
HP:0003251	Male infertility
HP:0011462	Young adult onset

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

5 total (human), top 5 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
butyraldehyde	increases expression	1
CGP 52608	affects binding, increases reaction	1
Resveratrol	affects cotreatment, decreases expression	1
Plant Extracts	affects cotreatment, decreases expression	1
Copper Sulfate	increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.