VPS53

Summary

VPS53 (VPS53 subunit of GARP complex, HGNC:25608) is a protein-coding gene on chromosome 17p13.3, encoding Vacuolar protein sorting-associated protein 53 homolog (Q5VIR6). Acts as a component of the GARP complex that is involved in retrograde transport from early and late endosomes to the trans-Golgi network (TGN). It is a selective cancer dependency (DepMap: 14.6% of cell lines).

Involved in endocytic recycling and retrograde transport, endosome to Golgi. Acts upstream of or within lysosomal transport. Located in several cellular components, including Golgi apparatus; perinuclear region of cytoplasm; and recycling endosome. Part of EARP complex and GARP complex. Implicated in pontocerebellar hypoplasia type 2E.

Source: NCBI Gene 55275 — RefSeq curated summary.

At a glance

• Gene–disease (curated): pontocerebellar hypoplasia, type 13 (Strong, GenCC) — +2 more curated relationships
• GWAS associations: 49
• Clinical variants (ClinVar): 650 total — 3 pathogenic, 13 likely-pathogenic
• Phenotypes (HPO): 39
• Cancer dependency (DepMap): dependent in 14.6% of screened cell lines
• Dosage sensitivity (ClinGen): haploinsufficiency autosomal recessive, triplosensitivity unscored
• MANE Select transcript: NM_001128159

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:25608
Approved symbol	VPS53
Name	VPS53 subunit of GARP complex
Location	17p13.3
Locus type	gene with protein product
Status	Approved
Aliases	FLJ10979, HCCS1
Ensembl gene	ENSG00000141252
Ensembl biotype	protein_coding
OMIM	615850
Entrez	55275

Gene structure

Transcript identifiers

Ensembl transcripts: 72 — 33 protein_coding, 17 nonsense_mediated_decay, 13 protein_coding_CDS_not_defined, 9 retained_intron

ENST00000291074, ENST00000389040, ENST00000401468, ENST00000437048, ENST00000541903, ENST00000570359, ENST00000570510, ENST00000570650, ENST00000570771, ENST00000571456, ENST00000571805, ENST00000572259, ENST00000572334, ENST00000572607, ENST00000573028, ENST00000574029, ENST00000575100, ENST00000575207, ENST00000576019, ENST00000576149, ENST00000679361, ENST00000679447, ENST00000679468, ENST00000679680, ENST00000679817, ENST00000679865, ENST00000679959, ENST00000679961, ENST00000679978, ENST00000680069, ENST00000680114, ENST00000680128, ENST00000680241, ENST00000680274, ENST00000680465, ENST00000680641, ENST00000680660, ENST00000680702, ENST00000680704, ENST00000680872, ENST00000680944, ENST00000680958, ENST00000680970, ENST00000681035, ENST00000681050, ENST00000681096, ENST00000681103, ENST00000681120, ENST00000681133, ENST00000681154, ENST00000681160, ENST00000681205, ENST00000681217, ENST00000681229, ENST00000681295, ENST00000681317, ENST00000681423, ENST00000681442, ENST00000681478, ENST00000681510, ENST00000681570, ENST00000681578, ENST00000681600, ENST00000681661, ENST00000681830, ENST00000681858, ENST00000681866, ENST00000681897, ENST00000681902, ENST00000681917, ENST00000681943, ENST00000681946

RefSeq mRNA: 4 — MANE Select: NM_001128159 NM_001128159, NM_001366253, NM_001366254, NM_018289

CCDS: CCDS10995, CCDS45558, CCDS92214

Canonical transcript exons

ENST00000437048 — 22 exons

Exon	Start	End
ENSE00001653806	508668	519298
ENSE00003458365	655838	655953
ENSE00003469619	537028	537176
ENSE00003493686	631550	631628
ENSE00003508285	562503	562745
ENSE00003508928	697418	697484
ENSE00003513883	627174	627316
ENSE00003518517	623533	623674
ENSE00003527155	586270	586364
ENSE00003539039	532842	532911
ENSE00003552587	521601	521738
ENSE00003557753	553380	553462
ENSE00003609293	710533	710613
ENSE00003609799	699331	699380
ENSE00003615405	628088	628231
ENSE00003641629	551872	551950
ENSE00003649222	653291	653410
ENSE00003651806	661809	661895
ENSE00003655671	601795	601896
ENSE00003656560	519826	519930
ENSE00003664865	560426	560573
ENSE00003847776	714623	714839

Expression profiles

Bgee: expression breadth ubiquitous, 140 present calls, max score 94.88.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 36.5450 / max 937.1130, expressed in 1821 samples.

FANTOM5 promoters (14 alternative TSS)

Promoter ID	TPM avg	Samples expressed
163635	35.1982	1820
163608	0.4356	100
163632	0.2229	103
163631	0.1609	5
163614	0.1292	23
163624	0.1176	48
163618	0.0696	20
163636	0.0552	17
163628	0.0500	10
163625	0.0426	12

Top tissues by expression

140 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
sural nerve	UBERON:0015488	94.88	gold quality
bone marrow cell	CL:0002092	93.92	gold quality
stromal cell of endometrium	CL:0002255	91.96	gold quality
cerebellum	UBERON:0002037	91.61	gold quality
cerebellar cortex	UBERON:0002129	91.53	gold quality
cerebellar hemisphere	UBERON:0002245	91.45	gold quality
bone element	UBERON:0001474	91.23	gold quality
bone marrow	UBERON:0002371	91.23	gold quality
corpus callosum	UBERON:0002336	91.18	gold quality
right hemisphere of cerebellum	UBERON:0014890	90.93	gold quality
right testis	UBERON:0004534	90.73	gold quality
left testis	UBERON:0004533	90.72	gold quality
testis	UBERON:0000473	89.97	gold quality
prefrontal cortex	UBERON:0000451	89.50	gold quality
tonsil	UBERON:0002372	89.49	gold quality
superior frontal gyrus	UBERON:0002661	89.46	gold quality
skeletal muscle tissue	UBERON:0001134	88.73	gold quality
monocyte	CL:0000576	88.68	gold quality
colonic epithelium	UBERON:0000397	88.54	gold quality
calcaneal tendon	UBERON:0003701	88.52	gold quality
leukocyte	CL:0000738	88.48	gold quality
cortical plate	UBERON:0005343	87.76	gold quality
frontal cortex	UBERON:0001870	87.31	gold quality
frontal lobe	UBERON:0016525	87.31	gold quality
islet of Langerhans	UBERON:0000006	87.29	gold quality
blood	UBERON:0000178	86.80	gold quality
muscle tissue	UBERON:0002385	86.75	gold quality
skin of leg	UBERON:0001511	86.51	gold quality
ganglionic eminence	UBERON:0004023	86.31	gold quality
zone of skin	UBERON:0000014	86.30	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	2.40

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

26 targeting VPS53, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-22-3P	99.93	68.13	917
HSA-MIR-4778-3P	99.93	70.40	1818
HSA-MIR-4731-5P	99.89	67.23	2537
HSA-MIR-636	99.80	69.58	1500
HSA-MIR-4694-3P	99.79	69.53	2640
HSA-MIR-6727-3P	99.49	65.92	1333
HSA-MIR-4480	99.42	66.02	735
HSA-MIR-4722-3P	99.35	65.22	1099
HSA-MIR-504-3P	99.30	67.18	1745
HSA-MIR-10522-5P	99.26	68.50	2087
HSA-MIR-422A	99.18	65.83	550
HSA-MIR-3074-5P	98.82	66.56	1414
HSA-MIR-4755-3P	98.77	65.59	1915
HSA-MIR-4763-5P	98.75	63.89	854
HSA-MIR-378A-3P	98.43	66.10	548
HSA-MIR-378B	98.43	65.36	573
HSA-MIR-378C	98.43	66.10	548
HSA-MIR-378D	98.43	66.10	548
HSA-MIR-378E	98.43	65.99	551
HSA-MIR-378F	98.43	65.66	554
HSA-MIR-378H	98.43	66.16	545
HSA-MIR-378I	98.43	66.10	548
HSA-MIR-122-5P	97.23	64.92	1024
HSA-MIR-500B-3P	96.49	65.40	1087
HSA-MIR-6879-3P	93.93	64.00	759
HSA-MIR-6503-3P	93.87	66.39	348

Functional genomics

ClinGen dosage: haploinsufficiency 30 (autosomal recessive), triplosensitivity Not yet evaluated (unscored). ClinGen Gene Dosage Map DepMap (CRISPR cell-line fitness): dependent in 14.6% of screened cell lines.

Literature-anchored findings (GeneRIF, showing 9)

• Golgi associated retrograde protein complex, consisting of the Vps52, Vps53, and Vps54 proteins, shows significant conservation between various species but diversification and specialization result in important differences in human cells. (PMID:15878329)
• Data show that transcription of the putative tumor suppressor gene HCCS1 requires binding of ETS-2 to its consensus near the transcription start site; observations provide insight into the mechanistic aspects of HCCS1 transcription regulation (PMID:16953216)
• Amphipathic tail-anchoring peptide (ATAP) targets specifically to mitochondria, and induces caspase-dependent apoptosis that does not require Bax or Bak. (PMID:17666431)
• Missorting of cathepsin D in GARP-depleted cells results from accumulation of recycling MPRs in a population of light, small vesicles downstream of endosomes. (PMID:18367545)
• Golgi-associated retrograde protein orchestrates retrograde transport from endosomes to the trans-Golgi network by promoting vesicle tethering and assembly of SNARE complexes in consecutive, independent steps.[Golgi associated retrograde protein] (PMID:19620288)
• sensitivity of serum Hepatocellular carcinoma suppressor 1 (HCCS1) promoter methylation for discriminating patients with hepatocellular carcinoma from chronic hepatitis B was 62.5% (PMID:28189396)
• HCCS1 inhibits the stemness of human pancreatic cancer stem-like cells. (PMID:30915757)
• VPS53 gene is associated with a new phenotype of complicated hereditary spastic paraparesis. (PMID:31418091)
• Novel and deleterious variants in VPS53, GLB1, and MLC1, genes previously associated with variable neurodevelopmental anomalies, were found to segregate with intellectual disabilities in the three families. (PMID:32209057)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	vps53	ENSDARG00000069324
mus_musculus	Vps53	ENSMUSG00000017288
rattus_norvegicus	Vps53	ENSRNOG00000006895
drosophila_melanogaster	Vps53	FBGN0031598
caenorhabditis_elegans		WBGENE00011502

Protein

Protein identifiers

Vacuolar protein sorting-associated protein 53 homolog — Q5VIR6 (reviewed: Q5VIR6)

All UniProt accessions (43): A0A7P0T7U9, A0A7P0T804, A0A7P0T805, A0A7P0T874, A0A7P0T8A5, A0A7P0T8A9, A0A7P0T8D0, A0A7P0T8I9, A0A7P0T8K1, A0A7P0T8P7, A0A7P0T8S5, A0A7P0T8V1, Q5VIR6, A0A7P0T8V2, A0A7P0T8V9, A0A7P0T9B2, A0A7P0T9B6, A0A7P0T9V8, A0A7P0T9X9, A0A7P0T9Z7, A0A7P0TA41, A0A7P0TA53, A0A7P0TA79, A0A7P0TA82, A0A7P0TAE0, A0A7P0TAF8, A0A7P0TAK4, A0A7P0TB16, A0A7P0TB80, A0A7P0TBG3, A0A7P0TBJ8, A0A7P0TBK3, A0A7P0Z400, A0A7P0Z461, A0A7P0Z4K0, A0A7P0Z4M8, A0A7P0Z4Q7, E7EVT8, F6VX93, I3L0S6, I3L184, I3L1W6, I3L4P9

UniProt curated annotations — full annotation on UniProt →

Function. Acts as a component of the GARP complex that is involved in retrograde transport from early and late endosomes to the trans-Golgi network (TGN). The GARP complex is required for the maintenance of the cycling of mannose 6-phosphate receptors between the TGN and endosomes, this cycling is necessary for proper lysosomal sorting of acid hydrolases such as CTSD. Acts as a component of the EARP complex that is involved in endocytic recycling. The EARP complex associates with Rab4-positive endosomes and promotes recycling of internalized transferrin receptor (TFRC) to the plasma membrane.

Subunit / interactions. Component of the Golgi-associated retrograde protein (GARP) complex, also called VFT (VPS fifty-three) complex, composed of VPS51, VPS52, VPS53 and VPS54. Component of the endosome-associated retrograde protein (EARP) complex, composed of VPS51, VPS52, VPS53 and VPS50/Syndetin. EIPR1 interacts with both EARP and GARP complexes and mediates the recruitment of the GARP complex to the trans-Golgi network. Interacts with VPS50 in an EIPR1-independent manner.

Subcellular location. Golgi apparatus. trans-Golgi network membrane. Endosome membrane. Recycling endosome.

Disease relevance. Pontocerebellar hypoplasia 2E (PCH2E) [MIM:615851] An autosomal recessive neurodegenerative disorder characterized by progressive cerebello-cerebral atrophy, profound intellectual disability, progressive microcephaly, spasticity, and early-onset epilepsy. The disease is caused by variants affecting the gene represented in this entry.

Similarity. Belongs to the VPS53 family.

Isoforms (4)

UniProt ID	Names	Canonical?
Q5VIR6-4	1	yes
Q5VIR6-1	2, long
Q5VIR6-2	3, short
Q5VIR6-3	4

RefSeq proteins (4): NP_001121631, NP_001353182, NP_001353183, NP_060759 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR007234	Vps53_N	Domain
IPR031745	Vps53_C	Domain
IPR038260	Vps53_C_sf	Homologous_superfamily
IPR039766	Vps53	Family

Pfam: PF04100, PF16854

UniProt features (27 total): sequence conflict 7, modified residue 5, splice variant 5, sequence variant 3, compositionally biased region 3, region of interest 2, chain 1, coiled-coil region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q5VIR6-F1	80.86	0.46

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (5): 391, 580, 110, 360, 377

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-6811440	Retrograde transport at the Trans-Golgi-Network

MSigDB gene sets: 269 (showing top): GSE45365_NK_CELL_VS_CD8_TCELL_DN, GOBP_LYSOSOMAL_TRANSPORT, GCM_GSPT1, GOBP_INTRACELLULAR_PROTEIN_TRANSPORT, GOBP_PROTEIN_TARGETING, GOBP_VACUOLAR_TRANSPORT, GOBP_VESICLE_MEDIATED_TRANSPORT, REACTOME_MEMBRANE_TRAFFICKING, GOBP_ESTABLISHMENT_OF_PROTEIN_LOCALIZATION_TO_ORGANELLE, GOBP_PROTEIN_LOCALIZATION_TO_LYSOSOME, GOBP_ORGANIC_HYDROXY_COMPOUND_TRANSPORT, GOCC_TRANS_GOLGI_NETWORK, GOBP_PROTEIN_LOCALIZATION_TO_VACUOLE, GCM_DDX11, DODD_NASOPHARYNGEAL_CARCINOMA_UP

GO Biological Process (8): protein targeting to lysosome (GO:0006622), lysosomal transport (GO:0007041), endocytic recycling (GO:0032456), retrograde transport, endosome to Golgi (GO:0042147), vesicle-mediated cholesterol transport (GO:0090119), protein transport (GO:0015031), vesicle-mediated transport (GO:0016192), cytosolic transport (GO:0016482)

GO Molecular Function (1): protein binding (GO:0005515)

GO Cellular Component (10): GARP complex (GO:0000938), Golgi apparatus (GO:0005794), cytosol (GO:0005829), endosome membrane (GO:0010008), membrane (GO:0016020), trans-Golgi network membrane (GO:0032588), perinuclear region of cytoplasm (GO:0048471), recycling endosome (GO:0055037), EARP complex (GO:1990745), endosome (GO:0005768)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Intra-Golgi and retrograde Golgi-to-ER traffic	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cytoplasm	3
cellular anatomical structure	3
endosomal transport	2
cytosolic transport	2
transport	2
cytoplasmic vesicle	2
endomembrane system	2
endosome	2
protein targeting to vacuole	1
lysosomal transport	1
protein localization to lysosome	1
vacuolar transport	1
vesicle-mediated transport to the plasma membrane	1
intercellular transport	1
vesicle-mediated transport	1
intracellular cholesterol transport	1
intracellular protein localization	1
establishment of protein localization	1
cellular process	1
cytosol	1
intracellular transport	1
binding	1
Golgi apparatus	1
vesicle tethering complex	1
intracellular membrane-bounded organelle	1
cytoplasmic vesicle membrane	1
bounding membrane of organelle	1
trans-Golgi network	1
organelle membrane	1
protein-containing complex	1
recycling endosome	1

Protein interactions and networks

STRING

1624 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
VPS53	VPS54	Q9P1Q0	998
VPS53	VPS52	Q8N1B4	998
VPS53	VPS51	Q9UID3	997
VPS53	STX16	O14662	903
VPS53	VPS50	Q96JG6	877
VPS53	RAB6A	P20340	855
VPS53	COG4	Q9H9E3	826
VPS53	VAMP4	O75379	816
VPS53	STX6	O43752	815
VPS53	RAB6C	Q9H0N0	779
VPS53	TNPO3	Q9Y5L0	773
VPS53	COG7	P83436	769
VPS53	EXOC3	O60645	749
VPS53	COG8	Q96MW5	713
VPS53	ZNF787	Q6DD87	702

IntAct

94 interactions, top by confidence:

A	B	Type	Score
VPS50	VPS53	psi-mi:“MI:0914”(association)	0.840
VPS53	VPS50	psi-mi:“MI:0915”(physical association)	0.840
EXOC6	EXOC5	psi-mi:“MI:0914”(association)	0.840
PSMD7	PSMD11	psi-mi:“MI:0914”(association)	0.730
VPS53	VPS54	psi-mi:“MI:0915”(physical association)	0.670
CEP170	DAPK3	psi-mi:“MI:0914”(association)	0.530
EIPR1	LDHC	psi-mi:“MI:0914”(association)	0.530
VPS53	SNAP29	psi-mi:“MI:0914”(association)	0.530
TMEM9	ESYT2	psi-mi:“MI:0914”(association)	0.530
EIPR1	TCP1	psi-mi:“MI:0914”(association)	0.530
ANKRD22	ESYT2	psi-mi:“MI:0914”(association)	0.530
Vps54	VPS53	psi-mi:“MI:0915”(physical association)	0.400
	TK2	psi-mi:“MI:0915”(physical association)	0.400
VPS51	SNAP29	psi-mi:“MI:0914”(association)	0.350
VPS53	VPS52	psi-mi:“MI:0914”(association)	0.350
VPS50	STX16	psi-mi:“MI:0914”(association)	0.350
VPS52	VPS53	psi-mi:“MI:0914”(association)	0.350
MKI67	ARHGAP10	psi-mi:“MI:0914”(association)	0.350
CCDC40	PSMD9	psi-mi:“MI:0914”(association)	0.350
DTNBP1	AP3B1	psi-mi:“MI:0914”(association)	0.350
EXOC1	EXOC5	psi-mi:“MI:0914”(association)	0.350
SYCE3	TRIM24	psi-mi:“MI:0914”(association)	0.350

BioGRID (203): VPS53 (Affinity Capture-MS), VPS53 (Affinity Capture-MS), VPS53 (Affinity Capture-MS), VPS53 (Affinity Capture-MS), VPS53 (Affinity Capture-MS), VPS53 (Affinity Capture-MS), VPS51 (Co-fractionation), VPS53 (Co-fractionation), VPS53 (Affinity Capture-MS), VPS53 (Synthetic Lethality), VPS53 (Synthetic Lethality), VPS53 (Synthetic Lethality), CCDC132 (Affinity Capture-MS), VPS54 (Affinity Capture-MS), VPS53 (Affinity Capture-MS)

ESM2 similar proteins: A2A432, A6H5Z3, A9X1D0, B0VX69, B1MTJ4, B2KI88, B5FW36, C1FXW2, E2R766, E2RBS6, F1LSG8, O43242, O54923, O55047, O70133, P60762, Q13098, Q13619, Q13620, Q29425, Q2KJ46, Q3TCH7, Q4V860, Q5NVP9, Q5R5J4, Q5RAN1, Q5RB36, Q5VIR6, Q5ZKV9, Q5ZLD7, Q5ZML9, Q6AYU1, Q6NRT5, Q6NZH6, Q86TU7, Q8CCB4, Q8CI71, Q8K4Q0, Q8N122, Q8R3S6

Diamond homologs: P34561, Q5R5J4, Q5VIR6, Q5ZLD7, Q8CCB4, F4I7Y2, Q0WQF4

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 95 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

GO biological processes:

GO term	Partners	Fold	FDR
Golgi to plasma membrane transport	5	35.1×	7e-05
endocytic recycling	6	20.1×	9e-05
protein transport	15	8.2×	2e-07

Disease & clinical

Clinical variants and AI predictions

ClinVar

650 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	3
Likely pathogenic	13
Uncertain significance	131
Likely benign	399
Benign	73

Top pathogenic / likely-pathogenic (16)

Variant ID	HGVS	Classification
139444	NM_001128159.3(VPS53):c.2084A>G (p.Gln695Arg)	Pathogenic
4075917	GRCh37/hg19 17p13.3(chr17:428071-471775)x1	Pathogenic
4075939	GRCh37/hg19 17p13.3(chr17:572297-614293)x1	Pathogenic
1335927	NM_001128159.3(VPS53):c.88-2A>G	Likely pathogenic
3582153	NM_001128159.3(VPS53):c.1972del (p.Ser658fs)	Likely pathogenic
3582154	NM_001128159.3(VPS53):c.1915del (p.Thr639fs)	Likely pathogenic
3582334	NM_001128159.3(VPS53):c.840G>A (p.Trp280Ter)	Likely pathogenic
3582335	NM_001128159.3(VPS53):c.800_801del (p.Glu267fs)	Likely pathogenic
3582336	NM_001128159.3(VPS53):c.687+1G>A	Likely pathogenic
3582337	NM_001128159.3(VPS53):c.609-1G>T	Likely pathogenic
3582399	NM_001128159.3(VPS53):c.238C>T (p.Arg80Ter)	Likely pathogenic
3582400	NM_001128159.3(VPS53):c.168+2T>G	Likely pathogenic
4686164	NM_001128159.3(VPS53):c.137A>G (p.Glu46Gly)	Likely pathogenic
557943	NM_001128159.3(VPS53):c.1516C>T (p.Arg506Ter)	Likely pathogenic
817131	NM_001128159.3(VPS53):c.300_301dup (p.Gln101fs)	Likely pathogenic
818227	NM_001128159.3(VPS53):c.692C>T (p.Pro231Leu)	Likely pathogenic

SpliceAI

3950 predictions. Top by Δscore:

Variant	Effect	Δscore
17:537026:A:AC	donor_gain	1.0000
17:537027:C:CC	donor_gain	1.0000
17:537027:CTTTG:C	donor_gain	1.0000
17:537059:A:AC	donor_gain	1.0000
17:537060:C:CC	donor_gain	1.0000
17:537174:CAT:C	acceptor_gain	1.0000
17:537177:C:CC	acceptor_gain	1.0000
17:551866:CCTTA:C	donor_loss	1.0000
17:551867:CTTAC:C	donor_loss	1.0000
17:551868:TTAC:T	donor_loss	1.0000
17:551869:TA:T	donor_loss	1.0000
17:551870:A:C	donor_loss	1.0000
17:551871:C:G	donor_loss	1.0000
17:551871:CCTTG:C	donor_gain	1.0000
17:553379:CGTG:C	donor_gain	1.0000
17:553459:CTAG:C	acceptor_gain	1.0000
17:553460:TAG:T	acceptor_gain	1.0000
17:553463:C:CC	acceptor_gain	1.0000
17:553466:T:C	acceptor_gain	1.0000
17:553466:T:TC	acceptor_gain	1.0000
17:553474:C:CT	acceptor_gain	1.0000
17:560420:GCTCA:G	donor_loss	1.0000
17:560421:CTCAC:C	donor_loss	1.0000
17:560422:TCA:T	donor_loss	1.0000
17:560423:CAC:C	donor_loss	1.0000
17:560425:CCTG:C	donor_gain	1.0000
17:560569:TGGTT:T	acceptor_gain	1.0000
17:560570:GGTT:G	acceptor_gain	1.0000
17:560571:GTT:G	acceptor_gain	1.0000
17:560572:TT:T	acceptor_gain	1.0000

AlphaMissense

5492 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
17:521638:A:T	V729D	1.000
17:521731:A:G	L698P	1.000
17:521734:A:G	L697P	1.000
17:521737:A:G	L696P	1.000
17:532843:T:G	Q695P	1.000
17:537168:C:A	W625C	1.000
17:537168:C:G	W625C	1.000
17:537170:A:G	W625R	1.000
17:537170:A:T	W625R	1.000
17:553449:A:G	L573P	1.000
17:553461:A:G	L569P	1.000
17:560455:C:G	A559P	1.000
17:562545:A:G	L505P	1.000
17:562596:A:G	L488P	1.000
17:562622:C:A	K479N	1.000
17:562622:C:G	K479N	1.000
17:562638:A:G	L474P	1.000
17:586297:A:G	L429P	1.000
17:627289:G:T	R287S	1.000
17:655862:A:G	L155P	1.000
17:655871:A:G	L152P	1.000
17:655880:A:G	L149P	1.000
17:655893:A:G	S145P	1.000
17:655901:A:G	L142P	1.000
17:655901:A:T	L142Q	1.000
17:655907:C:G	R140P	1.000
17:655909:T:A	K139N	1.000
17:655909:T:G	K139N	1.000
17:655910:T:A	K139I	1.000
17:655913:G:T	A138D	1.000

dbSNP variants (sampled 300 via entrez): RS1000008068 (17:582246 CAGAACCTCAGTGCATTCTG>C), RS1000049054 (17:606967 C>T), RS1000049299 (17:527793 G>A,T), RS1000081314 (17:580649 C>G,T), RS1000100027 (17:564644 G>A), RS1000104396 (17:519035 G>A,T), RS1000107880 (17:597592 T>C), RS1000111568 (17:715699 G>A), RS1000124803 (17:684962 T>C), RS1000162687 (17:512032 G>A), RS1000164303 (17:598337 T>C), RS1000187036 (17:715426 T>G), RS1000187846 (17:551304 T>C), RS1000192118 (17:631424 G>A,C), RS1000202721 (17:513457 C>T)

Disease associations

OMIM: gene MIM:615850 | disease phenotypes: MIM:615851, MIM:607596

GenCC curated gene-disease

Disease	Classification	Inheritance
pontocerebellar hypoplasia, type 13	Strong	Autosomal recessive
pontocerebellar hypoplasia type 2E	Strong	Autosomal recessive
progressive cerebello-cerebral atrophy	Supportive	Autosomal recessive

Mondo (5): pontocerebellar hypoplasia type 2E (MONDO:0014370), pontocerebellar hypoplasia (MONDO:0020135), microcephaly (MONDO:0001149), pontocerebellar hypoplasia, type 13 (MONDO:0032831), (MONDO:0016589)

Orphanet (2): Progressive cerebello-cerebral atrophy (Orphanet:247198), Non-syndromic pontocerebellar hypoplasia (Orphanet:98523)

HPO phenotypes

39 total (30 of 39 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000252	Microcephaly
HP:0000253	Progressive microcephaly
HP:0000286	Epicanthus
HP:0000341	Narrow forehead
HP:0000347	Micrognathia
HP:0000445	Wide nose
HP:0000486	Strabismus
HP:0000648	Optic atrophy
HP:0000737	Irritability
HP:0000939	Osteoporosis
HP:0001249	Intellectual disability
HP:0001257	Spasticity
HP:0001263	Global developmental delay
HP:0001272	Cerebellar atrophy
HP:0001276	Hypertonia
HP:0001319	Neonatal hypotonia
HP:0001336	Myoclonus
HP:0001371	Flexion contracture
HP:0001508	Failure to thrive
HP:0002059	Cerebral atrophy
HP:0002079	Hypoplasia of the corpus callosum
HP:0002119	Ventriculomegaly
HP:0002179	Opisthotonus
HP:0002187	Profound intellectual disability
HP:0002510	Spastic tetraplegia
HP:0002650	Scoliosis
HP:0003196	Short nose
HP:0003593	Infantile onset
HP:0003676	Progressive

GWAS associations

49 associations (top):

Study	Trait	p-value
GCST001942_3	Prostate cancer	5.000000e-15
GCST004562_154	Waist circumference adjusted for body mass index	3.000000e-09
GCST004562_249	Waist circumference adjusted for body mass index	8.000000e-06
GCST004562_49	Waist circumference adjusted for body mass index	2.000000e-08
GCST004563_135	Waist circumference adjusted for BMI (joint analysis main effects and physical activity interaction)	4.000000e-08
GCST004563_31	Waist circumference adjusted for BMI (joint analysis main effects and physical activity interaction)	7.000000e-09
GCST004564_96	Waist circumference adjusted for BMI in active individuals	2.000000e-06
GCST004564_98	Waist circumference adjusted for BMI in active individuals	9.000000e-07
GCST006611_5	HDL cholesterol	1.000000e-08
GCST006632_6	Decline in glucose metabolism in posterior cingulate cortex	2.000000e-06
GCST010241_222	Apolipoprotein A1 levels	2.000000e-09
GCST010242_41	HDL cholesterol levels	6.000000e-15
GCST010244_184	Triglyceride levels	2.000000e-08
GCST011517_7	joint destruction in rheumatoid arthritis (rapid vs slow)	3.000000e-06
GCST012227_394	Hip circumference adjusted for BMI	4.000000e-10
GCST012229_181	Hip index	1.000000e-12
GCST90020026_53	Hip index	1.000000e-30
GCST90020026_54	Hip index	2.000000e-08
GCST90020026_55	Hip index	4.000000e-16
GCST90020026_56	Hip index	1.000000e-10
GCST90020026_57	Hip index	2.000000e-15
GCST90020026_58	Hip index	5.000000e-08
GCST90020026_59	Hip index	9.000000e-09
GCST90020026_60	Hip index	2.000000e-18
GCST90020026_61	Hip index	3.000000e-11
GCST90020026_62	Hip index	6.000000e-12
GCST90020026_63	Hip index	2.000000e-23
GCST90020026_64	Hip index	8.000000e-09
GCST90020026_65	Hip index	1.000000e-27
GCST90020026_66	Hip index	2.000000e-09

EFO canonical traits (8, from GWAS)

EFO ID	Trait name
EFO:0007789	BMI-adjusted waist circumference
EFO:0008002	physical activity measurement
EFO:0004612	high density lipoprotein cholesterol measurement
EFO:0009392	glucose metabolism decline measurement
EFO:0004614	apolipoprotein A 1 measurement
EFO:0004530	triglyceride measurement
EFO:0005413	joint damage measurement
EFO:0008039	BMI-adjusted hip circumference

MeSH disease descriptors (2)

Descriptor	Name	Tree numbers
D008831	Microcephaly	C05.660.207.620; C10.500.507.400.500; C16.131.621.207.620; C16.131.666.507.400.500
C580383	Pontocerebellar Hypoplasia (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

45 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects expression, increases expression, increases methylation	5
bisphenol A	decreases expression, affects cotreatment, decreases methylation	2
sodium arsenite	increases reaction, increases expression, affects binding	2
Benzo(a)pyrene	decreases expression, decreases methylation	2
Phenylmercuric Acetate	affects cotreatment, increases expression	2
aristolochic acid I	increases expression	1
FR900359	decreases phosphorylation	1
bisphenol F	increases expression	1
dicrotophos	increases expression	1
2,4,6-tribromophenol	increases expression	1
bufotalin	increases expression	1
propionaldehyde	increases expression	1
sodium arsenate	increases expression	1
decabromobiphenyl ether	increases expression	1
trichostatin A	affects expression	1
beta-lapachone	decreases expression	1
arsenite	affects binding, decreases reaction	1
mono-(2-ethylhexyl)phthalate	increases abundance, increases methylation	1
cobaltous chloride	decreases expression	1
butyraldehyde	decreases expression	1
tetrabromobisphenol A	increases expression	1
aflatoxin B2	decreases methylation	1
pentanal	decreases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	increases expression, affects cotreatment	1
bisphenol B	increases expression	1
dorsomorphin	affects cotreatment, increases expression	1
pentabrominated diphenyl ether 100	increases expression	1
Sunitinib	increases expression	1
Zoledronic Acid	decreases expression	1
Fulvestrant	affects cotreatment, decreases methylation	1

Clinical trials (associated diseases)

17 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT05518188	PHASE1/PHASE2	RECRUITING	Melpida: Recombinant Adeno-associated Virus (serotype 9) Encoding a Codon Optimized Human AP4M1 Transgene (hAP4M1opt)
NCT00001639	Not specified	COMPLETED	Evaluation of Patients With Unresolved Chromosome Abnormalities
NCT01151462	Not specified	WITHDRAWN	Postnatal HCMV Infection in Very Preterm Infants. Implications, Morbidity, Growth and Neurodevelopmental Outcomes.
NCT01565005	Not specified	COMPLETED	Microcephaly Genetic Deficiency in Neural Progenitors
NCT02510170	Not specified	COMPLETED	Fetal and Maternal Head Circumference During Pregnancy in Israeli Population
NCT02741882	Not specified	COMPLETED	Zika and Microcephaly: Case-control Study
NCT02943304	Not specified	COMPLETED	Neurodevelopment Outcome of Newborns Exposed to Zika Virus (ZIKV) in Utero
NCT03255369	Not specified	UNKNOWN	Vertical Exposure to Zika Virus and Its Consequences for Child Neurodevelopment (ZIKVIRUSIFF)
NCT03325946	Not specified	RECRUITING	The FBRI VTC Neuromotor Research Clinic
NCT03330600	Not specified	COMPLETED	Efficacy of Aquatic Physiotherapy in Children With Microcephaly by Zika Virus Congenital Syndrome
NCT03548779	Not specified	COMPLETED	North Carolina Genomic Evaluation by Next-generation Exome Sequencing, 2
NCT03651687	Not specified	COMPLETED	Guangzhou Surveillance and Clinical Study in Microcephaly (GSCSM)
NCT03922594	Not specified	TERMINATED	Surveillance of Zika-related Microcephaly in Sub-Saharan Africa and Asia
NCT04816175	Not specified	COMPLETED	Intensive Therapy for Children With Microcephaly, Hyperkinetic Movements, or Global Developmental Delay
NCT05322980	Not specified	COMPLETED	Summary of Infants Weighing 500 Grams or Less
NCT06019182	Not specified	RECRUITING	MEHMO Natural History and Biomarkers
NCT06566066	Not specified	RECRUITING	Register for Patients With Thyroid Hormone Resistance.