WARS1

Summary

WARS1 (tryptophanyl-tRNA synthetase 1, HGNC:12729) is a protein-coding gene on chromosome 14q32.2, encoding Tryptophan–tRNA ligase, cytoplasmic (P23381). Catalyzes the attachment of tryptophan to tRNA(Trp) in a two-step reaction: tryptophan is first activated by ATP to form Trp-AMP and then transferred to the acceptor end of the tRNA(Trp). It is a common-essential gene (DepMap: required in 99.0% of cancer cell lines).

Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Two forms of tryptophanyl-tRNA synthetase exist, a cytoplasmic form, named WARS, and a mitochondrial form, named WARS2. Tryptophanyl-tRNA synthetase (WARS) catalyzes the aminoacylation of tRNA(trp) with tryptophan and is induced by interferon. Tryptophanyl-tRNA synthetase belongs to the class I tRNA synthetase family. Four transcript variants encoding two different isoforms have been found for this gene.

Source: NCBI Gene 7453 — RefSeq curated summary.

At a glance

• Gene–disease (curated): distal hereditary motor neuropathy (Definitive, GenCC) — +2 more curated relationships
• GWAS associations: 1
• Clinical variants (ClinVar): 146 total — 1 pathogenic, 3 likely-pathogenic
• Phenotypes (HPO): 55
• Druggable target: yes
• Cancer dependency (DepMap): dependent in 99.0% of screened cell lines (common-essential)
• MANE Select transcript: NM_004184

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:12729
Approved symbol	WARS1
Name	tryptophanyl-tRNA synthetase 1
Location	14q32.2
Locus type	gene with protein product
Status	Approved
Aliases	IFP53
Ensembl gene	ENSG00000140105
Ensembl biotype	protein_coding
OMIM	191050
Entrez	7453

Gene structure

Transcript identifiers

Ensembl transcripts: 86 — 74 protein_coding, 7 retained_intron, 3 protein_coding_CDS_not_defined, 2 nonsense_mediated_decay

ENST00000344102, ENST00000355338, ENST00000358655, ENST00000392882, ENST00000553395, ENST00000553413, ENST00000553524, ENST00000553545, ENST00000553581, ENST00000553769, ENST00000553808, ENST00000553934, ENST00000554084, ENST00000554331, ENST00000554509, ENST00000554601, ENST00000554605, ENST00000554772, ENST00000554820, ENST00000554950, ENST00000555031, ENST00000555063, ENST00000555410, ENST00000555464, ENST00000555813, ENST00000556209, ENST00000556295, ENST00000556338, ENST00000556435, ENST00000556504, ENST00000556579, ENST00000556645, ENST00000556660, ENST00000556695, ENST00000556698, ENST00000556783, ENST00000557094, ENST00000557135, ENST00000557239, ENST00000557297, ENST00000557347, ENST00000557614, ENST00000557722, ENST00000627608, ENST00000883283, ENST00000883284, ENST00000883285, ENST00000883286, ENST00000883287, ENST00000883288, ENST00000883289, ENST00000883290, ENST00000883291, ENST00000883292, ENST00000883293, ENST00000883294, ENST00000883295, ENST00000883296, ENST00000883297, ENST00000883298, ENST00000883299, ENST00000883300, ENST00000883301, ENST00000883302, ENST00000940837, ENST00000940838, ENST00000940839, ENST00000940840, ENST00000940841, ENST00000960983, ENST00000960984, ENST00000960985, ENST00000960986, ENST00000960987, ENST00000960988, ENST00000960989, ENST00000960990, ENST00000960991, ENST00000960992, ENST00000960993, ENST00000960994, ENST00000960995, ENST00000960996, ENST00000960997, ENST00000960998, ENST00000960999

RefSeq mRNA: 4 — MANE Select: NM_004184 NM_004184, NM_173701, NM_213645, NM_213646

CCDS: CCDS9960, CCDS9961

Canonical transcript exons

ENST00000392882 — 11 exons

Exon	Start	End
ENSE00001314927	100333790	100335036
ENSE00002525476	100375283	100375347
ENSE00003524248	100353687	100353869
ENSE00003545921	100354447	100354566
ENSE00003645776	100369087	100369258
ENSE00003664628	100346746	100346846
ENSE00003667532	100342398	100342571
ENSE00003671570	100337062	100337202
ENSE00003691154	100360554	100360662
ENSE00003691538	100343275	100343387
ENSE00003785703	100361708	100361921

Expression profiles

Bgee: expression breadth ubiquitous, 291 present calls, max score 99.37.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 211.5603 / max 7668.8545, expressed in 1827 samples.

FANTOM5 promoters (11 alternative TSS)

Promoter ID	TPM avg	Samples expressed
144927	115.5772	1361
144936	59.0135	1826
144931	25.3636	1655
144935	4.9124	1321
144928	2.2508	610
144932	1.4171	687
144930	1.2472	465
144913	0.5211	283
144934	0.4910	284
144917	0.3902	178

Top tissues by expression

295 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
monocyte	CL:0000576	99.37	gold quality
mononuclear cell	CL:0000842	99.26	gold quality
leukocyte	CL:0000738	99.23	gold quality
granulocyte	CL:0000094	98.94	gold quality
upper lobe of left lung	UBERON:0008952	98.80	gold quality
right lung	UBERON:0002167	98.62	gold quality
apex of heart	UBERON:0002098	98.52	gold quality
upper lobe of lung	UBERON:0008948	98.47	gold quality
vermiform appendix	UBERON:0001154	98.08	gold quality
islet of Langerhans	UBERON:0000006	97.69	gold quality
rectum	UBERON:0001052	97.53	gold quality
colonic epithelium	UBERON:0000397	97.46	gold quality
stromal cell of endometrium	CL:0002255	97.26	gold quality
smooth muscle tissue	UBERON:0001135	97.25	gold quality
lung	UBERON:0002048	97.25	gold quality
heart left ventricle	UBERON:0002084	97.17	gold quality
cardiac ventricle	UBERON:0002082	97.13	gold quality
lymph node	UBERON:0000029	97.12	gold quality
omental fat pad	UBERON:0010414	97.11	gold quality
peritoneum	UBERON:0002358	97.09	gold quality
caecum	UBERON:0001153	96.96	gold quality
gall bladder	UBERON:0002110	96.83	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	96.83	gold quality
adipose tissue of abdominal region	UBERON:0007808	96.77	gold quality
placenta	UBERON:0001987	96.68	gold quality
spleen	UBERON:0002106	96.54	gold quality
visceral pleura	UBERON:0002401	96.43	gold quality
right adrenal gland	UBERON:0001233	96.27	gold quality
heart right ventricle	UBERON:0002080	96.22	gold quality
adenohypophysis	UBERON:0002196	96.20	gold quality

Single-cell (SCXA)

Detected in 12 experiment(s), a significant marker in 11.

Experiment	Marker?	Max mean expression
E-HCAD-1	yes	1004.65
E-CURD-114	yes	497.31
E-CURD-122	yes	37.95
E-MTAB-9221	yes	26.67
E-MTAB-6678	yes	25.28
E-HCAD-13	yes	21.31
E-MTAB-9467	yes	19.07
E-MTAB-6701	yes	12.28
E-MTAB-5061	yes	11.92
E-MTAB-9801	yes	6.51
E-GEOD-75688	no	4699.66
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): STAT1

miRNA regulators (miRDB)

56 targeting WARS1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-185-3P	99.95	67.01	1743
HSA-MIR-6753-3P	99.93	66.57	637
HSA-MIR-7107-3P	99.93	66.73	627
HSA-MIR-6768-5P	99.92	67.36	1942
HSA-MIR-345-3P	99.89	70.23	1421
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-4698	99.84	71.41	4303
HSA-MIR-323A-3P	99.79	70.30	1739
HSA-MIR-4319	99.76	69.83	2586
HSA-MIR-3150A-3P	99.76	64.44	1640
HSA-MIR-6763-5P	99.76	64.68	1767
HSA-MIR-4524A-3P	99.72	66.85	2406
HSA-MIR-646	99.68	67.84	1645
HSA-MIR-670-5P	99.67	69.94	1565
HSA-MIR-4527	99.66	67.43	714
HSA-MIR-545-5P	99.66	70.18	2308
HSA-MIR-10394-5P	99.65	66.83	1852
HSA-MIR-1205	99.65	66.76	1826
HSA-MIR-6512-3P	99.65	66.07	1468
HSA-MIR-6720-5P	99.65	66.22	1459
HSA-MIR-1251-3P	99.64	67.21	1408
HSA-MIR-6503-5P	99.62	66.96	597
HSA-MIR-762	99.58	66.61	1994
HSA-MIR-516B-5P	99.56	66.33	1495
HSA-MIR-4498	99.47	67.42	2360
HSA-MIR-330-3P	99.41	69.95	2521
HSA-MIR-125A-5P	99.36	70.59	1640
HSA-MIR-125B-5P	99.36	70.36	1662
HSA-MIR-1912-3P	99.32	67.40	936
HSA-MIR-4641	99.28	66.64	744

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 99.0% of screened cell lines, common-essential.

Literature-anchored findings (GeneRIF, showing 38)

• In this study, we show that a recombinant form of a COOH-terminal fragment of TrpRS is a potent antagonist of vascular endothelial growth factor-induced angiogenesis in a mouse model and of naturally occurring retinal angiogenesis in the neonatal mouse (PMID:11773625)
• Thus, protein synthesis may be linked to the regulation of angiogenesis by a natural fragment of TrpRS (PMID:11773626)
• Recognition by tryptophanyl-tRNA synthetases of discriminator base on tRNATrp from three biological domains (PMID:11834741)
• The recently discovered antiangiogenic and cell-signaling activities of tryptophanyl-tRNA synthetase bioactive fragments are discussed in this review. (PMID:12416978)
• TrpRS may have a role in the maintenance of vascular homeostasis (PMID:14630953)
• results suggest that mammalian and bacterial tryptophanyl-tRNA synthetase might use different mechanisms to recognize the substrate and modeling studies indicate that transfer RNA binds with the dimeric enzyme (PMID:14660560)
• A crystal structure of human tryptophanyl-tRNA synthetase was solved at 2.1 A with a tryptophanyl-adenylate bound at the active site (PMID:14671330)
• May play an important role in the intracellular regulation of protein synthesis under conditions of oxidative stress. (PMID:15628863)
• These crystals captured two conformations of the human tryptophanyl-tRNA synthetase and tRNATrp complex, which are nearly identical with respect to the protein and a bound tryptophan. (PMID:16724112)
• The first crystal structure of human tryptophanyl-tRNA synthetase (hTrpRS) in complex with tRNA(Trp) and Trp which, together with biochemical data, reveals the molecular basis of a novel tRNA binding and recognition mechanism. (PMID:16798914)
• Results provide the first evidence of the involvement of heme in regulation of TrpRS aminoacylation activity. (PMID:17877375)
• the annexin II-S100A10 complex, which regulates exocytosis, forms a ternary complex with TrpRS. (PMID:17999956)
• Analysis of the molecular basis of the mechanisms of the substrate recognition and the activation reaction by tryptophanyl-tRNA synthetase. (PMID:18180246)
• Indoleamine 2,3-dioxygenase (IDO)-expression in antigen-presenting cells (APCs) may control autoimmune responses by depleting the available tryptophan, whereas tryptophanyl-tRNA synthetase (TTS) may counteract this effect (PMID:19363598)
• Tryptophanyl-tRNA synthetase is a multidomain protein exhibiting excellent allosteric communication, and this research has provided valuable structural as well as functional insights into the protein. (PMID:19768679)
• Low tryptophanyl-tRNA synthetase is associated with recurrence in colorectal cancer. (PMID:19900940)
• Mini-tryptophanyl-tRNA synthetase inhibited ischemic angiogenesis in rats. (PMID:20963594)
• Naturally occurring fragments of the two proteins involved in translation, TyrRS and TrpRS, have opposing activities on angiogenesis. (PMID:21442253)
• Tryptophanyl-tRNA synthetase down-regulation by hypoxia may be a factor responsible for low TrpRS in pancreatic tumors with high metastatic ability. (PMID:21926542)
• Indoleamine2,3-dioxygenase and tryptophanyl-tRNA synthetase may play critical roles in the immune pathogenesis of chronic kidney disease. (PMID:23651343)
• Genes within recently identified loci associated with waist-hip ratio (WHR) exhibit fat depot-specific mRNA expression, which correlates with obesity-related traits. Adipose tissue (AT) mRNA expression of 6 genes (TBX15/WARS2, STAB1, PIGC, ZNRF3, GRB14) (PMID:23670221)
• Tryptophanyl-tRNA synthetase expression is up-regulated in patients with rheumatoid arthritis. (PMID:24515434)
• Overexpression of WARS predicts no recurrence and good survival for triple-negative breast cancer patients. (PMID:26209610)
• Based on these results, secretion of full-length tryptophanyl-tRNA synthetase appears to work as a primary defence system against infection, acting before full activation of innate immunity. (PMID:27748732)
• findings establish WARS as a gene whose mutations may cause distal hereditary motor neuropathy and alter canonical and non-canonical functions of tryptophanyl-tRNA synthetase. (PMID:28369220)
• Inhibition of human tryptophanyl-tRNA synthetase (TrpRS) expression by TrpRS-specific siRNAs decreased and overexpression of TrpRS increased Trp uptake into the cells (PMID:29666190)
• Human tryptophanyl-tRNA synthetase is an IFN-gamma-inducible entry factor for Enterovirus. (PMID:30153112)
• Data report a novel noncanonical function of WARS in antiviral defense. WARS is rapidly secreted in response to viral infection and primes the innate immune response by inducing the secretion of proinflammatory cytokines and type I IFNs, resulting in the inhibition of virus replication both in vitro and in vivo. These results suggest that WARS is a member of the antiviral innate immune response. (PMID:30355684)
• Expression of Indoleamine 2, 3-dioxygenase 1 (IDO1) and Tryptophanyl-tRNA Synthetase (WARS) in Gastric Cancer Molecular Subtypes. (PMID:31033497)
• Mini tryptophanyl-tRNA synthetase is required for a synthetic phenotype in vascular smooth muscle cells induced by IFN-gamma-mediated beta2-adrenoceptor signaling. (PMID:31786502)
• Tryptophanyl-tRNA Synthetase 1 Signals Activate TREM-1 via TLR2 and TLR4. (PMID:32899943)
• Identification of Prognostic RBPs in Osteosarcoma. (PMID:33754909)
• WARS1 and SARS1: Two tRNA synthetases implicated in autosomal recessive microcephaly. (PMID:35790048)
• Biallelic variants in WARS1 cause a highly variable neurodevelopmental syndrome and implicate a critical exon for normal auditory function. (PMID:35815345)
• Exploring the role of tryptophanyl-tRNA synthetase and associations with inflammatory markers and clinical outcomes in COVID-19 patients: A case-control study. (PMID:37567323)
• Tryptophan-Starved Human Cells Overexpressing Tryptophanyl-tRNA Synthetase Enhance High-Affinity Tryptophan Uptake via Enzymatic Production of Tryptophanyl-AMP. (PMID:37895133)
• Highly secreted tryptophanyl tRNA synthetase 1 as a potential theranostic target for hypercytokinemic severe sepsis. (PMID:38177528)
• Tryptophanyl-Transfer RNA Synthetase Is Involved in a Negative Feedback Loop Mitigating Interferon-gamma-Induced Gene Expression. (PMID:38247871)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	wars1	ENSDARG00000100954
		ENSDARG00000104659
mus_musculus	Wars1	ENSMUSG00000021266
rattus_norvegicus	Wars1	ENSRNOG00000004359
drosophila_melanogaster	TrpRS	FBGN0010803
caenorhabditis_elegans		WBGENE00006945

Paralogs (1): WARS2 (ENSG00000116874)

Protein

Protein identifiers

Tryptophan–tRNA ligase, cytoplasmic — P23381 (reviewed: P23381)

Alternative names: Interferon-induced protein 53, Tryptophanyl-tRNA synthetase

All UniProt accessions (28): P23381, A0A024R6K8, G3V227, G3V277, G3V2C0, G3V2F2, G3V2Y7, G3V313, G3V339, G3V3H8, G3V3P2, G3V3R3, G3V3S7, G3V3X0, G3V3Y5, G3V423, G3V456, G3V4A3, G3V4C7, G3V4N0, G3V4N8, G3V4Q0, G3V4S4, G3V5H5, G3V5U1, G3V5W1, H0YJP3, P78534

UniProt curated annotations — full annotation on UniProt →

Function. Catalyzes the attachment of tryptophan to tRNA(Trp) in a two-step reaction: tryptophan is first activated by ATP to form Trp-AMP and then transferred to the acceptor end of the tRNA(Trp). Has no angiostatic activity. Possesses an angiostatic activity but has no aminoacylation activity. Inhibits fluid shear stress-activated responses of endothelial cells. Regulates ERK, Akt, and eNOS activation pathways that are associated with angiogenesis, cytoskeletal reorganization and shear stress-responsive gene expression. Has an angiostatic activity.

Subunit / interactions. Homodimer. Interacts with an oxidized form of GAPDH. GAPDH stimulates the aminoacylation activity of isoform 2.

Subcellular location. Cytoplasm.

Post-translational modifications. Proteolytic cleavage generates 2 forms; T1-TrpRS and T2-TrpRS.

Disease relevance. Neuronopathy, distal hereditary motor, autosomal dominant 9 (HMND9) [MIM:617721] A form of distal hereditary motor neuronopathy, a heterogeneous group of neuromuscular disorders caused by selective degeneration of motor neurons in the anterior horn of the spinal cord, without sensory deficit in the posterior horn. The overall clinical picture consists of a classical distal muscular atrophy syndrome in the legs without clinical sensory loss. The disease starts with weakness and wasting of distal muscles of the anterior tibial and peroneal compartments of the legs. Later on, weakness and atrophy may expand to the proximal muscles of the lower limbs and/or to the distal upper limbs. HMND9 is characterized by juvenile onset of slowly progressive distal muscle weakness and atrophy affecting both the lower and upper limbs. The disease may be caused by variants affecting the gene represented in this entry. Neurodevelopmental disorder with microcephaly and speech delay, with or without brain abnormalities (NEDMSBA) [MIM:620317] An autosomal recessive disorder apparent from early infancy and characterized by global developmental delay, delayed or absent walking, impaired intellectual development, poor or absent speech, and postnatal progressive microcephaly. Additional variable features include cortical visual impairment, seizures, hypotonia, spasticity, and sensorineural deafness. Brain anomalies including myelination defects, cortical atrophy, or thin corpus callosum are present in most patients. The disease may be caused by variants affecting the gene represented in this entry.

Induction. By IFNG/IFN-gamma.

Similarity. Belongs to the class-I aminoacyl-tRNA synthetase family.

Isoforms (2)

UniProt ID	Names	Canonical?
P23381-1	1	yes
P23381-2	2, mini TrpRS

RefSeq proteins (4): NP_004175, NP_776049, NP_998810, NP_998811 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000738	WHEP-TRS_dom	Domain
IPR001412	aa-tRNA-synth_I_CS	Conserved_site
IPR002305	aa-tRNA-synth_Ic	Family
IPR002306	Trp-tRNA-ligase	Family
IPR009068	uS15_NS1_RNA-bd_sf	Homologous_superfamily
IPR014729	Rossmann-like_a/b/a_fold	Homologous_superfamily

Pfam: PF00458, PF00579

Enzyme classification (BRENDA):

• EC 6.1.1.2 — tryptophan-tRNA ligase (BRENDA: 36 organisms, 113 substrates, 74 inhibitors, 112 Km, 92 kcat entries)

Substrate kinetics (BRENDA)

40 substrates with measured Km, best-characterized 15. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
TRNATRP	0.0001–0.0248	30
ATP	0.03–2	19
TRP	0.0004–0.128	12
L-TRYPTOPHAN	0.0007–0.027	10
P1,P3-BIS(5’-ADENOSYL)TRIPHOSPHATE	1	2
ARCHEOGLOBUS FULGIDUS TRNATRP(A73, WILD-TYPE)	0.0001	1
ARCHEOGLOBUS FULGIDUS TRNATRP(A73C)	0.0001	1
ARCHEOGLOBUS FULGIDUS TRNATRP(A73G)	0.0001	1
ARCHEOGLOBUS FULGIDUS TRNATRP(A73U)	0.0001	1
BACILLUS SUBTILIS TRNATRP(A73, WILD-TYPE)	0.0001	1
BACILLUS SUBTILIS TRNATRP(A73C)	0.0001	1
BACILLUS SUBTILIS TRNATRP(A73G)	0.0001	1
BACILLUS SUBTILIS TRNATRP(A73U)	0.0001	1
BOVINE TRNATRP(G73, WILD-TYPE)	0.0002	1
BOVINE TRNATRP(G73A)	0.0002	1

Catalyzed reactions (Rhea), 1 shown:

• tRNA(Trp) + L-tryptophan + ATP = L-tryptophyl-tRNA(Trp) + AMP + diphosphate + H(+) (RHEA:24080)

UniProt features (73 total): helix 27, strand 16, sequence variant 11, sequence conflict 4, turn 4, chain 3, short sequence motif 2, modified residue 2, initiator methionine 1, splice variant 1, domain 1, region of interest 1

Structure

Experimental structures (PDB)

13 structures.

PDB	Method	Resolution (Å)
1R6U	X-RAY DIFFRACTION	2
1R6T	X-RAY DIFFRACTION	2.1
5UJJ	X-RAY DIFFRACTION	2.1
1ULH	X-RAY DIFFRACTION	2.31
2QUH	X-RAY DIFFRACTION	2.4
2QUI	X-RAY DIFFRACTION	2.4
2QUJ	X-RAY DIFFRACTION	2.42
1O5T	X-RAY DIFFRACTION	2.5
5UJI	X-RAY DIFFRACTION	2.79
2AZX	X-RAY DIFFRACTION	2.8
2QUK	X-RAY DIFFRACTION	2.8
2DR2	X-RAY DIFFRACTION	3
2AKE	X-RAY DIFFRACTION	3.1

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P23381-F1	92.17	0.77

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (2): 154, 351

Function

Pathways and Gene Ontology

Reactome pathways

4 pathways

ID	Pathway
R-HSA-379716	Cytosolic tRNA aminoacylation
R-HSA-379724	tRNA Aminoacylation
R-HSA-392499	Metabolism of proteins
R-HSA-72766	Translation

MSigDB gene sets: 523 (showing top): RODRIGUES_THYROID_CARCINOMA_ANAPLASTIC_UP, GOBP_AMINO_ACID_ACTIVATION, MCLACHLAN_DENTAL_CARIES_UP, KAAB_FAILED_HEART_ATRIUM_DN, GOBP_TRNA_METABOLIC_PROCESS, CHIANG_LIVER_CANCER_SUBCLASS_UNANNOTATED_DN, HSIAO_HOUSEKEEPING_GENES, WIELAND_UP_BY_HBV_INFECTION, GOBP_TRANSLATION, TERAMOTO_OPN_TARGETS_CLUSTER_7, MARTINEZ_RB1_TARGETS_UP, ONKEN_UVEAL_MELANOMA_UP, TGIF_01, GOBP_BLOOD_VESSEL_MORPHOGENESIS, SCHLOSSER_SERUM_RESPONSE_DN

GO Biological Process (10): angiogenesis (GO:0001525), translation (GO:0006412), tryptophanyl-tRNA aminoacylation (GO:0006436), negative regulation of cell population proliferation (GO:0008285), intracellular signal transduction (GO:0035556), regulation of angiogenesis (GO:0045765), tRNA aminoacylation for protein translation (GO:0006418), negative regulation of protein kinase activity (GO:0006469), positive regulation of gene expression (GO:0010628), positive regulation of protein-containing complex assembly (GO:0031334)

GO Molecular Function (11): tryptophan-tRNA ligase activity (GO:0004830), ATP binding (GO:0005524), protein kinase binding (GO:0019901), protein domain specific binding (GO:0019904), protein-macromolecule adaptor activity (GO:0030674), protein homodimerization activity (GO:0042803), nucleotide binding (GO:0000166), aminoacyl-tRNA ligase activity (GO:0004812), protein binding (GO:0005515), ligase activity (GO:0016874), kinase inhibitor activity (GO:0019210)

GO Cellular Component (5): nucleus (GO:0005634), cytoplasm (GO:0005737), cytosol (GO:0005829), protein-containing complex (GO:0032991), extracellular exosome (GO:0070062)

Reactome top-level categories

Rollup of top-3 pathways:

Category	Pathways
tRNA Aminoacylation	1
Translation	1
Metabolism of proteins	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
intracellular anatomical structure	2
protein binding	2
cellular anatomical structure	2
blood vessel morphogenesis	1
anatomical structure formation involved in morphogenesis	1
peptidyltransferase activity	1
translational initiation	1
translational elongation	1
translational termination	1
macromolecule biosynthetic process	1
protein metabolic process	1
protein biosynthetic process	1
tRNA aminoacylation for protein translation	1
cell population proliferation	1
regulation of cell population proliferation	1
negative regulation of cellular process	1
signal transduction	1
angiogenesis	1
regulation of anatomical structure morphogenesis	1
regulation of vasculature development	1
translation	1
tRNA aminoacylation	1
negative regulation of protein phosphorylation	1
protein kinase activity	1
negative regulation of kinase activity	1
regulation of protein kinase activity	1
gene expression	1
regulation of gene expression	1
positive regulation of macromolecule biosynthetic process	1
regulation of protein-containing complex assembly	1
positive regulation of cellular component biogenesis	1
positive regulation of cellular component organization	1
protein-containing complex assembly	1
aminoacyl-tRNA ligase activity	1
adenyl ribonucleotide binding	1
purine ribonucleoside triphosphate binding	1
kinase binding	1
molecular adaptor activity	1
identical protein binding	1
protein dimerization activity	1

Protein interactions and networks

STRING

2282 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
WARS1	YARS1	P54577	991
WARS1	WARS2	Q9UGM6	923
WARS1	YARS2	Q9Y2Z4	914
WARS1	NDUFB3	O43676	893
WARS1	MARS1	P56192	878
WARS1	MARS2	Q96GW9	877
WARS1	QARS1	P47897	869
WARS1	VARS1	P26640	869
WARS1	PARS2	Q7L3T8	868
WARS1	AARS1	P49588	857
WARS1	VARS2	Q5ST30	857
WARS1	AARS2	Q5JTZ9	815
WARS1	HARS1	P12081	810
WARS1	IARS2	Q9NSE4	810
WARS1	KARS1	Q15046	808

IntAct

47 interactions, top by confidence:

A	B	Type	Score
CFTR	ESYT2	psi-mi:“MI:2364”(proximity)	0.710
CFTR	ESYT2	psi-mi:“MI:0914”(association)	0.710
CDH5	WARS1	psi-mi:“MI:0915”(physical association)	0.650
CDH5	WARS1	psi-mi:“MI:0407”(direct interaction)	0.650
TERF1	WARS1	psi-mi:“MI:0915”(physical association)	0.510
WARS1	WARS1	psi-mi:“MI:0407”(direct interaction)	0.440
WARS1	CDH5	psi-mi:“MI:0915”(physical association)	0.400
WARS1	DNMT3B	psi-mi:“MI:0915”(physical association)	0.370
DCAF13	WARS1	psi-mi:“MI:0915”(physical association)	0.370
JUN		psi-mi:“MI:0914”(association)	0.350
JUN	TPM3	psi-mi:“MI:0914”(association)	0.350
NS1	SAC3D1	psi-mi:“MI:0914”(association)	0.350
PRNP	CARNS1	psi-mi:“MI:0914”(association)	0.350
LRRK2		psi-mi:“MI:0914”(association)	0.350
ENG	IGKV2-28	psi-mi:“MI:0914”(association)	0.350
PTPN12	PRPSAP2	psi-mi:“MI:0914”(association)	0.350
NME1-NME2	SART1	psi-mi:“MI:0914”(association)	0.350
MTA2	HSP90AA1	psi-mi:“MI:0914”(association)	0.350
ZDHHC5	IGKV2D-24	psi-mi:“MI:0914”(association)	0.350
NEK7	SUPT5H	psi-mi:“MI:0914”(association)	0.350
DDA1	PGK1	psi-mi:“MI:0914”(association)	0.350
MAPT	SHTN1	psi-mi:“MI:0914”(association)	0.350
GAB2	UBA6	psi-mi:“MI:0914”(association)	0.350
ITM2C	UBA6	psi-mi:“MI:0914”(association)	0.350

BioGRID (214): WARS (Affinity Capture-MS), CCT3 (Co-fractionation), CTSD (Co-fractionation), HSD17B12 (Co-fractionation), KPNA2 (Co-fractionation), MVB12A (Co-fractionation), PFAS (Co-fractionation), PSMG1 (Co-fractionation), RABIF (Co-fractionation), TATDN1 (Co-fractionation), WARS (Co-fractionation), WARS (Co-fractionation), WARS (Co-fractionation), WARS (Co-fractionation), WARS (Co-fractionation)

ESM2 similar proteins: A2XKU9, A4IHJ3, A7RHL5, A8E657, A9NK39, A9RBS1, B4YYA9, B5X8A5, F4JWP9, O16140, O42130, O42131, O46374, O80585, P11388, P11708, P14152, P15348, P23381, P41515, P41516, Q01320, Q02880, Q1JQD4, Q3T145, Q3ZBN0, Q498C5, Q498D9, Q558Y7, Q5R4J1, Q5ZME2, Q64399, Q64511, Q6AVK1, Q6DIY9, Q6PAB3, Q6TGV7, Q6V289, Q75HE6, Q7YRU4

Diamond homologs: A2BLD4, A3MX72, A4WL99, A6URQ1, B6YUH1, C6A032, O26352, O28579, O59584, O67115, P17248, P23381, P23612, P32921, Q09692, Q46BQ5, Q4JBG7, Q55DZ8, Q58810, Q5JEP3, Q5R4J1, Q6AGQ7, Q6P7B0, Q6PBS3, Q83FN1, Q83HC3, Q8PVK0, Q8PWV5, Q8TSI1, Q8TUA1, Q8TYF7, Q8U453, Q8ZTU5, Q976M1, Q978Y8, Q97ZX0, Q9HIW5, Q9HN66, Q9HN83, Q9UY11

SIGNOR signaling

9 interactions.

A	Effect	B	Mechanism
QRICH1	“up-regulates quantity by expression”	WARS1	“transcriptional regulation”
ATF4	“up-regulates quantity by expression”	WARS1	“transcriptional regulation”
WARS1	“down-regulates quantity”	tRNA(Trp)	“chemical modification”
WARS1	“down-regulates quantity”	tryptophan	“chemical modification”
WARS1	“down-regulates quantity”	ATP(4-)	“chemical modification”
WARS1	“up-regulates quantity”	diphosphate(3-)	“chemical modification”
WARS1	“up-regulates quantity”	AMP	“chemical modification”
WARS1	“up-regulates quantity”	Trp-tRNA(Trp)	“chemical modification”
WARS1	“up-regulates quantity”	alpha-aminoacyl-tRNA	“chemical modification”

Disease & clinical

Clinical variants and AI predictions

ClinVar

146 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	3
Uncertain significance	78
Likely benign	21
Benign	15

Top pathogenic / likely-pathogenic (4)

Variant ID	HGVS	Classification
2499495	NM_004184.4(WARS1):c.1A>G (p.Met1Val)	Pathogenic
2499496	NM_004184.4(WARS1):c.1255G>A (p.Asp419Asn)	Likely pathogenic
3065742	NM_004184.4(WARS1):c.827G>A (p.Gly276Glu)	Likely pathogenic
4292215	NM_004184.4(WARS1):c.1222G>T (p.Glu408Ter)	Likely pathogenic

SpliceAI

1938 predictions. Top by Δscore:

Variant	Effect	Δscore
14:100335036:CCTG:C	acceptor_loss	1.0000
14:100335038:T:A	acceptor_loss	1.0000
14:100335042:C:CT	acceptor_gain	1.0000
14:100335042:C:T	acceptor_gain	1.0000
14:100337057:CTCA:C	donor_loss	1.0000
14:100337058:TCAC:T	donor_loss	1.0000
14:100337059:CACC:C	donor_loss	1.0000
14:100337060:A:T	donor_loss	1.0000
14:100337060:ACCTT:A	donor_gain	1.0000
14:100337061:C:A	donor_loss	1.0000
14:100337061:CCTT:C	donor_gain	1.0000
14:100337061:CCTTC:C	donor_gain	1.0000
14:100337064:T:A	donor_gain	1.0000
14:100337198:TTGAC:T	acceptor_gain	1.0000
14:100337199:TGAC:T	acceptor_gain	1.0000
14:100337201:ACC:A	acceptor_loss	1.0000
14:100337203:C:CA	acceptor_loss	1.0000
14:100337203:C:CC	acceptor_gain	1.0000
14:100337209:C:CT	acceptor_gain	1.0000
14:100337209:C:T	acceptor_gain	1.0000
14:100337210:A:T	acceptor_gain	1.0000
14:100342392:GCTCA:G	donor_loss	1.0000
14:100342393:CTCAC:C	donor_loss	1.0000
14:100342394:TCA:T	donor_loss	1.0000
14:100342395:CACC:C	donor_loss	1.0000
14:100342396:A:T	donor_loss	1.0000
14:100342397:C:CT	donor_loss	1.0000
14:100343313:T:TA	donor_gain	1.0000
14:100353682:CTTA:C	donor_loss	1.0000
14:100353683:TTA:T	donor_loss	1.0000

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000178470 (14:100355648 C>G), RS1000182914 (14:100363325 C>A), RS1000339950 (14:100336810 G>A), RS1000397546 (14:100342424 C>T), RS1000471700 (14:100372865 GCTGCCTGCCTGC>G,GCTGC,GCTGCCTGC,GCTGCCTGCCTGCCTGC,GCTGCCTGCCTGCCTGCCTGC,GCTGCCTGCCTGCCTGCCTGCCTGC), RS1000553719 (14:100359779 G>A), RS1000690800 (14:100345887 C>A), RS1000713094 (14:100348173 C>T), RS1000722213 (14:100340859 G>T), RS1000754108 (14:100352961 C>T), RS1000781527 (14:100367129 C>T), RS1000785922 (14:100349526 G>A,T), RS1000847612 (14:100366042 C>T), RS1000929448 (14:100346025 G>A), RS1000935488 (14:100360352 A>C)

Disease associations

OMIM: gene MIM:191050 | disease phenotypes: MIM:617721, MIM:181500, MIM:620317

GenCC curated gene-disease

Disease	Classification	Inheritance
distal hereditary motor neuropathy	Definitive	Autosomal dominant
neuronopathy, distal hereditary motor, type 9	Strong	Autosomal dominant
neurodevelopmental disorder with microcephaly and speech delay, with or without brain abnormalities	Strong	Autosomal recessive

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
distal hereditary motor neuropathy	Limited	AD

Mondo (4): neuronopathy, distal hereditary motor, type 9 (MONDO:0060585), schizophrenia (MONDO:0005090), neurodevelopmental disorder with microcephaly and speech delay, with or without brain abnormalities (MONDO:0957218), distal hereditary motor neuropathy (MONDO:0018894)

Orphanet (1): NON RARE IN EUROPE: Schizophrenia (Orphanet:3140)

HPO phenotypes

55 total (30 of 55 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000007	Autosomal recessive inheritance
HP:0000076	Vesicoureteral reflux
HP:0000122	Unilateral renal agenesis
HP:0000219	Thin upper lip vermilion
HP:0000252	Microcephaly
HP:0000340	Sloping forehead
HP:0000426	Prominent nasal bridge
HP:0000448	Prominent nose
HP:0000582	Upslanted palpebral fissure
HP:0000637	Long palpebral fissure
HP:0000664	Synophrys
HP:0000729	Autistic behavior
HP:0000750	Delayed speech and language development
HP:0001249	Intellectual disability
HP:0001250	Seizure
HP:0001251	Ataxia
HP:0001252	Hypotonia
HP:0001257	Spasticity
HP:0001263	Global developmental delay
HP:0001265	Hyporeflexia
HP:0001274	Agenesis of corpus callosum
HP:0001288	Gait disturbance
HP:0001302	Pachygyria
HP:0001344	Absent speech
HP:0001347	Hyperreflexia
HP:0001510	Growth delay
HP:0001761	Pes cavus
HP:0002069	Bilateral tonic-clonic seizure
HP:0002119	Ventriculomegaly

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST006585_1310	Blood protein levels	7.000000e-18

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL6066299 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

ChEMBL bioactivities

2 potent at pChembl≥5 of 4 total, top 2 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
7.79	Kd	16.29	nM	CHEMBL3752910
7.79	ED50	16.29	nM	CHEMBL3752910

PubChem BioAssay actives

1 with measured affinity, of 4 total; 1 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
4-methyl-3-[(1-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2149773: Binding affinity to human WARS incubated for 45 mins by Kinobead based pull down assay	kd	0.0163	uM

CTD chemical–gene interactions

125 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Cyclosporine	increases expression	7
sodium arsenite	decreases expression, increases abundance, increases expression	6
Valproic Acid	increases expression, affects expression, affects cotreatment	6
bisphenol A	decreases expression, increases expression, affects expression	5
Tunicamycin	increases expression	5
Cadmium Chloride	affects localization, decreases expression, increases expression	4
Estradiol	increases expression	3
Tretinoin	increases expression	3
Genistein	increases expression	3
perfluorooctane sulfonic acid	increases expression	2
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression, increases expression	2
Resveratrol	increases expression	2
Aspirin	decreases expression	2
Nickel	increases expression	2
Phenylmercuric Acetate	affects cotreatment, increases expression	2
T-2 Toxin	decreases expression	2
Tobacco Smoke Pollution	affects expression, increases expression	2
Thapsigargin	increases expression	2
Particulate Matter	affects cotreatment, increases abundance, increases expression	2
aristolochic acid I	increases expression	1
FR900359	increases phosphorylation	1
bisphenol F	increases expression	1
tremortin	increases expression	1
chloroacetaldehyde	affects expression	1
methylmercuric chloride	increases expression	1
triphenyl phosphate	affects expression	1
deoxynivalenol	decreases expression	1
pyrogallol 1,3-dimethyl ether	decreases expression, affects localization, increases expression, affects cotreatment	1
beta-lapachone	increases expression	1
arsenite	affects expression	1

ChEMBL screening assays

1 unique, capped per target: 1 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL5652815	Binding	Binding affinity to human WARS incubated for 45 mins by Kinobead based pull down assay	NVP-BHG712: Effects of Regioisomers on the Affinity and Selectivity toward the EPHrin Family. — ChemMedChem

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00000374	PHASE4	COMPLETED	Treatment for First-Episode Schizophrenia
NCT00001656	PHASE4	COMPLETED	Comparison of Clozapine vs Olanzapine in Childhood-Onset Psychotic Disorders
NCT00007774	PHASE4	COMPLETED	To Determine if Olanzapine is More Cost Effective Than Haloperidol for the Treatment of Schizophrenia
NCT00014001	PHASE4	COMPLETED	CATIE- Schizophrenia Trial
NCT00018668	PHASE4	COMPLETED	Antipsychotic Response in Schizophrenia
NCT00034801	PHASE4	COMPLETED	Olanzapine Versus Active Comparator in the Treatment of Depression in Patients With Schizophrenia
NCT00034905	PHASE4	COMPLETED	A Comparison of Seroquel vs. Risperidone in Schizophrenia
NCT00036088	PHASE4	COMPLETED	Olanzapine Versus An Active Comparator in the Treatment of Schizophrenia
NCT00044187	PHASE4	COMPLETED	The Assessment of a Weight-Gain Agent for the Treatment of Olanzapine-Associated Anti-Obesity Agent in Patients With Schizophrenia, Schizophreniform Disorder, Schizoaffective Disorder, and Bipolar I Disorder
NCT00044655	PHASE4	COMPLETED	Switching Medication to Treat Schizophrenia
NCT00048828	PHASE4	COMPLETED	Treating Drug-Resistant Childhood Schizophrenia
NCT00053703	PHASE4	COMPLETED	Treatment of Early Onset Schizophrenia Spectrum Disorders (TEOSS)
NCT00056498	PHASE4	COMPLETED	Risperidone Treatment in Schizophrenia Patients Who Are Currently Taking Clozapine
NCT00061802	PHASE4	COMPLETED	Efficacy and Safety of Two Atypical Antipsychotics vs. Placebo in Patients With an Acute Exacerbation of Either Schizophrenia or Schizoaffective Disorder
NCT00080327	PHASE4	COMPLETED	Study of Three Doses of Aripiprazole in Patients With Acute Schizophrenia
NCT00088049	PHASE4	COMPLETED	Study of Olanzapine vs. Aripiprazole in the Treatment of Schizophrenia
NCT00090012	PHASE4	COMPLETED	Comparison of Continuing Olanzapine to Switching to Quetiapine in Overweight or Obese Patients With Schizophrenia and Schizoaffective Disorder
NCT00100776	PHASE4	COMPLETED	Efficacy of High Dose Olanzapine for the Treatment of Schizophrenia and Schizoaffective Disorder
NCT00103571	PHASE4	COMPLETED	Olanzapine Versus Aripiprazole in the Treatment of Acutely Ill Patients With Schizophrenia
NCT00108368	PHASE4	COMPLETED	The Effects of Risperidone and Olanzapine on Thinking
NCT00114595	PHASE4	COMPLETED	Ethyl-Eicosapentaenoic Acid and Tardive Dyskinesia
NCT00130923	PHASE4	COMPLETED	Risperidone Long-acting Versus Oral Risperidone in Patients With Schizophrenia and Alcohol Use Disorder
NCT00137020	PHASE4	COMPLETED	Clinical Effect Of Cross Titration Of Antipsychotics With Ziprasidone In Schizophrenia Or Schizoaffective Disorder
NCT00140166	PHASE4	COMPLETED	Treatment of Acute Schizophrenia With Vitamin Therapy
NCT00145847	PHASE4	COMPLETED	Naltrexone Treatment of Alcohol Abuse in Schizophrenia
NCT00148564	PHASE4	COMPLETED	Energy Homeostasis Under Treatment With Atypical Antipsychotics
NCT00156715	PHASE4	COMPLETED	Efficacy of Quetiapine in the Treatment of Patients With Schizophrenia and a Comorbid Substance Use Disorder
NCT00158223	PHASE4	COMPLETED	Effectiveness of Pimozide in Augmenting the Effects of Clozapine in the Treatment of Schizophrenia
NCT00159081	PHASE4	COMPLETED	One Year Drug Treatment in First-Episode Schizophrenia
NCT00159120	PHASE4	COMPLETED	Maintenance Treatment vs. Stepwise Drug Discontinuation in First-Episode Schizophrenia
NCT00159133	PHASE4	COMPLETED	Prodrome-Based Early Intervention With Antipsychotics vs. Benzodiazepines in First-Episode Schizophrenia
NCT00159757	PHASE4	TERMINATED	12 Week Open, Non-Comparative Switch Study Of Oral Ziprazidone In Previously Treated Schizophrenic Patients
NCT00167817	PHASE4	COMPLETED	Effect of Switch to Aripiprazole on Health and Smoking Parameters in Patients With Schizophrenia: A Pilot Study
NCT00169026	PHASE4	TERMINATED	Alcoholism and Schizophrenia: Effects of Clozapine
NCT00169039	PHASE4	TERMINATED	Clozapine Versus Chlorpromazine for Treatment-Unresponsive Schizophrenia
NCT00169065	PHASE4	COMPLETED	Effectiveness of Clozapine Versus Olanzapine for Treatment-resistant Schizophrenia
NCT00169091	PHASE4	TERMINATED	Clozapine Versus Haloperidol for Treating the First Episode of Schizophrenia
NCT00176423	PHASE4	COMPLETED	Efficacy Study of Galantamine for Cognitive Impairments in Schizophrenia
NCT00176436	PHASE4	COMPLETED	Atomoxetine for Treatment of Weight Gain in Olanzapine or Clozapine Patients
NCT00177008	PHASE4	COMPLETED	Aripiprazole for the Treatment of Schizophrenia With Co-Morbid Social Anxiety