WASL

Summary

WASL (WASP like actin nucleation promoting factor, HGNC:12735) is a protein-coding gene on chromosome 7q31.32, encoding Actin nucleation-promoting factor WASL (O00401). Regulates actin polymerization by stimulating the actin-nucleating activity of the Arp2/3 complex.

This gene encodes a member of the Wiskott-Aldrich syndrome (WAS) protein family. Wiskott-Aldrich syndrome proteins share similar domain structure, and associate with a variety of signaling molecules to alter the actin cytoskeleton. The encoded protein is highly expressed in neural tissues, and interacts with several proteins involved in cytoskeletal organization, including cell division control protein 42 (CDC42) and the actin-related protein-2/3 (ARP2/3) complex. The encoded protein may be involved in the formation of long actin microspikes, and in neurite extension.

Source: NCBI Gene 8976 — RefSeq curated summary.

At a glance

• Gene–disease (curated): Parkinson disease (Limited, GenCC)
• GWAS associations: 7
• Clinical variants (ClinVar): 69 total
• MANE Select transcript: NM_003941

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:12735
Approved symbol	WASL
Name	WASP like actin nucleation promoting factor
Location	7q31.32
Locus type	gene with protein product
Status	Approved
Aliases	N-WASP, NWASP, WASPB
Ensembl gene	ENSG00000106299
Ensembl biotype	protein_coding
OMIM	605056
Entrez	8976

Gene structure

Transcript identifiers

Ensembl transcripts: 3 — 3 protein_coding

ENST00000223023, ENST00000924343, ENST00000924344

RefSeq mRNA: 1 — MANE Select: NM_003941 NM_003941

CCDS: CCDS34743

Canonical transcript exons

ENST00000223023 — 11 exons

Exon	Start	End
ENSE00000882047	123748618	123749003
ENSE00001188527	123681943	123684580
ENSE00002432099	123695823	123695865
ENSE00002451202	123696579	123696747
ENSE00002488176	123706277	123706373
ENSE00002488854	123692347	123692867
ENSE00002491899	123694715	123694868
ENSE00002513419	123704634	123704657
ENSE00002514348	123706740	123706826
ENSE00002529311	123689042	123689150
ENSE00003292004	123709089	123709223

Expression profiles

Bgee: expression breadth ubiquitous, 290 present calls, max score 97.44.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 17.8980 / max 215.3042, expressed in 1809 samples.

FANTOM5 promoters (3 alternative TSS)

Promoter ID	TPM avg	Samples expressed
85986	16.7816	1806
85985	0.9568	540
85984	0.1596	49

Top tissues by expression

299 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
middle temporal gyrus	UBERON:0002771	97.44	gold quality
lateral nuclear group of thalamus	UBERON:0002736	97.19	gold quality
jejunal mucosa	UBERON:0000399	96.77	gold quality
Brodmann (1909) area 23	UBERON:0013554	96.39	gold quality
upper leg skin	UBERON:0004262	96.22	gold quality
colonic mucosa	UBERON:0000317	95.52	gold quality
jejunum	UBERON:0002115	95.46	gold quality
mucosa of sigmoid colon	UBERON:0004993	95.40	gold quality
renal medulla	UBERON:0000362	95.24	gold quality
trigeminal ganglion	UBERON:0001675	95.23	gold quality
esophagus squamous epithelium	UBERON:0006920	95.08	gold quality
postcentral gyrus	UBERON:0002581	95.06	gold quality
pons	UBERON:0000988	95.05	gold quality
parietal lobe	UBERON:0001872	94.95	gold quality
dorsal root ganglion	UBERON:0000044	94.69	gold quality
urethra	UBERON:0000057	94.62	gold quality
entorhinal cortex	UBERON:0002728	94.55	gold quality
penis	UBERON:0000989	94.47	gold quality
mammalian vulva	UBERON:0000997	94.45	gold quality
nipple	UBERON:0002030	94.37	gold quality
duodenum	UBERON:0002114	94.36	gold quality
saphenous vein	UBERON:0007318	94.21	gold quality
visceral pleura	UBERON:0002401	94.20	gold quality
mammary duct	UBERON:0001765	94.15	gold quality
rectum	UBERON:0001052	94.04	gold quality
amniotic fluid	UBERON:0000173	94.03	gold quality
pigmented layer of retina	UBERON:0001782	94.01	gold quality
adult organism	UBERON:0007023	94.00	gold quality
retina	UBERON:0000966	93.98	gold quality
skin of hip	UBERON:0001554	93.92	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-GEOD-84465	yes	26.78
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): EPB41L4B, HNRNPK

miRNA regulators (miRDB)

183 targeting WASL, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-4692	100.00	67.32	2066
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-4262	100.00	73.26	3931
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-196A-5P	100.00	68.16	684
HSA-MIR-196B-5P	100.00	68.16	681
HSA-MIR-3134	100.00	66.43	777
HSA-MIR-4282	99.99	75.36	6408
HSA-MIR-186-5P	99.99	70.83	3707
HSA-MIR-4514	99.99	67.10	1870
HSA-MIR-181A-5P	99.99	72.96	2995
HSA-MIR-181B-5P	99.99	72.97	2996
HSA-MIR-181C-5P	99.99	72.95	2996
HSA-MIR-181D-5P	99.99	73.04	2997
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-3662	99.99	73.82	5684
HSA-MIR-196A-1-3P	99.99	72.15	2772
HSA-MIR-548AW	99.99	72.57	3559
HSA-MIR-4500	99.99	72.72	2367
HSA-MIR-223-3P	99.99	70.14	1140
HSA-MIR-4775	99.98	75.00	6394
HSA-MIR-32-5P	99.98	75.21	1964
HSA-MIR-92A-3P	99.98	75.21	1960
HSA-MIR-92B-3P	99.98	75.25	1955
HSA-MIR-25-3P	99.98	74.60	1817
HSA-MIR-363-3P	99.98	74.72	1821

Literature-anchored findings (GeneRIF, showing 40)

• nuclear localization of N-WASP modulates Src kinase activity by regulating HSP90 expression (PMID:12871950)
• Expression of the WA fragment of N-WASP to block associated actin polymerization also inhibited C. parvum invasion. (PMID:15102814)
• Erk phosphorylation liberates the SH3 domain of cortactin from intramolecular interactions with proline-rich regions, causing it to synergize with WASP and N-WASP in activating the Arp2/3 complex (PMID:15169891)
• The cooperative actions of two distinct Cdc42 effectors, the N-WASP-WIP complex and Toca-1, are required for Cdc42-induced actin assembly. (PMID:15260990)
• NF2 tumor suppressor Merlin and the ERM proteins interact with N-WASP and regulate its actin polymerization function (PMID:15699051)
• WASP and N-WASP are activated and phosphorylated by protein-tyrosine kinase and GTPase signals (PMID:16293614)
• Nef interferes with maturation of stimulatory T-lymphocyte contacts by modulation of N-Wasp activity (PMID:16687395)
• We demonstrate that the interaction of N-WASP with the PSF-NonO complex can couple N-WASP with RNA polymerase II to regulate transcription. (PMID:16767080)
• a vesicle trafficking regulator Toca-1 regulates different aspects of neuronal morphology from N-WASP (PMID:16885158)
• signal-induced relief of the autoinhibited fold of IQGAP1 allows activation of N-WASP to stimulate Arp2/3-dependent actin assembly (PMID:17085436)
• CR16 and N-WASP are suggested to play important roles in spermatogenesis (PMID:17573773)
• N-WASP, a member of the N-WASP family may act as a tumour progression suppressor in human breast cancer and may therefore have significant clinical value in this condition. (PMID:17985201)
• These data constitute evidence that Toca-1 is required for N-WASP-mediated actin polymerization by Shigella flexneri in vivo. (PMID:18191793)
• of N-WASP and, subsequently, the Arp2/3 complex appears to be an important molecular signal for regulating spines and synapses (PMID:18430734)
• Wiskostatin induced defective cytokinesis does not occur through the inhibition of the N-WASP pathway. (PMID:18667055)
• Compared with controls, neuronal Wiskott-Aldrich syndrome protein expression in brains of intractable epilepsy patients was significantly higher. (PMID:18708039)
• the Toca-1-N-WASP complex can link filopodial formation to endocytosis (PMID:19213734)
• the exchange rate of N-WASP controls the rate of ARP2/3-complex-dependent actin-based motility by regulating the extent of actin polymerization by antagonizing filament capping (PMID:19262673)
• CFL1 and N-WASP may play an important role in the tumorigenesis of ESCC, and to be the candidate novel biomarkers for the diagnosis and prognosis of esophageal squamous cell carcinoma. (PMID:20095995)
• Arg promotes actin-based protrusions in response to extracellular stimuli through phosphorylation of and physical interactions with N-WASp. (PMID:20146487)
• Cdc42 regulates the activity of IRSp53 by regulating the IRSp53-WIRE interaction as well as localization of the complex to plasma membrane to generate filopodia. (PMID:20678498)
• Cdc42 may influence endocytic membrane trafficking by regulating the formation and activity of the Toca-1/N-WASP complex. (PMID:20730103)
• Recruitment of FAK and N-WASP is necessary for cell migration and invasion induced by 17beta-estradiol in breast cancer cells. (PMID:20880986)
• N-WASP plays a role in efficient assembly of kinetochores and attachment of microtubules to chromosomes, which is essential for accurate chromosome congression and segregation (PMID:21533546)
• Perturbation of N-WASP-CK2 complex function showed that N-WASP controls the presence of F-actin at clathrin-coated structures. N-WASP-CK2 complex integrates in a single circuit different activities contributing to CME. (PMID:21610097)
• N-WASP assists in the recruitment and localization of Tuba to the cell junction. (PMID:21677511)
• results indicate that by mediating intensive F-actin accumulation at the sites of cell infiltration, WAVE2, N-WASP, and Mena are crucial for PI3K-dependent cell invasion induced by PDGF (PMID:21769917)
• N-WASP-WIRE serves as an integrator that couples actin nucleation with the subsequent steps of filament stabilization and organization necessary for zonula adherens integrity. (PMID:21785420)
• Study portrays a role for Claudin-5 in cell motility involving the N-WASP signalling cascade indicating a possible role for Claudin-5 in the metastasis of human breast cancer. (PMID:22559840)
• study describes that both N-WASp and WASp participate in the inhibition of NK-cell chemotaxis in response to NKG2D WASp engagement, and that this effect is not dependent on the regulation of F-actin dynamics (PMID:22585739)
• Neural Wiskott-Aldrich syndrome protein (N-WASP)-mediated p120-catenin interaction with Arp2-Actin complex stabilizes endothelial adherens junctions. (PMID:23212915)
• N-WASP has a crucial proinvasive role in driving Arp2/3 complex-mediated actin assembly in cooperation with FAK at invasive cell edges, but WRC depletion can promote 3D cell motility. (PMID:23273897)
• NWASP activation by mycolactone underpins Buruli ulcer formation via modulation of the actin cytoskeleton. (PMID:23549080)
• endocytosis by endothelial cells may represent a means of traversal of the blood vessel wall by yeast during disseminated candidiasis, and N-WASP may play a key role in the process. (PMID:23690407)
• A gain-of-function approach for miR-142-3p revealed a down-regulation of N-Wasp expression accompanied by a decrease of mycobacteria intake, while a loss-of-function approach yielded the reciprocal increase of the phagocytosis process. (PMID:23760605)
• c-Src and NWASP play key roles in mediating the molecular pathogenesis of low oxygen-induced accelerated brain invasion by gliomas. (PMID:24069415)
• Our observations suggest that ITSN1 is an important general regulator of Cdc42-, Nck- and N-WASP-dependent actin polymerisation (PMID:24284073)
• PC1 modulates actin cytoskeleton rearrangements and directional cell migration through the Pacsin 2/N-Wasp complex. (PMID:24385601)
• These results support a role for N-WASP in amphiphysin-2-dependent nuclear positioning and triad organization and in centronuclear myopathy and myotonic dystrophy pathophysiology. (PMID:25262827)
• Tir-Intimin interaction recruits the Nck adaptor to a Tir tyrosine phosphorylated residue where it activates neural Wiskott-Aldrich syndrome protein (N-WASP). (PMID:25482634)

Cross-species orthologs

7 orthologs

Organism	Symbol	Gene ID
danio_rerio	waslb	ENSDARG00000006283
danio_rerio	wasla	ENSDARG00000014113
mus_musculus	Wasl	ENSMUSG00000029684
rattus_norvegicus	Wasl	ENSRNOG00000006975
caenorhabditis_elegans		WBGENE00007840
caenorhabditis_elegans		WBGENE00015100
caenorhabditis_elegans		WBGENE00015107

Paralogs (1): WAS (ENSG00000015285)

Protein

Protein identifiers

Actin nucleation-promoting factor WASL — O00401 (reviewed: O00401)

Alternative names: Neural Wiskott-Aldrich syndrome protein

All UniProt accessions (1): O00401

UniProt curated annotations — full annotation on UniProt →

Function. Regulates actin polymerization by stimulating the actin-nucleating activity of the Arp2/3 complex. Involved in various processes, such as mitosis and cytokinesis, via its role in the regulation of actin polymerization. Together with CDC42, involved in the extension and maintenance of the formation of thin, actin-rich surface projections called filopodia. In addition to its role in the cytoplasm, also plays a role in the nucleus by regulating gene transcription, probably by promoting nuclear actin polymerization. Binds to HSF1/HSTF1 and forms a complex on heat shock promoter elements (HSE) that negatively regulates HSP90 expression. Plays a role in dendrite spine morphogenesis. Decreasing levels of DNMBP (using antisense RNA) alters apical junction morphology in cultured enterocytes, junctions curve instead of being nearly linear.

Subunit / interactions. Binds actin and the Arp2/3 complex. Interacts with CDC42. Interacts with FCHSD1. Interacts with FCHSD2. Binds to SH3 domains of GRB2. Interacts with the C-terminal SH3 domain of DNMBP. Interacts with SNX9. Interacts with the WW domains of PRPF40A/FBP11. Interacts with PTK2/FAK1. Interacts with PACSIN1, PACSIN2 and PACSIN3. Interacts with NOSTRIN. Binds to TNK2. Interacts with SNX33. Interacts with NONO (via second RRM domain); the interaction is direct. Component of a multiprotein complex with NONO and SFPQ; associates with the complex via direct interaction with NONO. (Microbial infection) Interacts with E.coli effector protein EspF(U). Identified in a complex containing at least WASL, BAIAP2L1 and E.coli EspF(U). (Microbial infection) Interacts with Shigella flexneri protein IcsA. The interaction with IcsA enhances the affinity of WASL for Arp2/3, thus assembling a tight complex which has maximal activity in actin assembly.

Subcellular location. Cytoplasm. Cytoskeleton. Nucleus.

Post-translational modifications. Phosphorylation at Ser-242, Tyr-256, Ser-484 and Ser-485 enhances actin polymerization activity.

RefSeq proteins (1): NP_003932* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000095	CRIB_dom	Domain
IPR000697	WH1/EVH1_dom	Domain
IPR003124	WH2_dom	Domain
IPR011026	WAS_C	Homologous_superfamily
IPR011993	PH-like_dom_sf	Homologous_superfamily
IPR033927	WASPfam_EVH1	Domain
IPR036936	CRIB_dom_sf	Homologous_superfamily

Pfam: PF00568, PF00786, PF02205

UniProt features (39 total): sequence conflict 9, helix 8, modified residue 6, compositionally biased region 4, domain 4, region of interest 4, turn 2, initiator methionine 1, chain 1

Structure

Experimental structures (PDB)

8 structures.

PDB	Method	Resolution (Å)
4CC2	X-RAY DIFFRACTION	1.55
4CC7	X-RAY DIFFRACTION	1.97
2FF3	X-RAY DIFFRACTION	2
9DLX	ELECTRON MICROSCOPY	2.91
2VCP	X-RAY DIFFRACTION	3.2
2LNH	SOLUTION NMR
9R3Y	SOLUTION NMR
9R4V	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O00401-F1	69.23	0.19

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (6): 2, 242, 256, 307, 484, 485

Function

Pathways and Gene Ontology

Reactome pathways

13 pathways

ID	Pathway
R-HSA-2029482	Regulation of actin dynamics for phagocytic cup formation
R-HSA-203641	NOSTRIN mediated eNOS trafficking
R-HSA-373753	Nephrin family interactions
R-HSA-3928662	EPHB-mediated forward signaling
R-HSA-418885	DCC mediated attractive signaling
R-HSA-5663213	RHO GTPases Activate WASPs and WAVEs
R-HSA-8856828	Clathrin-mediated endocytosis
R-HSA-9013148	CDC42 GTPase cycle
R-HSA-9013149	RAC1 GTPase cycle
R-HSA-9013406	RHOQ GTPase cycle
R-HSA-9013409	RHOJ GTPase cycle
R-HSA-9013424	RHOV GTPase cycle
R-HSA-9664422	FCGR3A-mediated phagocytosis

MSigDB gene sets: 323 (showing top): GOBP_DENDRITE_DEVELOPMENT, MYAATNNNNNNNGGC_UNKNOWN, REACTOME_INNATE_IMMUNE_SYSTEM, GOBP_POSITIVE_REGULATION_OF_ENDOCYTOSIS, GOBP_VESICLE_LOCALIZATION, BROWNE_HCMV_INFECTION_8HR_UP, GOBP_VESICLE_ORGANIZATION, ENK_UV_RESPONSE_KERATINOCYTE_UP, PID_NETRIN_PATHWAY, GOBP_SPINDLE_LOCALIZATION, GOBP_DENDRITIC_SPINE_DEVELOPMENT, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, GOBP_PLASMA_MEMBRANE_ORGANIZATION, GAUSSMANN_MLL_AF4_FUSION_TARGETS_A_UP, GOBP_NEUROGENESIS

GO Biological Process (21): vesicle budding from membrane (GO:0006900), actin polymerization or depolymerization (GO:0008154), response to bacterium (GO:0009617), vesicle organization (GO:0016050), actin cytoskeleton organization (GO:0030036), actin filament polymerization (GO:0030041), vesicle transport along actin filament (GO:0030050), protein-containing complex localization (GO:0031503), regulation of protein localization (GO:0032880), positive regulation of transcription by RNA polymerase II (GO:0045944), cell division (GO:0051301), positive regulation of filopodium assembly (GO:0051491), spindle localization (GO:0051653), dendritic spine morphogenesis (GO:0060997), protein-containing complex assembly (GO:0065003), regulation of postsynapse organization (GO:0099175), negative regulation of membrane tubulation (GO:1903526), positive regulation of clathrin-dependent endocytosis (GO:2000370), negative regulation of lymphocyte migration (GO:2000402), actin filament organization (GO:0007015), regulation of Rho protein signal transduction (GO:0035023)

GO Molecular Function (4): actin binding (GO:0003779), GTPase regulator activity (GO:0030695), protein binding (GO:0005515), small GTPase binding (GO:0031267)

GO Cellular Component (13): nucleus (GO:0005634), endoplasmic reticulum membrane (GO:0005789), cytosol (GO:0005829), plasma membrane (GO:0005886), actin cytoskeleton (GO:0015629), lamellipodium (GO:0030027), actin cap (GO:0030478), endocytic vesicle membrane (GO:0030666), cytoplasmic vesicle (GO:0031410), extracellular exosome (GO:0070062), glutamatergic synapse (GO:0098978), cytoplasm (GO:0005737), cytoskeleton (GO:0005856)

Reactome top-level categories

Rollup of top-9 pathways:

Category	Pathways
RHO GTPase cycle	5
Fcgamma receptor (FCGR) dependent phagocytosis	1
Metabolism of nitric oxide: NOS3 activation and regulation	1
Cell-Cell communication	1
EPH-Ephrin signaling	1
Netrin-1 signaling	1
RHO GTPase Effectors	1
Membrane Trafficking	1
Leishmania phagocytosis	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	3
cytoplasm	2
vesicle organization	1
vesicle-mediated transport	1
membrane organization	1
actin filament organization	1
response to other organism	1
organelle organization	1
cytoskeleton organization	1
actin filament-based process	1
actin polymerization or depolymerization	1
protein polymerization	1
actin filament-based movement	1
actin filament-based transport	1
vesicle cytoskeletal trafficking	1
macromolecule localization	1
intracellular protein localization	1
regulation of localization	1
regulation of transcription by RNA polymerase II	1
transcription by RNA polymerase II	1
positive regulation of DNA-templated transcription	1
cellular process	1
filopodium assembly	1
regulation of filopodium assembly	1
positive regulation of plasma membrane bounded cell projection assembly	1
cell cycle process	1
organelle localization	1
neuron projection development	1
neuron projection morphogenesis	1
dendrite morphogenesis	1
dendritic spine development	1
dendritic spine organization	1
cellular component assembly	1
protein-containing complex organization	1
regulation of synapse organization	1
postsynapse organization	1
negative regulation of cellular component organization	1
plasma membrane tubulation	1
regulation of membrane tubulation	1
positive regulation of receptor-mediated endocytosis	1

Protein interactions and networks

STRING

2338 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
WASL	WIPF1	O43516	999
WASL	CDC42	P21181	999
WASL	NCK1	P16333	998
WASL	HCLS1	P14317	997
WASL	CFL1	P23528	997
WASL	CTTN	Q14247	997
WASL	CFL2	Q9Y281	997
WASL	GRB2	P29354	995
WASL	ACTR2	P61160	994
WASL	ITSN1	Q15811	993
WASL	SH3PXD2A	Q5TCZ1	992
WASL	FNBP1L	Q5T0N5	990
WASL	NPHS1	O60500	987
WASL	ITSN2	Q9NZM3	980
WASL	TRIP10	Q15642	956
WASL	SNX9	Q9Y5X1	956

IntAct

241 interactions, top by confidence:

A	B	Type	Score
WASL	GRB2	psi-mi:“MI:0915”(physical association)	0.940
GRB2	WASL	psi-mi:“MI:0915”(physical association)	0.940
WIPF1	WASL	psi-mi:“MI:0915”(physical association)	0.920
WASL	WIPF1	psi-mi:“MI:0915”(physical association)	0.920
NCK2	WASL	psi-mi:“MI:0915”(physical association)	0.870
WASL	NCK2	psi-mi:“MI:0915”(physical association)	0.870
WASL	WIPF2	psi-mi:“MI:0915”(physical association)	0.850
WIPF2	WASL	psi-mi:“MI:0914”(association)	0.850
WASL	RNF8	psi-mi:“MI:0915”(physical association)	0.830
WASL	NCK1	psi-mi:“MI:0915”(physical association)	0.740
WASL	WIPF3	psi-mi:“MI:0914”(association)	0.740
NCK1	WASL	psi-mi:“MI:0914”(association)	0.740
GRB2	WIPF3	psi-mi:“MI:0914”(association)	0.730

BioGRID (194): WASL (Two-hybrid), WASL (Two-hybrid), WASL (Two-hybrid), WASL (Two-hybrid), WASL (Two-hybrid), RNF8 (Two-hybrid), ARPC3 (Two-hybrid), RHOJ (Two-hybrid), WASL (Two-hybrid), WASL (Affinity Capture-MS), WASL (Reconstituted Complex), FNBP1L (Co-fractionation), TRIP10 (Co-fractionation), WASF1 (Co-fractionation), WASF2 (Co-fractionation)

ESM2 similar proteins: A1L5A6, A2VDN6, A4IGK4, O00401, O08816, O12940, O35226, O43395, O48726, O60784, O88746, P40855, P50503, P55036, Q15459, Q16186, Q2KIA6, Q3SZD1, Q4WTC0, Q58DA0, Q5R5F1, Q5R684, Q5R7U2, Q5XHH7, Q5ZLF0, Q60415, Q62698, Q68FJ8, Q6GN67, Q6NRL6, Q6NZ09, Q6P877, Q6PDL0, Q7ZXD6, Q84L30, Q84L31, Q84L33, Q8BUR9, Q8K4Z5, Q8R1Q8

Diamond homologs: O00401, O08816, O36027, P42768, P70315, Q12446, Q91YD9, Q95107

SIGNOR signaling

13 interactions.

A	Effect	B	Mechanism
NCK1	up-regulates	WASL	binding
PTPN2	down-regulates	WASL	dephosphorylation
NEB	up-regulates	WASL	binding
WASL	“up-regulates activity”	ARP2/3	binding
CDC42	“up-regulates activity”	WASL	binding
“phosphatidylinositol bisphosphate”	“up-regulates activity”	WASL	“chemical activation”
WIPF1	“up-regulates activity”	WASL	binding
PTK2	“up-regulates activity”	WASL	phosphorylation
SRC	“up-regulates activity”	WASL	phosphorylation
TNK2	“up-regulates activity”	WASL	phosphorylation
ABL1	unknown	WASL	phosphorylation
ABL1	“up-regulates activity”	WASL	phosphorylation

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 79 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
RHO GTPases Activate WASPs and WAVEs	14	79.3×	1e-21
Parasite infection	10	61.8×	3e-14
Leishmania phagocytosis	10	61.8×	3e-14
Fcgamma receptor (FCGR) dependent phagocytosis	10	49.7×	2e-13
FCGR3A-mediated phagocytosis	14	46.8×	3e-18
Regulation of actin dynamics for phagocytic cup formation	14	46.0×	3e-18
EPHB-mediated forward signaling	7	33.2×	4e-08
Leishmania infection	10	29.1×	5e-11

GO biological processes:

GO term	Partners	Fold	FDR
Arp2/3 complex-mediated actin nucleation	5	81.0×	9e-07
positive regulation of actin filament polymerization	9	45.8×	2e-10
axonogenesis	5	12.3×	2e-03
cytoskeleton organization	6	12.2×	5e-04
actin cytoskeleton organization	9	10.9×	2e-05
actin filament organization	6	10.9×	9e-04
endocytosis	7	10.2×	4e-04
ubiquitin-dependent protein catabolic process	6	6.8×	6e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

69 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	45
Likely benign	2
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1665 predictions. Top by Δscore:

Variant	Effect	Δscore
7:123684581:C:CC	acceptor_gain	1.0000
7:123689080:T:TA	donor_gain	1.0000
7:123694711:TTAC:T	donor_loss	1.0000
7:123694712:TACC:T	donor_loss	1.0000
7:123694713:ACC:A	donor_loss	1.0000
7:123694714:C:T	donor_loss	1.0000
7:123694864:TTCAG:T	acceptor_gain	1.0000
7:123694865:TCAG:T	acceptor_gain	1.0000
7:123694866:CAG:C	acceptor_gain	1.0000
7:123694866:CAGC:C	acceptor_gain	1.0000
7:123694867:AG:A	acceptor_gain	1.0000
7:123694868:GC:G	acceptor_loss	1.0000
7:123694869:C:CC	acceptor_gain	1.0000
7:123695817:A:AC	donor_gain	1.0000
7:123695818:C:CC	donor_gain	1.0000
7:123695819:TTA:T	donor_loss	1.0000
7:123695820:TA:T	donor_loss	1.0000
7:123695821:A:AC	donor_gain	1.0000
7:123695821:ACAT:A	donor_gain	1.0000
7:123695822:C:CC	donor_gain	1.0000
7:123695822:CA:C	donor_gain	1.0000
7:123695822:CAT:C	donor_gain	1.0000
7:123695822:CATC:C	donor_gain	1.0000
7:123695822:CATCA:C	donor_gain	1.0000
7:123695863:TGCC:T	acceptor_loss	1.0000
7:123695864:GCCT:G	acceptor_loss	1.0000
7:123695866:C:CC	acceptor_gain	1.0000
7:123695866:CTGA:C	acceptor_loss	1.0000
7:123695871:G:C	acceptor_gain	1.0000
7:123695871:G:GC	acceptor_gain	1.0000

AlphaMissense

3268 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
7:123684530:A:G	W503R	1.000
7:123684530:A:T	W503R	1.000
7:123689064:C:A	R478S	1.000
7:123689064:C:G	R478S	1.000
7:123689086:A:G	L471S	1.000
7:123692372:A:G	I441T	1.000
7:123692372:A:T	I441K	1.000
7:123692456:A:G	I413T	1.000
7:123694738:A:T	V268D	1.000
7:123694765:A:C	I259S	1.000
7:123694765:A:T	I259N	1.000
7:123694777:A:C	I255R	1.000
7:123694777:A:T	I255K	1.000
7:123694804:A:G	L246P	1.000
7:123694804:A:T	L246H	1.000
7:123694834:A:G	F236S	1.000
7:123694837:A:G	L235P	1.000
7:123694846:A:G	L232S	1.000
7:123695826:A:C	F223L	1.000
7:123695826:A:T	F223L	1.000
7:123695827:A:C	F223C	1.000
7:123695827:A:G	F223S	1.000
7:123695828:A:G	F223L	1.000
7:123695844:C:A	W217C	1.000
7:123695844:C:G	W217C	1.000
7:123695845:C:G	W217S	1.000
7:123695846:A:G	W217R	1.000
7:123695846:A:T	W217R	1.000
7:123695848:C:T	G216D	1.000
7:123695849:C:G	G216R	1.000

dbSNP variants (sampled 300 via entrez): RS1000001061 (7:123730913 T>G), RS1000044221 (7:123728002 T>C), RS1000116087 (7:123718996 G>A), RS1000176292 (7:123748862 G>A), RS1000198167 (7:123722159 A>G), RS1000204 (7:123695024 T>A,C,G), RS1000234654 (7:123686970 T>A,C), RS1000241832 (7:123739896 GTGTGTGTGTGTGTGTGTGTA>G), RS1000259418 (7:123713205 T>C), RS1000265451 (7:123719654 A>G), RS1000302083 (7:123688727 G>C), RS1000315974 (7:123719221 T>G), RS1000419287 (7:123722513 A>C,G), RS1000459897 (7:123737732 A>C), RS1000551414 (7:123682691 TATA>T)

Disease associations

OMIM: gene MIM:605056 | disease phenotypes:

GenCC curated gene-disease

Disease	Classification	Inheritance
Parkinson disease	Limited	Autosomal recessive

Mondo (1): Parkinson disease (MONDO:0005180)

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

7 associations (top):

Study	Trait	p-value
GCST001337_22	Platelet count	3.000000e-12
GCST004603_44	Platelet count	9.000000e-14
GCST004607_159	Plateletcrit	7.000000e-11
GCST90002385_148	High light scatter reticulocyte count	1.000000e-10
GCST90002386_459	High light scatter reticulocyte percentage of red cells	8.000000e-12
GCST90002405_488	Reticulocyte count	5.000000e-12
GCST90002406_256	Reticulocyte fraction of red cells	2.000000e-13

EFO canonical traits (3, from GWAS)

EFO ID	Trait name
EFO:0004309	platelet count
EFO:0007985	platelet crit
EFO:0007986	reticulocyte count

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D010300	Parkinson Disease	C10.228.140.079.862.500; C10.228.662.600.400; C10.574.928.750

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

56 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	increases expression, increases abundance	4
methylmercuric chloride	affects cotreatment, increases expression	3
bisphenol A	decreases expression, affects methylation	2
Tobacco Smoke Pollution	affects expression, increases expression	2
Valproic Acid	decreases methylation, affects expression	2
FR900359	decreases phosphorylation	1
2,4,6-tribromophenol	decreases expression	1
testosterone enanthate	affects expression	1
uranyl acetate	affects expression	1
sodium arsenate	increases expression	1
decabromobiphenyl ether	decreases expression	1
arsenite	decreases methylation	1
tetrabromobisphenol A	decreases expression	1
zinc chromate	increases abundance, increases expression	1
aflatoxin B2	increases methylation	1
2-amino-3,8-dimethylimidazo(4,5-f)quinoxaline	increases expression	1
di-n-butylphosphoric acid	affects expression	1
chromium hexavalent ion	increases abundance, increases expression	1
monomethylarsonous acid	increases expression	1
K 7174	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	increases expression, affects cotreatment	1
dimethylarsinous acid	decreases expression	1
erucylphospho-N,N,N-trimethylpropylammonium	increases expression	1
bisphenol B	increases expression	1
2,2’,4,4’-tetrabromodiphenyl ether	decreases expression	1
dorsomorphin	increases expression, affects cotreatment	1
pentabrominated diphenyl ether 100	decreases expression	1
hexabrominated diphenyl ether 153	decreases expression	1
jinfukang	decreases expression	1
bis-N,N-dimethylamino-2-(N-methylpyrrolyl)methyl cyclopentadienyl titanium (IV)	decreases expression	1

Cellosaurus cell lines

3 cell lines: 3 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_TX83	HAP1 WASL (-) 1	Cancer cell line	Male
CVCL_TX84	HAP1 WASL (-) 2	Cancer cell line	Male
CVCL_TX85	HAP1 WASL (-) 3	Cancer cell line	Male

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00030979	PHASE4	COMPLETED	Donepezil to Treat Dementia in Parkinson’s Disease
NCT00043849	PHASE4	COMPLETED	Treatment of Agitation/Psychosis in Dementia/Parkinsonism (TAP/DAP)
NCT00095810	PHASE4	COMPLETED	Aripiprazole in Patients With Psychosis Associated With Parkinson’s Disease
NCT00125567	PHASE4	COMPLETED	Stalevo in Early Wearing-Off Patients
NCT00143026	PHASE4	COMPLETED	Study to Compare the Effect of Treatment With Carbidopa/Levodopa/Entacapone on the Quality of Life of Patients With Parkinson’s Disease. This Study is Not Recruiting in the United States
NCT00144300	PHASE4	COMPLETED	Ophthalmologic Safety Study of Pramipexole Immediate Release (IR) Versus Ropinirole in Early Parkinson’s Disease (PD) Patients
NCT00153972	PHASE4	COMPLETED	Dopamine Turnover Rate as Surrogate Parameter for Diagnosis of Early Parkinson’s Disease
NCT00174239	PHASE4	TERMINATED	Study Of Cabaser and Sinemet CR For The Treatment Of Nighttime Symptoms Associated With Parkinson’s Disease.
NCT00215904	PHASE4	COMPLETED	D-serine Adjuvant Treatment for Parkinson’s Disease
NCT00247247	PHASE4	COMPLETED	Comtess® Versus Cabaseril® as Add-on to Levodopa in the Treatment of Parkinsonian Patients Suffering From Wearing- Off.
NCT00272688	PHASE4	COMPLETED	Continuous Delivery of Levodopa in Patients With Advanced Idiopathic Parkinsons Disease - Cost-benefit
NCT00297778	PHASE4	COMPLETED	Pramipexole Versus Placebo in Parkinson’s Disease (PD) Patients With Depressive Symptoms
NCT00304161	PHASE4	COMPLETED	Effectiveness of Antidepressant Treatment for Depression in People With Parkinson’s Disease
NCT00307450	PHASE4	COMPLETED	Efficacy and Safety of Levetiracetam Versus Placebo on Levodopa-induced Dyskinesias in Advanced Parkinson’s Disease
NCT00321854	PHASE4	COMPLETED	Study of (Mirapex) Pramipexole for the Early Treatment of Parkinsons Disease (PD)
NCT00354133	PHASE4	UNKNOWN	Controlled Trial With Deep Brain Stimulation in Patients With Early Parkinson’s Disease
NCT00373087	PHASE4	COMPLETED	COMT Polymorphism and Entacapone Efficacy
NCT00391898	PHASE4	COMPLETED	Efficacy of Levodopa/Carbidopa/Entacapone vs Levodopa/Carbidopa in Parkinson’s Disease Patients With Early Wearing-off
NCT00399477	PHASE4	COMPLETED	A Non-Blinded Study Demonstrating the Effectiveness and Safety of Azilect Alone or in Combination Therapy in Parkinson’s Disease
NCT00402233	PHASE4	COMPLETED	A Randomized, Double-blind, Active (Pramipexole 0.5 mg Tid) and Placebo Controlled, Study of Pramipexole Given 0.5 mg and 0.75 mg Bid Over 12-week Treatment in Early Parkinson’s Disease (PD) Patients
NCT00437125	PHASE4	COMPLETED	Study on the Tolerability of Duloxetine in Depressed Patients With Parkinson’s Disease
NCT00443872	PHASE4	COMPLETED	Efficacy of Orally Disintegrating Selegiline in Parkinson’s Patients Experiencing Adverse Effects With Dopamine Agonists
NCT00455143	PHASE4	TERMINATED	Cognitive Protection - Dexmedetomidine and Cognitive Reserve
NCT00462007	PHASE4	COMPLETED	Study to Evaluate Initiation of Stalevo in Early Wearing-off
NCT00462254	PHASE4	TERMINATED	Ramelteon (ROZEREM) in the Treatment of Sleep Disturbances Associated With Parkinson’s Disease
NCT00477802	PHASE4	TERMINATED	Botulinum Toxin Type A (Botox) in the Management of Levodopa-Induced Peak-Dose Dyskinesias in Parkinson’s Disease
NCT00485069	PHASE4	COMPLETED	REQUIP (Ropinirole Hydrochloride) IR Long-Term Phase 4 Study
NCT00489255	PHASE4	COMPLETED	Safety/Efficacy of Tigan® to Control Nausea/Vomiting Experienced During Apokyn® Initiation and Treatment
NCT00526630	PHASE4	COMPLETED	Methylphenidate for the Treatment of Gait Impairment in Parkinson’s Disease
NCT00561678	PHASE4	COMPLETED	Perioperative Cognitive Function - Dexmedetomidine and Cognitive Reserve
NCT00571285	PHASE4	TERMINATED	Clinical Effects of Vitamin D Repletion in Patients With Parkinson’s Disease
NCT00584025	PHASE4	WITHDRAWN	Keppra IV for the Treatment of Motor Fluctuations in Parkinson’s Disease
NCT00584090	PHASE4	WITHDRAWN	Solifenacin Succinate (VESIcare) for the Treatment of Urinary Incontinence in Parkinson’s Disease
NCT00590122	PHASE4	COMPLETED	Parcopa Versus Carbidopa-levodopa in a Single Dose Cross-over Comparison Study
NCT00594464	PHASE4	COMPLETED	A Trial of Neupro® (Rotigotine Transdermal Patch) in Patients With Parkinson’s Disease Undergoing Surgery
NCT00601978	PHASE4	WITHDRAWN	Carbidopa/Levodopa Versus Carbidopa/Levodopa/Entacapone on Markers of Event Related Potentials (ERPs) in Patients With Idiopathic Parkinson’s Disease (PD) and End-of-dose Wearing Off
NCT00632762	PHASE4	COMPLETED	Long-Term Effects of Amantadine in Parkinsonian (AMANDYSK)
NCT00640159	PHASE4	COMPLETED	Selegiline to Zelapar Switch Study in Parkinson Disease Patients
NCT00642356	PHASE4	TERMINATED	Carbidopa/Levodopa/Entacapone Versus Immediate Release (IR) Carbidopa/Levodopa on Non-motor Symptoms in Patients With Idiopathic Parkinson’s Disease and Demonstrating Non-motor Symptoms of Wearing Off
NCT00646204	PHASE4	COMPLETED	Namenda (Memantine) for Non-motor Symptoms in Parkinson’s Disease