YWHAB

Summary

YWHAB (tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta, HGNC:12849) is a protein-coding gene on chromosome 20q13.12, encoding 14-3-3 protein beta/alpha (P31946). Adapter protein implicated in the regulation of a large spectrum of both general and specialized signaling pathways.

This gene encodes a protein belonging to the 14-3-3 family of proteins, members of which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals. The encoded protein has been shown to interact with RAF1 and CDC25 phosphatases, suggesting that it may play a role in linking mitogenic signaling and the cell cycle machinery. Two transcript variants, which encode the same protein, have been identified for this gene.

Source: NCBI Gene 7529 — RefSeq curated summary.

At a glance

• GWAS associations: 6
• Clinical variants (ClinVar): 9 total
• Druggable target: yes
• MANE Select transcript: NM_139323

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:12849
Approved symbol	YWHAB
Name	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta
Location	20q13.12
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000166913
Ensembl biotype	protein_coding
OMIM	601289
Entrez	7529

Gene structure

Transcript identifiers

Ensembl transcripts: 33 — 29 protein_coding, 2 retained_intron, 2 nonsense_mediated_decay

ENST00000353703, ENST00000372839, ENST00000428262, ENST00000445830, ENST00000477896, ENST00000479421, ENST00000631616, ENST00000633979, ENST00000879921, ENST00000879922, ENST00000879923, ENST00000879924, ENST00000879925, ENST00000879926, ENST00000879927, ENST00000879928, ENST00000879929, ENST00000879930, ENST00000920367, ENST00000920368, ENST00000920369, ENST00000920370, ENST00000957067, ENST00000957068, ENST00000957069, ENST00000957070, ENST00000957071, ENST00000957072, ENST00000957073, ENST00000957074, ENST00000957075, ENST00000957076, ENST00000957077

RefSeq mRNA: 2 — MANE Select: NM_139323 NM_003404, NM_139323

CCDS: CCDS13339

Canonical transcript exons

ENST00000353703 — 6 exons

Exon	Start	End
ENSE00001458785	44906382	44908532
ENSE00001891800	44885705	44885886
ENSE00003515039	44906001	44906096
ENSE00003550189	44903993	44904116
ENSE00003677841	44904968	44905131
ENSE00003798043	44901531	44901833

Expression profiles

Bgee: expression breadth ubiquitous, 295 present calls, max score 99.97.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 168.5818 / max 2368.3464, expressed in 1828 samples.

FANTOM5 promoters (4 alternative TSS)

Promoter ID	TPM avg	Samples expressed
184757	166.2503	1828
184756	1.8215	1231
184758	0.4473	225
184755	0.0627	18

Top tissues by expression

295 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
endothelial cell	CL:0000115	99.97	gold quality
Brodmann (1909) area 23	UBERON:0013554	99.97	gold quality
middle temporal gyrus	UBERON:0002771	99.94	gold quality
lateral nuclear group of thalamus	UBERON:0002736	99.91	gold quality
entorhinal cortex	UBERON:0002728	99.87	gold quality
parietal lobe	UBERON:0001872	99.86	gold quality
postcentral gyrus	UBERON:0002581	99.86	gold quality
pons	UBERON:0000988	99.81	gold quality
substantia nigra pars compacta	UBERON:0001965	99.80	gold quality
superior frontal gyrus	UBERON:0002661	99.78	gold quality
superior vestibular nucleus	UBERON:0007227	99.77	gold quality
substantia nigra pars reticulata	UBERON:0001966	99.76	gold quality
visceral pleura	UBERON:0002401	99.76	gold quality
lateral globus pallidus	UBERON:0002476	99.73	gold quality
pleura	UBERON:0000977	99.69	gold quality
ventral tegmental area	UBERON:0002691	99.68	gold quality
mucosa of sigmoid colon	UBERON:0004993	99.68	gold quality
parietal pleura	UBERON:0002400	99.67	gold quality
orbitofrontal cortex	UBERON:0004167	99.66	gold quality
tongue squamous epithelium	UBERON:0006919	99.66	gold quality
pancreatic ductal cell	CL:0002079	99.65	gold quality
medulla oblongata	UBERON:0001896	99.65	gold quality
CA1 field of hippocampus	UBERON:0003881	99.65	gold quality
colonic mucosa	UBERON:0000317	99.64	gold quality
Brodmann (1909) area 10	UBERON:0013541	99.64	gold quality
renal medulla	UBERON:0000362	99.63	gold quality
dorsal plus ventral thalamus	UBERON:0001897	99.63	gold quality
Brodmann (1909) area 46	UBERON:0006483	99.63	gold quality
trigeminal ganglion	UBERON:0001675	99.62	gold quality
dorsal root ganglion	UBERON:0000044	99.61	gold quality

Single-cell (SCXA)

Detected in 12 experiment(s), a significant marker in 7.

Experiment	Marker?	Max mean expression
E-MTAB-8142	yes	1845.54
E-HCAD-35	yes	47.94
E-HCAD-5	yes	47.45
E-CURD-122	yes	37.96
E-MTAB-10042	yes	16.80
E-MTAB-7316	yes	16.40
E-GEOD-110499	no	1408.51
E-CURD-95	no	1269.39
E-MTAB-10596	no	1039.31
E-CURD-89	no	1000.27
E-CURD-120	no	42.59
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): CEBPE, PAX5, POU2F2, SPI1

miRNA regulators (miRDB)

177 targeting YWHAB, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4682	100.00	68.89	1258
HSA-MIR-8485	100.00	77.57	4731
HSA-MIR-200B-3P	100.00	73.31	2693
HSA-MIR-200C-3P	100.00	73.35	2685
HSA-MIR-429	100.00	73.44	2698
HSA-MIR-4262	100.00	73.26	3931
HSA-MIR-3064-3P	100.00	70.09	1254
HSA-MIR-4789-3P	99.99	70.75	2484
HSA-MIR-4282	99.99	75.36	6408
HSA-MIR-513B-5P	99.99	69.96	2150
HSA-MIR-181A-5P	99.99	72.96	2995
HSA-MIR-181B-5P	99.99	72.97	2996
HSA-MIR-181C-5P	99.99	72.95	2996
HSA-MIR-181D-5P	99.99	73.04	2997
HSA-MIR-27A-3P	99.98	72.13	2955
HSA-MIR-27B-3P	99.98	72.13	2955
HSA-MIR-9985	99.98	72.11	2939
HSA-MIR-12136	99.98	72.81	5713
HSA-LET-7F-2-3P	99.98	70.98	2588
HSA-MIR-1185-1-3P	99.98	71.04	2593
HSA-MIR-1185-2-3P	99.98	71.04	2593
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-146A-5P	99.96	68.93	988
HSA-MIR-146B-5P	99.96	69.13	977
HSA-MIR-551B-5P	99.96	71.28	3493
HSA-MIR-128-3P	99.95	71.17	2484
HSA-MIR-216A-3P	99.95	71.19	2505
HSA-LET-7C-3P	99.95	73.42	2862
HSA-MIR-9983-3P	99.94	71.48	3631
HSA-MIR-7153-5P	99.94	68.89	1006

Literature-anchored findings (GeneRIF, showing 40)

• Results show that three 14-3-3 isoforms, beta, gamma and eta, are DAL-1/Protein 4.1B-binding proteins. (PMID:11996670)
• TSC2 associates with 14-3-3 in vivo (PMID:12364343)
• KCNK3 potassium channels are shown to bear two cytoplasmic trafficking motifs: an N-terminal dibasic site that binds beta-COP to hold channels in ER and a C-terminal “release” site that binds the ubiquitous intracellular regulator 14-3-3beta (PMID:12437930)
• 14-3-3 beta interacts with the TSC1-TSC2 complex and negatively regulates the function of the TSC proteins (PMID:12468542)
• 14-3-3 binds to the IGF-1 receptor after IGF1R’s serine autophosphorylation (PMID:12482592)
• MK2 phosphorylates TSC2, which creates a 14-3-3 binding site and thus regulates the cellular function of the TSC2 tumor suppressor protein (PMID:12582162)
• 14-3-3beta is a p90 ribosomal S6 kinase (RSK) isoform 1-binding protein that negatively regulates RSK kinase activity (PMID:12618428)
• Immunoexpression of 14-3-3 proteins in glial cytoplasmic inclusions of multiple system atrophy. (PMID:12669242)
• These findings suggest that deregulation of 14-3-3 protein amounts might contribute to the development of tumors in tuberous sclerosis patients. (PMID:14680818)
• HS1 with EPEP insertion polymorphism transmits accelerated signals from B cell receptor and is involved in pathogenesis of systemic lupus erythematosus. (PMID:15022330)
• novel binding site on 14-3-3 for integrin beta1 and a functional amphipathic groove, rather than its interaction with integrin beta1, is required for 14-3-3 regulation of cell spreading and migration. (PMID:15389601)
• decreased expression of selected 14-3-3 genes is a common feature of schizophrenia (PMID:15726117)
• Tyrosine 3-monooxygenase/tryptophan S-monooxygenase activation protein, beta polypeptide is decreased during acute lung injury more in mice deficient in metallothionein 1/2 (PMID:16166738)
• These data show a novel interaction for 14-3-3 with NFL mRNA, and suggests that 14-3-3 may play a role in regulating NFL mRNA stability. (PMID:17098443)
• 14-3-3beta binds DYRK1A (PMID:17229891)
• PBF is a new cellular factor mediating the effects of PI3K/Akt signaling and 14-3-3 on cell growth (PMID:17531190)
• Ror2 induces osteogenic differentiation, at least in part, through a release of the 14-3-3beta-mediated inhibition (PMID:17717073)
• A new regulatory mechanism of myosin light-chain phosphatase via the interaction between 14-3-3 and MYPT1, is reported. (PMID:18094049)
• changes in the expression of five 14-3-3 isoforms (beta, gamma, epsilon, tau, and zeta) during the apoptosis of JURL-MK1 and K562 cells. (PMID:19173300)
• 14-3-3beta, 14-3-3gamma, 14-3-3epsilon, 14-3-3eta and 14-3-3theta isoforms interact with the GPIb-IX complex in platelets (PMID:19558434)
• Study identified an overrepresentation of focal amplifications of known (FGFR3, CCND1, MYC, MDM2) and novel candidate genes (MYBL2, YWHAB and SDC4) in stage Ta bladder carcinoma. (PMID:19821490)
• Show that viral infection activates 14-3-3 protein mediated signaling pathways in human keratinocytes. (PMID:20070120)
• This protein has been found differentially expressed in the anterior cingulate cortex from patients with schizophrenia (PMID:20381070)
• 14-3-3 eta, beta, gamma and sigma isoforms were negatively expressed in meningioma (PMID:20388496)
• protein within PIV5-infected cells is phosphorylated at residue S369, binds the 14-3-3 protein, and is held away from sites of virus budding. (PMID:21147917)
• 14-3-3beta interacts with human Dapper1, attenuating the ability of hDpr1 to promote Dishevelled (Dvl) degradation, thus enhancing Wnt signaling (PMID:21262972)
• Studies indicate that Akt phosphorylates acetylated-FoxO and then phosphorylated FoxO interacts with 14-3-3 proteins in the nucleus, which in turn results in cytoplasmic retention of FoxO. (PMID:21396404)
• Data indicate that gene analysis revealed an up-regulation of all four 14-3-3 isoforms beta, eta, gamma, and sigma. (PMID:21416292)
• The expression levels of 14-3-3 protein beta/alpha were higher in urine samples from patients with renal cell carcinoma than in samples from healthy volunteers. (PMID:21553213)
• 14-3-3beta protein has the potential to be used as a diagnostic and prognostic biomarker in gastric cancer. (PMID:21598387)
• Studies indictet that the mammalian FoxO family consists of FoxO1, 3, 4 and 6 and are regulated by by AKT and 14-3-3 proteins. (PMID:21708191)
• Analyses show that high cytoplasmic levels of 14-3-3beta and epsilon independently correlate with poor disease-specific survival in vulvar squamous cell carcinoma cases. (PMID:21935479)
• Modulation of matrix metalloproteinase 1 by 14-3beta/alpha, may be important in the alteration of collagenase production associated with airway remodelling in obstructive lung diseases (PMID:21948273)
• In glioblastoma PTPIP51 expression increases with the grade of malignancy and PTPIP51 interacts in situ with 14-3-3ss and PTP1B. (PMID:21972092)
• Data identified 14-3-3beta as a prognostic biomarker. (PMID:22125622)
• 14-3-3beta binding to phosphorylated CFTR augments its biogenesis by reducing retrograde retrieval of CFTR to the endoplasmic reticulum. This mechanism permits cAMP/PKA stimulation to make more CFTR available for anion secretion. (PMID:22278744)
• These results indicate that the six YWHAB polymorphisms are not associated with the genetic susceptibility to sporadic Creutzfeldt-Jakob disease. (PMID:23053962)
• Using gene reporter assays, we show that promoter variations in 11 intrinsic apoptosis genes, including ADPRT, APAF1, BCL2, BAD, BID, MCL1, BIRC4, BCL2L1, ENDOG, YWHAB, and YWHAQ, influence promoter activity in an allele-specific manner. (PMID:24038028)
• Data identified three classes of 14-3-3 targets that all have two binding sites, but displayed synergistic interaction between converging signalling pathways for different ranges of parameter values. (PMID:24269229)
• Data suggest that serum 14-3-3beta concentrations may constitute a useful marker for blood brain barrier damage severity and follow up in patients with eosinophilic meningitis caused by Angiostrongylus cantonensis. (PMID:24555778)

Cross-species orthologs

7 orthologs

Organism	Symbol	Gene ID
danio_rerio	ywhaba	ENSDARG00000013078
danio_rerio	ywhabb	ENSDARG00000075758
mus_musculus	Ywhab	ENSMUSG00000018326
rattus_norvegicus	Ywhab	ENSRNOG00000010945
drosophila_melanogaster	14-3-3zeta	FBGN0004907
caenorhabditis_elegans		WBGENE00001502
caenorhabditis_elegans		WBGENE00003920

Paralogs (6): YWHAE (ENSG00000108953), YWHAH (ENSG00000128245), YWHAQ (ENSG00000134308), YWHAZ (ENSG00000164924), YWHAG (ENSG00000170027), SFN (ENSG00000175793)

Protein

Protein identifiers

14-3-3 protein beta/alpha — P31946 (reviewed: P31946)

Alternative names: Protein 1054, Protein kinase C inhibitor protein 1

All UniProt accessions (6): P31946, A0A0J9YWE8, A0A0J9YWZ2, Q4VY19, Q4VY20, V9HWD6

UniProt curated annotations — full annotation on UniProt →

Function. Adapter protein implicated in the regulation of a large spectrum of both general and specialized signaling pathways. Binds to a large number of partners, usually by recognition of a phosphoserine or phosphothreonine motif. Binding generally results in the modulation of the activity of the binding partner. Negative regulator of osteogenesis. Blocks the nuclear translocation of the phosphorylated form (by AKT1) of SRPK2 and antagonizes its stimulatory effect on cyclin D1 expression resulting in blockage of neuronal apoptosis elicited by SRPK2. Negative regulator of signaling cascades that mediate activation of MAP kinases via AKAP13.

Subunit / interactions. Homodimer. Interacts with SAMSN1 and PRKCE. Interacts with AKAP13. Interacts with SSH1 and TORC2/CRTC2. Interacts with ABL1; the interaction results in cytoplasmic location of ABL1 and inhibition of cABL-mediated apoptosis. Interacts with ROR2 (dimer); the interaction results in phosphorylation of YWHAB on tyrosine residues. Interacts with GAB2. Interacts with YAP1 (phosphorylated form). Interacts with the phosphorylated (by AKT1) form of SRPK2. Interacts with PKA-phosphorylated AANAT. Interacts with MYO1C. Interacts with SIRT2. Interacts with the ‘Thr-369’ phosphorylated form of DAPK2. Interacts with PI4KB, TBC1D22A and TBC1D22B. Interacts with the ‘Ser-1134’ and ‘Ser-1161’ phosphorylated form of SOS1. Interacts (via phosphorylated form) with YWHAB; this interaction occurs in a protein kinase AKT1-dependent manner. Interacts with SLITRK1. Interacts with SYNPO2 (phosphorylated form); YWHAB competes with ACTN2 for interaction with SYNPO2. Interacts with RIPOR2 (via phosphorylated form) isoform 2; this interaction occurs in a chemokine-dependent manner and does not compete for binding of RIPOR2 with RHOA nor blocks inhibition of RIPOR2-mediated RHOA activity. Interacts with MARK2 and MARK3. Interacts with TESK1; the interaction is dependent on the phosphorylation of TESK1 ‘Ser-437’ and inhibits TESK1 kinase activity. Interacts with MEFV. Interacts with HDAC4. Interacts with ADAM22 (via C-terminus). (Microbial infection) Interacts with herpes simplex virus 1 protein UL46. (Microbial infection) Probably interacts with Chlamydia trachomatis protein IncG.

Subcellular location. Cytoplasm. Melanosome Vacuole membrane.

Post-translational modifications. The alpha, brain-specific form differs from the beta form in being phosphorylated. Phosphorylated on Ser-60 by protein kinase C delta type catalytic subunit in a sphingosine-dependent fashion.

Similarity. Belongs to the 14-3-3 family.

Isoforms (2)

UniProt ID	Names	Canonical?
P31946-1	Long	yes
P31946-2	Short

RefSeq proteins (2): NP_003395, NP_647539* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000308	14-3-3	Family
IPR023409	14-3-3_CS	Conserved_site
IPR023410	14-3-3_domain	Domain
IPR036815	14-3-3_dom_sf	Homologous_superfamily

Pfam: PF00244

UniProt features (35 total): modified residue 13, helix 11, turn 3, chain 2, site 2, initiator methionine 1, cross-link 1, splice variant 1, sequence variant 1

Structure

Experimental structures (PDB)

17 structures.

PDB	Method	Resolution (Å)
8EQ8	X-RAY DIFFRACTION	1.5
5N10	X-RAY DIFFRACTION	1.6
6HEP	X-RAY DIFFRACTION	1.86
8EQH	X-RAY DIFFRACTION	1.9
6A5Q	X-RAY DIFFRACTION	2
6YGJ	X-RAY DIFFRACTION	2.07
4DNK	X-RAY DIFFRACTION	2.2
6GN8	X-RAY DIFFRACTION	2.34
2BQ0	X-RAY DIFFRACTION	2.5
6GNK	X-RAY DIFFRACTION	2.55
9GCP	X-RAY DIFFRACTION	2.59
2C23	X-RAY DIFFRACTION	2.65
6BYK	X-RAY DIFFRACTION	3
8DP5	ELECTRON MICROSCOPY	3.1
6GN0	X-RAY DIFFRACTION	3.24
6GNJ	X-RAY DIFFRACTION	3.24
6GNN	X-RAY DIFFRACTION	3.79

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P31946-F1	93.84	0.88

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (2): 58 (interaction with phosphoserine on interacting protein); 129 (interaction with phosphoserine on interacting protein)

Post-translational modifications (14): 60, 70, 84, 106, 117, 186, 232, 51, 1, 1, 2, 2, 5, 51

Function

Pathways and Gene Ontology

Reactome pathways

73 pathways

ID	Pathway
R-HSA-111447	Activation of BAD and translocation to mitochondria
R-HSA-1445148	Translocation of SLC2A4 (GLUT4) to the plasma membrane
R-HSA-165159	MTOR signalling
R-HSA-170968	Frs2-mediated activation
R-HSA-170984	ARMS-mediated activation
R-HSA-2028269	Signaling by Hippo
R-HSA-392517	Rap1 signalling
R-HSA-450385	Butyrate Response Factor 1 (BRF1) binds and destabilizes mRNA
R-HSA-450513	Tristetraprolin (TTP, ZFP36) binds and destabilizes mRNA
R-HSA-5625740	RHO GTPases activate PKNs
R-HSA-5628897	TP53 Regulates Metabolic Genes
R-HSA-5673000	RAF activation
R-HSA-5674135	MAP2K and MAPK activation
R-HSA-5675221	Negative regulation of MAPK pathway
R-HSA-6802946	Signaling by moderate kinase activity BRAF mutants
R-HSA-6802948	Signaling by high-kinase activity BRAF mutants
R-HSA-6802952	Signaling by BRAF and RAF1 fusions
R-HSA-6802955	Paradoxical activation of RAF signaling by kinase inactive BRAF
R-HSA-75035	Chk1/Chk2(Cds1) mediated inactivation of Cyclin B:Cdk1 complex
R-HSA-9614399	Regulation of localization of FOXO transcription factors
R-HSA-9649948	Signaling downstream of RAS mutants
R-HSA-9656223	Signaling by RAF1 mutants
R-HSA-9726840	SHOC2 M1731 mutant abolishes MRAS complex function
R-HSA-9726842	Gain-of-function MRAS complexes activate RAF signaling
R-HSA-9735871	SARS-CoV-1 targets host intracellular signalling and regulatory pathways
R-HSA-9755779	SARS-CoV-2 targets host intracellular signalling and regulatory pathways
R-HSA-9856649	Transcriptional and post-translational regulation of MITF-M expression and activity
R-HSA-166208	mTORC1-mediated signalling
R-HSA-109581	Apoptosis
R-HSA-109606	Intrinsic Pathway for Apoptosis

MSigDB gene sets: 381 (showing top): MULLIGHAN_NPM1_SIGNATURE_3_UP, MORF_MBD4, MORF_RAB5A, REACTOME_ADAPTIVE_IMMUNE_SYSTEM, GOBP_INTRACELLULAR_PROTEIN_TRANSPORT, MODULE_255, GOCC_VACUOLAR_MEMBRANE, PAL_PRMT5_TARGETS_UP, REACTOME_G2_M_DNA_DAMAGE_CHECKPOINT, MORF_HDAC1, GOBP_PROTEIN_TARGETING, MORF_RAD21, MODULE_317, HSIAO_HOUSEKEEPING_GENES, PID_NFAT_3PATHWAY

GO Biological Process (9): protein targeting (GO:0006605), signal transduction (GO:0007165), intracellular protein localization (GO:0008104), positive regulation of hippo signaling (GO:0035332), negative regulation of protein import into nucleus (GO:0042308), negative regulation of G protein-coupled receptor signaling pathway (GO:0045744), negative regulation of DNA-templated transcription (GO:0045892), positive regulation of transcription by RNA polymerase II (GO:0045944), negative regulation of cell growth involved in contact inhibition (GO:0060243)

GO Molecular Function (12): protein kinase inhibitor activity (GO:0004860), protein phosphatase inhibitor activity (GO:0004864), enzyme binding (GO:0019899), protein domain specific binding (GO:0019904), identical protein binding (GO:0042802), histone deacetylase binding (GO:0042826), protein-containing complex binding (GO:0044877), cadherin binding (GO:0045296), phosphoserine residue binding (GO:0050815), phosphoprotein binding (GO:0051219), protein sequestering activity (GO:0140311), protein binding (GO:0005515)

GO Cellular Component (12): nucleus (GO:0005634), cytoplasm (GO:0005737), vacuolar membrane (GO:0005774), cytosol (GO:0005829), focal adhesion (GO:0005925), membrane (GO:0016020), transcription repressor complex (GO:0017053), melanosome (GO:0042470), perinuclear region of cytoplasm (GO:0048471), extracellular exosome (GO:0070062), vacuole (GO:0005773), protein-containing complex (GO:0032991)

Reactome top-level categories

Rollup of top-12 pathways:

Category	Pathways
Oncogenic MAPK signaling	4
RAF/MAP kinase cascade	3
Signal Transduction	2
Prolonged ERK activation events	2
Regulation of mRNA stability by proteins that bind AU-rich elements	2
Activation of BH3-only proteins	1
Membrane Trafficking	1
Adaptive Immune System	1
RHO GTPase Effectors	1
Transcriptional Regulation by TP53	1
G2/M DNA damage checkpoint	1
FOXO-mediated transcription	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
protein binding	5
cellular anatomical structure	4
cytoplasm	3
binding	2
intracellular membrane-bounded organelle	2
establishment of protein localization	1
cell communication	1
cellular process	1
signaling	1
regulation of cellular process	1
cellular response to stimulus	1
macromolecule localization	1
hippo signaling	1
regulation of hippo signaling	1
positive regulation of intracellular signal transduction	1
protein import into nucleus	1
regulation of protein import into nucleus	1
negative regulation of nucleocytoplasmic transport	1
negative regulation of intracellular protein transport	1
negative regulation of protein localization to nucleus	1
G protein-coupled receptor signaling pathway	1
regulation of G protein-coupled receptor signaling pathway	1
negative regulation of signal transduction	1
DNA-templated transcription	1
regulation of DNA-templated transcription	1
negative regulation of RNA biosynthetic process	1
regulation of transcription by RNA polymerase II	1
transcription by RNA polymerase II	1
positive regulation of DNA-templated transcription	1
negative regulation of cell growth	1
contact inhibition	1
protein kinase activity	1
kinase inhibitor activity	1
protein kinase regulator activity	1
phosphoprotein phosphatase activity	1
phosphatase inhibitor activity	1
protein phosphatase regulator activity	1
enzyme binding	1
cell adhesion molecule binding	1
protein phosphorylated amino acid binding	1

Protein interactions and networks

STRING

5368 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
YWHAB	ACTB	P02570	857
YWHAB	TXNDC9	O14530	821
YWHAB	CDC25B	P30305	801
YWHAB	RAF1	P04049	752
YWHAB	POTEF	A5A3E0	735
YWHAB	TH	P07101	717
YWHAB	TPH2	Q8IWU9	682
YWHAB	CDC25C	P30307	672
YWHAB	RIN1	Q13671	668
YWHAB	SYNPO	Q8N3V7	656
YWHAB	YWHAE	P29360	651
YWHAB	CLTA	P09496	650
YWHAB	NDEL1	Q9GZM8	646
YWHAB	AKT1	P31749	637
YWHAB	SRSF3	P23152	622

IntAct

753 interactions, top by confidence:

A	B	Type	Score
MAP2K1	RAF1	psi-mi:“MI:0914”(association)	0.960
YWHAB	YWHAE	psi-mi:“MI:0407”(direct interaction)	0.930
YAP1	YWHAB	psi-mi:“MI:0915”(physical association)	0.910
YWHAB	YWHAG	psi-mi:“MI:0407”(direct interaction)	0.900
CDC25C	YWHAB	psi-mi:“MI:0915”(physical association)	0.890
PTPN3	YWHAQ	psi-mi:“MI:2364”(proximity)	0.850
YWHAB	YWHAQ	psi-mi:“MI:0407”(direct interaction)	0.850
YWHAH	ABLIM1	psi-mi:“MI:0914”(association)	0.800
CDK14	YWHAB	psi-mi:“MI:0915”(physical association)	0.750
YWHAB	CDK14	psi-mi:“MI:0915”(physical association)	0.750
ARL3	UNC119B	psi-mi:“MI:0914”(association)	0.730
YWHAH	FAM83G	psi-mi:“MI:0914”(association)	0.710
YWHAB	YWHAB	psi-mi:“MI:0407”(direct interaction)	0.670
PTPN3	MCC	psi-mi:“MI:0914”(association)	0.660
MAST1	YWHAB	psi-mi:“MI:0914”(association)	0.640
RAF1	CALU	psi-mi:“MI:0914”(association)	0.640
YWHAB	exoS	psi-mi:“MI:0407”(direct interaction)	0.640
YWHAH	PLEKHG3	psi-mi:“MI:0914”(association)	0.610
Ksr1	NME1	psi-mi:“MI:0914”(association)	0.580
CDC25A	YWHAQ	psi-mi:“MI:2364”(proximity)	0.570
TNS2	YWHAB	psi-mi:“MI:2364”(proximity)	0.570
PPP2R1A	ENSA	psi-mi:“MI:0914”(association)	0.530
KSR2	POLR3A	psi-mi:“MI:0914”(association)	0.530

BioGRID (2021): YWHAB (Affinity Capture-MS), YWHAB (Affinity Capture-Western), YWHAB (Far Western), DDIT4 (Affinity Capture-Western), ZFP36 (Reconstituted Complex), YWHAB (Affinity Capture-Western), YWHAB (Affinity Capture-Western), DTL (Affinity Capture-Western), YWHAB (Affinity Capture-MS), YWHAB (Affinity Capture-Western), YWHAB (Two-hybrid), YWHAB (Affinity Capture-MS), YWHAB (Affinity Capture-MS), YWHAB (Affinity Capture-MS), YWHAB (Affinity Capture-MS)

ESM2 similar proteins: A4K2U9, P27348, P29309, P29310, P29361, P31946, P35213, P61981, P61982, P61983, P63101, P63102, P63103, P63104, P68250, P68252, P68254, P68255, P68509, P68510, P68511, Q04917, Q1HR36, Q20655, Q2F637, Q3SZI4, Q4R572, Q52M98, Q5F3W6, Q5PRD0, Q5R651, Q5RC20, Q5RFJ2, Q5XGC8, Q5XHK2, Q5ZKC9, Q5ZLQ6, Q5ZMD1, Q6NRY9, Q6P4Z5

Diamond homologs: A4K2U9, B8NLM9, O49995, O49998, O65352, O70456, O77642, P27348, P29309, P29310, P29311, P29361, P31946, P31947, P34730, P35213, P41932, P42643, P42644, P42652, P42653, P42654, P42656, P48348, P49106, P52908, P54632, P61981, P61982, P61983, P62258, P62259, P62260, P62261, P62262, P63101, P63102, P63103, P63104, P68250

SIGNOR signaling

6 interactions.

A	Effect	B	Mechanism
MAPK8	down-regulates	YWHAB	phosphorylation
IKBKB	down-regulates	YWHAB	phosphorylation
PRKCD	down-regulates	YWHAB	phosphorylation
YWHAB	down-regulates	SRPK2	binding
YWHAB	“down-regulates activity”	NEFL	binding
PRKCZ	“down-regulates activity”	YWHAB	phosphorylation

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 193 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Chk1/Chk2(Cds1) mediated inactivation of Cyclin B:Cdk1 complex	7	34.1×	2e-07
Activation of BAD and translocation to mitochondria	5	27.6×	2e-05
Defective Intrinsic Pathway for Apoptosis	5	27.6×	2e-05
SARS-CoV-1 targets host intracellular signalling and regulatory pathways	5	24.3×	4e-05
Diseases of programmed cell death	5	23.0×	4e-05
Deregulated CDK5 triggers multiple neurodegenerative pathways in Alzheimer’s disease models	6	22.6×	8e-06
Signaling by RAS mutants	7	21.4×	2e-06
Signaling by high-kinase activity BRAF mutants	8	18.4×	9e-07

GO biological processes:

GO term	Partners	Fold	FDR
insulin-like growth factor receptor signaling pathway	5	14.5×	4e-03
G2/M transition of mitotic cell cycle	7	12.8×	5e-04
positive regulation of cytokinesis	5	11.7×	9e-03
neuron projection morphogenesis	6	9.7×	6e-03
MAPK cascade	10	9.0×	2e-04
microtubule cytoskeleton organization	9	6.4×	3e-03
intracellular protein localization	10	6.1×	2e-03
protein phosphorylation	12	4.8×	2e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

9 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	0
Likely benign	0
Benign	1

Top pathogenic / likely-pathogenic (0)

SpliceAI

871 predictions. Top by Δscore:

Variant	Effect	Δscore
20:44885855:G:GT	donor_gain	1.0000
20:44885884:ACGGT:A	donor_loss	1.0000
20:44885886:GGTG:G	donor_loss	1.0000
20:44885887:G:T	donor_loss	1.0000
20:44901517:T:TA	acceptor_gain	1.0000
20:44901523:T:TA	acceptor_gain	1.0000
20:44901527:CTAG:C	acceptor_loss	1.0000
20:44901529:A:AC	acceptor_loss	1.0000
20:44901529:A:AG	acceptor_gain	1.0000
20:44901529:AG:A	acceptor_gain	1.0000
20:44901529:AGG:A	acceptor_gain	1.0000
20:44901530:G:GT	acceptor_gain	1.0000
20:44901530:GG:G	acceptor_gain	1.0000
20:44901530:GGG:G	acceptor_gain	1.0000
20:44901530:GGGA:G	acceptor_gain	1.0000
20:44901530:GGGAA:G	acceptor_gain	1.0000
20:44901829:TTCTG:T	donor_gain	1.0000
20:44901834:G:GG	donor_gain	1.0000
20:44903985:T:G	acceptor_gain	1.0000
20:44903987:TTTTA:T	acceptor_loss	1.0000
20:44903988:TTTA:T	acceptor_loss	1.0000
20:44903989:TTAG:T	acceptor_loss	1.0000
20:44903991:A:AG	acceptor_gain	1.0000
20:44903991:A:C	acceptor_loss	1.0000
20:44903991:AG:A	acceptor_gain	1.0000
20:44903992:G:GA	acceptor_gain	1.0000
20:44903992:GG:G	acceptor_gain	1.0000
20:44903992:GGA:G	acceptor_gain	1.0000
20:44904112:ACAAA:A	donor_gain	1.0000
20:44904113:CAAA:C	donor_gain	1.0000

AlphaMissense

1633 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
20:44901576:G:C	A15P	1.000
20:44901585:G:C	A18P	1.000
20:44901592:G:C	R20P	1.000
20:44901605:G:A	M24I	1.000
20:44901605:G:C	M24I	1.000
20:44901605:G:T	M24I	1.000
20:44901661:G:C	R43T	1.000
20:44901661:G:T	R43I	1.000
20:44901662:A:C	R43S	1.000
20:44901662:A:T	R43S	1.000
20:44901665:T:A	N44K	1.000
20:44901665:T:G	N44K	1.000
20:44901667:T:C	L45P	1.000
20:44901670:T:C	L46P	1.000
20:44901672:T:C	S47P	1.000
20:44901673:C:T	S47F	1.000
20:44901676:T:A	V48D	1.000
20:44901679:C:A	A49D	1.000
20:44901681:T:G	Y50D	1.000
20:44901684:A:C	K51Q	1.000
20:44901684:A:G	K51E	1.000
20:44901685:A:C	K51T	1.000
20:44901685:A:T	K51M	1.000
20:44901686:G:C	K51N	1.000
20:44901686:G:T	K51N	1.000
20:44901687:A:G	N52D	1.000
20:44901689:T:A	N52K	1.000
20:44901689:T:G	N52K	1.000
20:44901696:G:C	G55R	1.000
20:44901696:G:T	G55C	1.000

dbSNP variants (sampled 300 via entrez): RS1000078233 (20:44887523 T>C), RS1000120262 (20:44885261 G>A), RS1000317881 (20:44890836 G>A), RS1000483521 (20:44902788 A>G), RS1000575536 (20:44885018 C>A), RS1000663105 (20:44889117 C>G,T), RS1000673072 (20:44897617 G>T), RS1000808755 (20:44886066 CCGGGGCCGGGCCCTTTACCT>C), RS1000812884 (20:44895126 A>G), RS1000854217 (20:44903186 C>T), RS1000877141 (20:44896644 A>G,T), RS1000932702 (20:44897900 G>A), RS1001026161 (20:44885793 C>T), RS1001057683 (20:44889350 C>G), RS1001219160 (20:44904262 G>A)

Disease associations

OMIM: gene MIM:601289 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

6 associations (top):

Study	Trait	p-value
GCST006585_1819	Blood protein levels	3.000000e-11
GCST008555_5	Breakfast cereal skipping frequency	3.000000e-08
GCST008556_5	Breakfast skipping	3.000000e-08
GCST90002379_163	Basophil count	8.000000e-22
GCST90002380_23	Basophil percentage of white cells	1.000000e-21
GCST90002395_596	Mean platelet volume	2.000000e-30

EFO canonical traits (3, from GWAS)

EFO ID	Trait name
EFO:0010129	breakfast skipping measurement
EFO:0005090	basophil count
EFO:0007992	basophil percentage of leukocytes

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL3710403 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

ChEMBL bioactivities

9 potent at pChembl≥5 of 18 total, top 9 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
7.40	IC50	40	nM	CHEMBL6172787
7.16	Kd	70	nM	CHEMBL3814675
7.09	Kd	80.7	nM	CHEMBL5653589
7.09	ED50	80.7	nM	CHEMBL5653589
6.37	IC50	430	nM	CHEMBL6166949
5.80	IC50	1600	nM	CHEMBL6167108
5.28	IC50	5200	nM	CHEMBL5564234
5.21	IC50	6200	nM	CHEMBL6169379
5.10	IC50	8000	nM	CHEMBL6159874

PubChem BioAssay actives

3 with measured affinity, of 6 total; 3 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
(2S)-1-[(2S)-2-[[(2R)-2-[[(2S)-2-[[(2S)-4-amino-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-5-carbamimidamido-2-[[(2S)-1-[(2S)-2-[[(2R)-2-[[(2S)-3-(1H-imidazol-5-yl)-2-[[(2S)-pyrrolidine-2-carbonyl]amino]propanoyl]amino]-3-sulfanylpropanoyl]amino]-3-methylbutanoyl]pyrrolidine-2-carbonyl]amino]pentanoyl]amino]-3-carboxypropanoyl]amino]-4-methylpentanoyl]amino]-3-hydroxypropanoyl]amino]-3-(1H-indol-3-yl)propanoyl]amino]-4-methylpentanoyl]amino]-3-carboxypropanoyl]amino]-4-methylpentanoyl]amino]-4-carboxybutanoyl]amino]propanoyl]amino]-4-oxobutanoyl]amino]-4-methylsulfanylbutanoyl]amino]-3-sulfanylpropanoyl]amino]-4-methylpentanoyl]pyrrolidine-2-carboxylic acid	1304817: Binding affinity to GST-tagged 125I-labelled 14-3-3beta (unknown origin) expressed in Escherichia coli by solid phase assay	kd	0.0700	uM
4-methyl-3-[(2-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2149799: Binding affinity to human YWHAB incubated for 45 mins by Kinobead based pull down assay	kd	0.0807	uM
[2-[2-oxo-2-(2-phenylethylamino)ethoxy]phenyl]phosphonic acid	2067068: Inhibition of human full length 14-3-3beta expressed in Escherichia coli BL21 (DE3) by fluorescence based analysis	ic50	5.2000	uM

CTD chemical–gene interactions

73 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Arsenic Trioxide	increases expression, decreases expression	2
Rotenone	increases reaction, decreases expression, affects binding	2
Valproic Acid	affects expression, increases expression	2
Cadmium Chloride	decreases reaction, increases abundance, increases palmitoylation, increases expression	2
aristolochic acid I	increases expression, decreases expression	1
moringin	affects cotreatment, decreases expression	1
testosterone enanthate	affects expression	1
uranyl acetate	affects expression	1
bisphenol A	increases expression	1
beta-lapachone	decreases expression, increases expression	1
arsenite	increases reaction, affects binding	1
methylparaben	increases expression	1
sulforaphane	affects binding	1
sodium arsenite	increases expression	1
cobaltous chloride	decreases expression	1
2-bromopalmitate	decreases reaction, increases abundance, increases palmitoylation	1
triphenyltin	decreases expression	1
beta-methylcholine	affects expression	1
casticin	increases expression	1
phenethyl isothiocyanate	affects binding	1
tributyltinisothiocyanate	decreases expression	1
azoxystrobin	decreases expression	1
deguelin	decreases expression	1
fenpyroximate	decreases expression	1
4-chloro-N-((4-(1,1-dimethylethyl)phenyl)methyl)-3-ethyl-1-methyl-1H-pyrazole-5-carboxamide	decreases expression	1
pyrimidifen	decreases expression	1
2,2’,4,4’-tetrabromodiphenyl ether	decreases expression	1
pyrachlostrobin	decreases expression	1
bromovanin	increases expression	1
hexabrominated diphenyl ether 153	decreases expression	1

ChEMBL screening assays

5 unique, capped per target: 5 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL3816073	Binding	Binding affinity to GST-tagged 125I-labelled 14-3-3beta (unknown origin) expressed in Escherichia coli by solid phase assay	Small molecules that target phosphorylation dependent protein-protein interaction. — Bioorg Med Chem

Cellosaurus cell lines

3 cell lines: 3 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B8RY	Abcam HCT 116 YWHAB KO	Cancer cell line	Male
CVCL_B9UG	Abcam A-549 YWHAB KO	Cancer cell line	Male
CVCL_E0T7	Ubigene HeLa YWHAB KO	Cancer cell line	Female

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.