ZBTB9

Summary

ZBTB9 (zinc finger and BTB domain containing 9, HGNC:28323) is a protein-coding gene on chromosome 6p21.32, encoding Zinc finger and BTB domain-containing protein 9 (Q96C00). May be involved in transcriptional regulation.

Enables identical protein binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to be located in nucleus.

Source: NCBI Gene 221504 — RefSeq curated summary.

At a glance

• GWAS associations: 8
• Clinical variants (ClinVar): 54 total
• Druggable target: yes
• MANE Select transcript: NM_152735

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:28323
Approved symbol	ZBTB9
Name	zinc finger and BTB domain containing 9
Location	6p21.32
Locus type	gene with protein product
Status	Approved
Aliases	MGC23166, ZNF919
Ensembl gene	ENSG00000213588
Ensembl biotype	protein_coding
Entrez	221504

Gene structure

Transcript identifiers

Ensembl transcripts: 7 — 7 protein_coding

ENST00000395064, ENST00000612407, ENST00000612775, ENST00000621915, ENST00000932373, ENST00000932374, ENST00000956060

RefSeq mRNA: 1 — MANE Select: NM_152735 NM_152735

CCDS: CCDS4780

Canonical transcript exons

ENST00000395064 — 2 exons

Exon	Start	End
ENSE00001792832	33454576	33454775
ENSE00001865424	33455030	33457544

Expression profiles

Bgee: expression breadth ubiquitous, 134 present calls, max score 86.01.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 7.5105 / max 39.0389, expressed in 1712 samples.

FANTOM5 promoters (3 alternative TSS)

Promoter ID	TPM avg	Samples expressed
67313	7.0586	1704
67314	0.2610	115
67312	0.1909	91

Top tissues by expression

134 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	86.01	gold quality
pituitary gland	UBERON:0000007	85.12	gold quality
adenohypophysis	UBERON:0002196	83.42	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	83.01	gold quality
islet of Langerhans	UBERON:0000006	80.75	gold quality
granulocyte	CL:0000094	78.80	gold quality
ventricular zone	UBERON:0003053	77.88	gold quality
stromal cell of endometrium	CL:0002255	77.81	gold quality
ganglionic eminence	UBERON:0004023	76.92	gold quality
endometrium	UBERON:0001295	76.71	gold quality
cortical plate	UBERON:0005343	76.67	gold quality
right testis	UBERON:0004534	76.28	gold quality
testis	UBERON:0000473	76.09	gold quality
right adrenal gland cortex	UBERON:0035827	76.03	gold quality
right adrenal gland	UBERON:0001233	75.82	gold quality
placenta	UBERON:0001987	75.79	gold quality
left testis	UBERON:0004533	75.74	gold quality
vermiform appendix	UBERON:0001154	75.56	gold quality
lymph node	UBERON:0000029	75.45	gold quality
prefrontal cortex	UBERON:0000451	75.15	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	75.00	gold quality
left adrenal gland	UBERON:0001234	74.90	gold quality
adrenal gland	UBERON:0002369	74.81	gold quality
apex of heart	UBERON:0002098	74.70	gold quality
left adrenal gland cortex	UBERON:0035825	74.43	gold quality
fallopian tube	UBERON:0003889	74.34	gold quality
mucosa of transverse colon	UBERON:0004991	74.32	gold quality
pancreas	UBERON:0001264	74.29	gold quality
frontal cortex	UBERON:0001870	74.14	gold quality
sural nerve	UBERON:0015488	74.09	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	0.33

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

79 targeting ZBTB9, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6748-5P	100.00	65.81	1057
HSA-MIR-34A-5P	99.99	71.21	1784
HSA-MIR-449A	99.99	71.05	1776
HSA-MIR-34C-5P	99.97	70.45	1577
HSA-MIR-449B-5P	99.97	70.26	1580
HSA-MIR-302E	99.96	70.74	2669
HSA-MIR-551B-5P	99.96	71.28	3493
HSA-MIR-106A-5P	99.90	73.94	2683
HSA-MIR-15A-5P	99.90	72.80	2787
HSA-MIR-15B-5P	99.90	72.78	2798
HSA-MIR-16-5P	99.90	72.80	2780
HSA-MIR-195-5P	99.90	72.81	2805
HSA-MIR-17-5P	99.89	73.83	2665
HSA-MIR-302A-3P	99.89	71.23	1777
HSA-MIR-302B-3P	99.89	71.23	1777
HSA-MIR-302C-3P	99.89	71.20	1778
HSA-MIR-302D-3P	99.89	71.25	1777
HSA-MIR-6838-5P	99.89	71.94	2690
HSA-MIR-106B-5P	99.88	74.72	2795
HSA-MIR-20A-5P	99.88	74.76	2769
HSA-MIR-20B-5P	99.88	74.01	2621
HSA-MIR-519D-3P	99.88	73.97	2607
HSA-MIR-526B-3P	99.88	74.06	2587
HSA-MIR-93-5P	99.88	73.98	2606
HSA-MIR-373-3P	99.84	70.68	1668
HSA-MIR-520E-3P	99.84	70.55	1698
HSA-MIR-372-3P	99.83	70.58	1691
HSA-MIR-520A-3P	99.83	70.59	1687
HSA-MIR-520B-3P	99.83	70.56	1699
HSA-MIR-520C-3P	99.83	70.56	1699

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Zbtb9	ENSMUSG00000079605
rattus_norvegicus	Zbtb9	ENSRNOG00000026799

Paralogs (5): ZBTB8A (ENSG00000160062), ZBTB10 (ENSG00000205189), ZBTB22 (ENSG00000236104), C17orf113 (ENSG00000267221), ZBTB8B (ENSG00000273274)

Protein

Protein identifiers

Zinc finger and BTB domain-containing protein 9 — Q96C00 (reviewed: Q96C00)

All UniProt accessions (5): A0A087WTT7, A0A087X1K1, A0A087X1Z5, A0A1U9X8U5, Q96C00

UniProt curated annotations — full annotation on UniProt →

Function. May be involved in transcriptional regulation.

Subcellular location. Nucleus.

RefSeq proteins (1): NP_689948* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000210	BTB/POZ_dom	Domain
IPR011333	SKP1/BTB/POZ_sf	Homologous_superfamily
IPR013087	Znf_C2H2_type	Domain
IPR036236	Znf_C2H2_sf	Homologous_superfamily
IPR050457	ZnFinger_BTB_dom_contain	Family

Pfam: PF00651

UniProt features (16 total): cross-link 5, compositionally biased region 4, zinc finger region 2, region of interest 2, chain 1, domain 1, sequence variant 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
9B9V	ELECTRON MICROSCOPY	8.1

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q96C00-F1	60.55	0.15

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (5): 286, 286, 293, 307, 382

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 119 (showing top): RRAGTTGT_UNKNOWN, TGCTGCT_MIR15A_MIR16_MIR15B_MIR195_MIR424_MIR497, SP3_Q3, GGGTGGRR_PAX4_03, NFKB_Q6, BRN2_01, AACTTT_UNKNOWN, RYTTCCTG_ETS2_B, VDR_Q3, P300_01, CDPCR3HD_01, PIT1_Q6, CCCNNGGGAR_OLF1_01, ACEVEDO_LIVER_CANCER_UP, P53_DECAMER_Q2

GO Biological Process (1): regulation of transcription by RNA polymerase II (GO:0006357)

GO Molecular Function (7): RNA polymerase II cis-regulatory region sequence-specific DNA binding (GO:0000978), DNA-binding transcription factor activity, RNA polymerase II-specific (GO:0000981), zinc ion binding (GO:0008270), identical protein binding (GO:0042802), DNA binding (GO:0003677), protein binding (GO:0005515), metal ion binding (GO:0046872)

GO Cellular Component (1): nucleus (GO:0005634)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
RNA polymerase II transcription regulatory region sequence-specific DNA binding	2
regulation of DNA-templated transcription	1
transcription by RNA polymerase II	1
cis-regulatory region sequence-specific DNA binding	1
chromatin	1
DNA-binding transcription factor activity	1
regulation of transcription by RNA polymerase II	1
transition metal ion binding	1
protein binding	1
nucleic acid binding	1
binding	1
cation binding	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

558 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
ZBTB9	GPX5	O75715	427
ZBTB9	KIAA0232	Q92628	418
ZBTB9	MCCD1	P59942	400
ZBTB9	TMEM42	Q69YG0	391
ZBTB9	OVCH1	Q7RTY7	376
ZBTB9	ATAT1	Q5SQI0	368
ZBTB9	RGL2	O15211	361
ZBTB9	KIFC1	Q9BW19	357
ZBTB9	BAK1	Q16611	350
ZBTB9	VPS52	Q8N1B4	324
ZBTB9	IQCE	Q6IPM2	321
ZBTB9	SCAND3	Q6R2W3	321
ZBTB9	DHX16	O60231	320
ZBTB9	CCDC71L	Q8N9Z2	311
ZBTB9	HSD17B8	Q92506	309

IntAct

226 interactions, top by confidence:

A	B	Type	Score
MED29	MED19	psi-mi:“MI:0914”(association)	0.890
KRTAP10-7	ZBTB9	psi-mi:“MI:0915”(physical association)	0.740
MED19	MED19	psi-mi:“MI:0914”(association)	0.730
EHHADH	ZBTB9	psi-mi:“MI:0915”(physical association)	0.720
ZBTB9	PIN1	psi-mi:“MI:0915”(physical association)	0.720
ZBTB9	TSR2	psi-mi:“MI:0915”(physical association)	0.720
KRTAP12-2	ZBTB9	psi-mi:“MI:0915”(physical association)	0.720
KRTAP10-9	ZBTB9	psi-mi:“MI:0915”(physical association)	0.720
ZBTB9	MDFI	psi-mi:“MI:0915”(physical association)	0.720
ZBTB9	EHHADH	psi-mi:“MI:0915”(physical association)	0.720
TSR2	ZBTB9	psi-mi:“MI:0915”(physical association)	0.720
ZBTB9	KRTAP12-2	psi-mi:“MI:0915”(physical association)	0.720
PIN1	ZBTB9	psi-mi:“MI:0915”(physical association)	0.720

BioGRID (153): ZBTB9 (Two-hybrid), ZBTB9 (Two-hybrid), ZBTB9 (Two-hybrid), ZBTB9 (Two-hybrid), ZBTB9 (Two-hybrid), ZBTB9 (Two-hybrid), ZBTB9 (Two-hybrid), ZBTB9 (Two-hybrid), ZBTB9 (Two-hybrid), ZBTB9 (Two-hybrid), ZBTB9 (Two-hybrid), ZBTB9 (Two-hybrid), KRTAP12-2 (Two-hybrid), KRTAP10-7 (Two-hybrid), KRTAP10-9 (Two-hybrid)

ESM2 similar proteins: A0JNJ4, A4IHR5, A6H7J1, A7UKY7, D4AE48, E9Q9M8, O15209, O35615, O75081, O95785, P03966, P04198, P39881, P49796, P52746, Q01101, Q1LY51, Q29RS4, Q32KV8, Q4KLY2, Q505G8, Q5T6C5, Q5TJE2, Q61976, Q62511, Q63379, Q63ZV0, Q6AY75, Q6NUJ5, Q6NV74, Q6P0F9, Q7T3H2, Q8BG80, Q8CDC7, Q8CE64, Q8IX07, Q8N554, Q8R4U1, Q96C00, Q96JP5

Diamond homologs: A0A1B8YAB1, A1YPR0, B0WWP2, B1H285, B3M9V8, B3NDN0, B4GRJ2, B4HIK1, B4J045, B4L0G9, B4LIG6, B4MXW3, B4PD06, B4QLQ2, C9JR72, D3Z8N4, E0CZ16, G3X9X1, O15062, O88939, O93567, O95365, P28575, P41182, P41183, Q08CL3, Q08DK3, Q13105, Q16RL8, Q2M0J9, Q3UQV5, Q52KB5, Q5EXX3, Q5R7B8, Q5RDY3, Q5TC79, Q5ZI33, Q5ZKD9, Q5ZM39, Q60821

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 111 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Transcriptional regulation of white adipocyte differentiation	6	10.8×	8e-03

GO biological processes:

GO term	Partners	Fold	FDR
positive regulation of miRNA transcription	9	26.1×	2e-08
positive regulation of transcription initiation by RNA polymerase II	5	13.6×	4e-03
transcription by RNA polymerase II	11	7.8×	2e-05

Disease & clinical

Clinical variants and AI predictions

ClinVar

54 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	49
Likely benign	3
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

340 predictions. Top by Δscore:

Variant	Effect	Δscore
6:33454829:G:GT	donor_gain	1.0000
6:33454787:C:T	donor_gain	0.9900
6:33454833:T:G	donor_gain	0.9900
6:33454711:G:GT	donor_gain	0.9800
6:33454783:C:T	donor_gain	0.9800
6:33454800:G:GT	donor_gain	0.9800
6:33455028:A:AG	acceptor_gain	0.9800
6:33455029:G:GG	acceptor_gain	0.9800
6:33454660:G:GT	donor_gain	0.9700
6:33455024:CTGCA:C	acceptor_loss	0.9700
6:33455025:TGCA:T	acceptor_loss	0.9700
6:33455026:GCA:G	acceptor_loss	0.9700
6:33455027:CAGC:C	acceptor_loss	0.9700
6:33455028:A:AC	acceptor_loss	0.9700
6:33454773:C:T	donor_gain	0.9600
6:33455029:GC:G	acceptor_gain	0.9600
6:33455029:GCC:G	acceptor_gain	0.9600
6:33454760:G:GT	donor_gain	0.9500
6:33454829:G:T	donor_gain	0.9500
6:33455027:CAGCC:C	acceptor_loss	0.9500
6:33454771:GGCAG:G	donor_loss	0.9400
6:33454772:GCAG:G	donor_loss	0.9400
6:33454773:CAG:C	donor_loss	0.9400
6:33454774:AG:A	donor_loss	0.9400
6:33454775:GG:G	donor_loss	0.9400
6:33454776:GTGA:G	donor_loss	0.9400
6:33454777:T:A	donor_loss	0.9400
6:33454792:G:GA	donor_gain	0.9400
6:33454794:C:G	donor_gain	0.9400
6:33455029:GCCTT:G	acceptor_gain	0.9400

AlphaMissense

3013 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
6:33456250:T:C	F384L	1.000
6:33456252:T:A	F384L	1.000
6:33456252:T:G	F384L	1.000
6:33456256:T:C	C386R	1.000
6:33456262:T:C	C388R	1.000
6:33456263:G:A	C388Y	1.000
6:33456274:T:C	F392L	1.000
6:33456275:T:C	F392S	1.000
6:33456275:T:G	F392C	1.000
6:33456276:T:A	F392L	1.000
6:33456276:T:G	F392L	1.000
6:33456292:C:A	R398S	1.000
6:33456301:C:A	H401N	1.000
6:33456301:C:G	H401D	1.000
6:33456302:A:G	H401R	1.000
6:33456303:C:A	H401Q	1.000
6:33456303:C:G	H401Q	1.000
6:33456311:T:C	L404P	1.000
6:33456331:T:C	F411L	1.000
6:33456333:T:A	F411L	1.000
6:33456333:T:G	F411L	1.000
6:33456337:T:C	C413R	1.000
6:33456346:T:C	C416R	1.000
6:33456347:G:A	C416Y	1.000
6:33456358:T:A	F420I	1.000
6:33456358:T:C	F420L	1.000
6:33456359:T:C	F420S	1.000
6:33456360:C:A	F420L	1.000
6:33456360:C:G	F420L	1.000
6:33456365:T:C	L422P	1.000

dbSNP variants (sampled 300 via entrez): RS1000444373 (6:33457486 CG>C,CGG), RS1000643222 (6:33454863 G>T), RS1000878537 (6:33457752 CTGTTTTGTTT>C,CTGTTT,CTGTTTTGTTTTGTTT,CTGTTTTGTTTTGTTTTGTTT), RS1001573882 (6:33457058 C>G), RS1001884214 (6:33454213 C>A,G), RS1002188079 (6:33454402 G>A), RS1002457453 (6:33454642 G>GC), RS1002553648 (6:33451136 G>A,T), RS1002573718 (6:33454935 A>G), RS1002665337 (6:33457558 G>A), RS1003459359 (6:33453183 C>T), RS1003464069 (6:33453468 C>G), RS1003967024 (6:33452832 G>T), RS1004794657 (6:33454955 G>A), RS1004993833 (6:33456653 T>C)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

8 associations (top):

Study	Trait	p-value
GCST001113_12	Age at smoking initiation in chronic obstructive pulmonary disease	7.000000e-08
GCST004521_251	Autism spectrum disorder or schizophrenia	6.000000e-12
GCST004521_287	Autism spectrum disorder or schizophrenia	5.000000e-08
GCST004521_75	Autism spectrum disorder or schizophrenia	8.000000e-10
GCST004748_121	Lung cancer	9.000000e-06
GCST007094_28	Diastolic blood pressure	2.000000e-09
GCST007656_5	Chronic obstructive pulmonary disease or resting heart rate (pleiotropy)	3.000000e-15
GCST010124_3	Crohn’s disease or systemic sclerosis	1.000000e-10

EFO canonical traits (2, from GWAS)

EFO ID	Trait name
EFO:0005670	smoking initiation
EFO:0006336	diastolic blood pressure

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL5069365 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

23 total (human), top 23 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Cadmium Chloride	decreases expression	3
3-((6-(2-methoxyphenyl)pyrimidin-4-yl)amino)phenyl)methane sulfonamide	decreases expression	1
GSK-J4	decreases expression	1
FR900359	affects phosphorylation	1
TAK-243	increases sumoylation	1
pirinixic acid	affects binding, increases activity, increases expression	1
bisphenol A	affects cotreatment, increases expression	1
sodium arsenite	decreases expression	1
ferrous chloride	decreases expression	1
coumarin	decreases phosphorylation	1
cylindrospermopsin	increases expression	1
Temozolomide	increases expression	1
Leflunomide	decreases expression	1
Atrazine	decreases expression	1
Caffeine	decreases phosphorylation	1
Dexamethasone	increases expression, affects cotreatment	1
Estradiol	affects expression	1
Indomethacin	affects cotreatment, increases expression	1
Valproic Acid	affects expression	1
1-Methyl-3-isobutylxanthine	affects cotreatment, increases expression	1
Aflatoxin B1	increases methylation	1
Copper Sulfate	decreases expression	1
Acrylamide	increases expression	1

ChEMBL screening assays

3 unique, capped per target: 3 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL5059498	Binding	Proteomics fold change data (SUDHL4 cells, 1h)	Data for DCP probe CCT369260

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.