ZFAND1

Summary

ZFAND1 (zinc finger AN1-type containing 1, HGNC:25858) is a protein-coding gene on chromosome 8q21.13, encoding AN1-type zinc finger protein 1 (Q8TCF1). Plays a role in the regulation of cytoplasmic stress granules (SGs) turnover.

Enables proteasome binding activity. Involved in cellular response to arsenite ion; positive regulation of intracellular protein transport; and stress granule disassembly. Located in cytoplasmic stress granule.

Source: NCBI Gene 79752 — RefSeq curated summary.

At a glance

• GWAS associations: 2
• Clinical variants (ClinVar): 45 total
• MANE Select transcript: NM_024699

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:25858
Approved symbol	ZFAND1
Name	zinc finger AN1-type containing 1
Location	8q21.13
Locus type	gene with protein product
Status	Approved
Aliases	FLJ14007
Ensembl gene	ENSG00000104231
Ensembl biotype	protein_coding
Entrez	79752

Gene structure

Transcript identifiers

Ensembl transcripts: 28 — 17 protein_coding, 5 retained_intron, 3 protein_coding_CDS_not_defined, 3 nonsense_mediated_decay

ENST00000220669, ENST00000517353, ENST00000517450, ENST00000517588, ENST00000518419, ENST00000519338, ENST00000519464, ENST00000519523, ENST00000519820, ENST00000520076, ENST00000520604, ENST00000520635, ENST00000520941, ENST00000521287, ENST00000521742, ENST00000521885, ENST00000521895, ENST00000522032, ENST00000522520, ENST00000523012, ENST00000523096, ENST00000523361, ENST00000523431, ENST00000524305, ENST00000524339, ENST00000899191, ENST00000899192, ENST00000899193

RefSeq mRNA: 3 — MANE Select: NM_024699 NM_001170796, NM_001170797, NM_024699

CCDS: CCDS55250, CCDS55251, CCDS6232

Canonical transcript exons

ENST00000220669 — 8 exons

Exon	Start	End
ENSE00001311435	81701337	81702865
ENSE00003471135	81702969	81703124
ENSE00003579726	81714804	81714895
ENSE00003581115	81714987	81715114
ENSE00003582166	81718182	81718224
ENSE00003583532	81717249	81717288
ENSE00003607911	81721227	81721300
ENSE00003787520	81713918	81714039

Expression profiles

Bgee: expression breadth ubiquitous, 287 present calls, max score 96.44.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 25.1727 / max 344.4867, expressed in 1803 samples.

FANTOM5 promoters (5 alternative TSS)

Promoter ID	TPM avg	Samples expressed
93775	22.3600	1791
93777	2.1495	476
93778	0.2878	123
93776	0.2158	84
93779	0.1595	87

Top tissues by expression

292 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
body of pancreas	UBERON:0001150	96.44	gold quality
pancreas	UBERON:0001264	95.36	gold quality
calcaneal tendon	UBERON:0003701	95.11	gold quality
monocyte	CL:0000576	94.90	gold quality
mononuclear cell	CL:0000842	94.82	gold quality
islet of Langerhans	UBERON:0000006	94.67	gold quality
popliteal artery	UBERON:0002250	94.45	gold quality
tibial artery	UBERON:0007610	94.44	gold quality
parotid gland	UBERON:0001831	94.34	gold quality
leukocyte	CL:0000738	94.28	gold quality
artery	UBERON:0001637	94.05	gold quality
left ovary	UBERON:0002119	93.97	gold quality
rectum	UBERON:0001052	93.81	gold quality
colonic epithelium	UBERON:0000397	93.59	gold quality
descending thoracic aorta	UBERON:0002345	93.53	gold quality
aorta	UBERON:0000947	93.48	gold quality
left lobe of thyroid gland	UBERON:0001120	93.20	gold quality
right coronary artery	UBERON:0001625	93.14	gold quality
mucosa of stomach	UBERON:0001199	93.08	gold quality
adrenal tissue	UBERON:0018303	93.05	gold quality
right ovary	UBERON:0002118	92.97	gold quality
thyroid gland	UBERON:0002046	92.93	gold quality
ovary	UBERON:0000992	92.84	gold quality
gall bladder	UBERON:0002110	92.71	gold quality
right lobe of thyroid gland	UBERON:0001119	92.66	gold quality
endocervix	UBERON:0000458	92.47	gold quality
body of uterus	UBERON:0009853	92.34	gold quality
thoracic aorta	UBERON:0001515	92.32	gold quality
left coronary artery	UBERON:0001626	92.27	gold quality
cerebellar hemisphere	UBERON:0002245	92.27	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	11.95

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

97 targeting ZFAND1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-30A-5P	100.00	76.31	3233
HSA-MIR-30B-5P	100.00	76.29	3248
HSA-MIR-30C-5P	100.00	76.29	3248
HSA-MIR-30D-5P	100.00	76.32	3233
HSA-MIR-30E-5P	100.00	76.32	3242
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-9-5P	100.00	72.28	2361
HSA-MIR-7110-3P	100.00	73.18	2486
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-25-3P	99.98	74.60	1817
HSA-MIR-363-3P	99.98	74.72	1821
HSA-MIR-367-3P	99.98	74.83	1819
HSA-MIR-32-5P	99.98	75.21	1964
HSA-MIR-92A-3P	99.98	75.21	1960
HSA-MIR-92B-3P	99.98	75.25	1955
HSA-MIR-4803	99.98	71.99	3117
HSA-MIR-6888-3P	99.97	65.95	1170
HSA-MIR-570-3P	99.96	72.41	4910
HSA-MIR-548AA	99.96	70.64	3753
HSA-MIR-548AP-3P	99.96	70.64	3753
HSA-MIR-548T-3P	99.96	70.64	3753
HSA-MIR-6835-3P	99.93	70.49	2904
HSA-MIR-4760-3P	99.93	70.50	2385
HSA-MIR-153-5P	99.89	73.86	6317
HSA-MIR-548E-5P	99.89	72.73	4486
HSA-MIR-3121-3P	99.82	71.96	3630
HSA-MIR-8080	99.82	67.52	1342
HSA-MIR-4659A-3P	99.80	72.62	4248
HSA-MIR-4659B-3P	99.80	72.62	4248

Literature-anchored findings (GeneRIF, showing 2)

• By recruiting the 26S proteasome and the ubiquitin-selective ATPase p97 to arsenite-induced stress granules, ZFAND1 ensures their timely clearance and prevents their aberration. (PMID:29804830)
• Structural insight into the ZFAND1-p97 interaction involved in stress granule clearance. (PMID:38537699)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	zfand1	ENSDARG00000009178
mus_musculus	Zfand1	ENSMUSG00000039795
rattus_norvegicus	Zfand1	ENSRNOG00000010342

Paralogs (2): ZFAND2B (ENSG00000158552), ZFAND2A (ENSG00000178381)

Protein

Protein identifiers

AN1-type zinc finger protein 1 — Q8TCF1 (reviewed: Q8TCF1)

Alternative names: Zinc finger AN1-type-containing protein 1

All UniProt accessions (13): E5RFE5, E5RFU1, E5RG60, E5RGE5, E5RHR9, E5RI74, E5RIH7, E5RIS3, E5RJ74, Q8TCF1, E5RK75, H0YBX7, Q05BD2

UniProt curated annotations — full annotation on UniProt →

Function. Plays a role in the regulation of cytoplasmic stress granules (SGs) turnover. SGs are dynamic and transient cytoplasmic ribonucleoprotein assemblies important for cellular protein homeostasis when protein production is suspended after acute exogenous stress. Associates with SGs and is involved in the efficient and specific arsenite-induced clearance process of SGs through the recruitment of the ubiquitin-selective ATPase VCP and the 26S proteasome. This process requires both complexes for efficient degradation of damaged ubiquitinated SG proteins during recovery from arsenite stress, and hence avoiding aberrant cytoplasmic SGs degradation via autophagy.

Subunit / interactions. Associates with the 26S proteasome; this association occurs upon exposure to arsenite and is reduced in the presence of ATP. Interacts (via AN1-type 1 and 2 zinc fingers) with PSMD1; this interaction is increased upon arsenite treatment and occurs in an ATP-independent manner. Interacts with PSMC4. Interacts with PSMA1. Interacts (via its ubiquitin-like region) with VCP; this interaction occurs in an arsenite-dependent manner and is necessary for the recruitment of the ubiquitin-selective ATPase VCP to stress granules (SGs).

Subcellular location. Cytoplasm. Stress granule.

Domain organisation. The ubiquitin-like region is necessary for its localization to stress granules (SGs) in a VCP-independent manner. The AN1-type 1 and 2 zinc finger domains are necessary for the recruitment of the 26S proteasome to SGs. Both the AN1-type 1 and 2 zinc finger domains and the ubiquitin-like region are necessary for efficient SGs clearance upon specific arsenite-induced responses.

Isoforms (4)

UniProt ID	Names	Canonical?
Q8TCF1-1	1	yes
Q8TCF1-2	2
Q8TCF1-3	3
Q8TCF1-4	4

RefSeq proteins (3): NP_001164267, NP_001164268, NP_078975* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000058	Znf_AN1	Domain
IPR035896	AN1-like_Znf	Homologous_superfamily
IPR057358	UBL_ZFAND1-like	Domain

Pfam: PF01428, PF25327

UniProt features (50 total): binding site 16, strand 9, helix 8, splice variant 4, sequence conflict 3, initiator methionine 2, zinc finger region 2, modified residue 2, turn 2, chain 1, region of interest 1

Structure

Experimental structures (PDB)

5 structures.

PDB	Method	Resolution (Å)
7Y39	X-RAY DIFFRACTION	1.88
7Y7L	SOLUTION NMR
7YAB	SOLUTION NMR
8HW9	SOLUTION NMR
8XE8	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8TCF1-F1	83.31	0.47

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (16): 36; 42; 44; 64; 69; 79; 82; 87; 90; 96; 98; 10 …

Post-translational modifications (2): 2, 2

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 163 (showing top): GSE45365_CD8A_DC_VS_CD11B_DC_IFNAR_KO_DN, GOBP_INTRACELLULAR_PROTEIN_TRANSPORT, BHATI_G2M_ARREST_BY_2METHOXYESTRADIOL_DN, GOBP_POSITIVE_REGULATION_OF_INTRACELLULAR_PROTEIN_TRANSPORT, GOBP_POSITIVE_REGULATION_OF_PROTEIN_LOCALIZATION, GOBP_CELLULAR_RESPONSE_TO_OXYGEN_CONTAINING_COMPOUND, GOBP_POSITIVE_REGULATION_OF_INTRACELLULAR_TRANSPORT, GOBP_REGULATION_OF_CELLULAR_LOCALIZATION, GOBP_CELLULAR_RESPONSE_TO_ARSENIC_CONTAINING_SUBSTANCE, GOBP_PROTEIN_RNA_COMPLEX_ORGANIZATION, GOBP_RESPONSE_TO_OXYGEN_CONTAINING_COMPOUND, GOBP_REGULATION_OF_INTRACELLULAR_PROTEIN_TRANSPORT, GOBP_CELLULAR_RESPONSE_TO_HEAT, NIKOLSKY_BREAST_CANCER_8Q12_Q22_AMPLICON, GOBP_RESPONSE_TO_ABIOTIC_STIMULUS

GO Biological Process (3): stress granule disassembly (GO:0035617), positive regulation of intracellular protein transport (GO:0090316), cellular response to arsenite ion (GO:1903843)

GO Molecular Function (4): zinc ion binding (GO:0008270), proteasome binding (GO:0070628), protein binding (GO:0005515), metal ion binding (GO:0046872)

GO Cellular Component (2): cytoplasm (GO:0005737), cytoplasmic stress granule (GO:0010494)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
protein-RNA complex disassembly	1
organelle disassembly	1
intracellular protein transport	1
positive regulation of intracellular transport	1
regulation of intracellular protein transport	1
positive regulation of protein transport	1
cellular response to arsenic-containing substance	1
cellular response to oxygen-containing compound	1
response to arsenite ion	1
transition metal ion binding	1
protein-containing complex binding	1
binding	1
cation binding	1
intracellular anatomical structure	1
cellular anatomical structure	1
cytoplasmic ribonucleoprotein granule	1

Protein interactions and networks

STRING

527 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
ZFAND1	VCP	P55072	856
ZFAND1	PSMD1	Q99460	538
ZFAND1	SLC10A5	Q5PT55	486
ZFAND1	ZFAND6	Q6FIF0	467
ZFAND1	NPIPB11	E5RHQ5	400
ZFAND1	SNX16	P57768	400
ZFAND1	MGRN1	O60291	394
ZFAND1	IMPA1	P29218	391
ZFAND1	GOLGA6L1	Q8N7Z2	391
ZFAND1	ZFAND4	Q86XD8	383
ZFAND1	SS18L2	Q9UHA2	371
ZFAND1	C4orf33	Q8N1A6	370
ZFAND1	TMEM60	Q9H2L4	367
ZFAND1	OR2T33	Q8NG76	358
ZFAND1	SLC25A32	Q9H2D1	354

IntAct

4 interactions, top by confidence:

A	B	Type	Score
ZFAND1	GPR35	psi-mi:“MI:0915”(physical association)	0.370
ERBB2	ZFAND1	psi-mi:“MI:0915”(physical association)	0.370
ZFAND1		psi-mi:“MI:0915”(physical association)	0.000

BioGRID (21): PSMD1 (Reconstituted Complex), PSMC4 (Reconstituted Complex), PSMA1 (Reconstituted Complex), VCP (Affinity Capture-Western), VCP (Co-localization), PSMC5 (Co-localization), PSMA3 (Co-localization), ZFAND1 (Two-hybrid), ZFAND1 (Two-hybrid), ZFAND1 (Affinity Capture-MS), ZFAND1 (Affinity Capture-Western), ZFAND1 (Affinity Capture-MS), ZFAND1 (Affinity Capture-MS), ZFAND1 (Co-fractionation), ZFAND1 (Co-fractionation)

ESM2 similar proteins: A1KXW8, A6QL50, E1BGQ2, H0Y354, O94955, P47224, Q08326, Q0IIH8, Q1JQA1, Q1RMS8, Q1RMZ1, Q2TBU5, Q3T1H6, Q4R372, Q4R528, Q4R9C4, Q5F480, Q5F4A1, Q5I0G3, Q5RCQ0, Q5RFG8, Q5TFE4, Q5TYM5, Q641X7, Q6L9T8, Q6PIP5, Q7L622, Q7Z6J8, Q7ZX59, Q86X60, Q8BFZ8, Q8BKW4, Q8BM85, Q8BX13, Q8CEL2, Q8N5C7, Q8N635, Q8NHU2, Q8TCF1, Q8TCJ0

Diamond homologs: P53899, Q0D5B9, Q4KLG9, Q55BU1, Q55GW8, Q5R966, Q5U2P3, Q67YE6, Q6H595, Q8BFR6, Q8N6M9, Q8TCF1, Q8VZ42, Q8WV99, Q91X58, Q9JII7, Q9SCM4

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

45 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	36
Likely benign	2
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1297 predictions. Top by Δscore:

Variant	Effect	Δscore
8:81702973:G:C	donor_gain	1.0000
8:81713933:ATCG:A	donor_gain	1.0000
8:81714798:ACTT:A	donor_loss	1.0000
8:81714799:CTTA:C	donor_loss	1.0000
8:81714800:TTA:T	donor_loss	1.0000
8:81714801:TA:T	donor_loss	1.0000
8:81714802:A:AC	donor_gain	1.0000
8:81714802:A:T	donor_loss	1.0000
8:81714803:C:CC	donor_gain	1.0000
8:81714803:C:T	donor_loss	1.0000
8:81714896:C:CC	acceptor_gain	1.0000
8:81714982:ATCAC:A	donor_loss	1.0000
8:81714983:TCA:T	donor_loss	1.0000
8:81714984:CAC:C	donor_loss	1.0000
8:81714986:CC:C	donor_loss	1.0000
8:81715023:A:C	donor_gain	1.0000
8:81715112:CAC:C	acceptor_gain	1.0000
8:81715112:CACCT:C	acceptor_loss	1.0000
8:81715114:CCTG:C	acceptor_loss	1.0000
8:81715115:C:A	acceptor_loss	1.0000
8:81715115:C:CC	acceptor_gain	1.0000
8:81715116:T:C	acceptor_loss	1.0000
8:81715121:A:C	acceptor_gain	1.0000
8:81721139:C:CA	donor_gain	1.0000
8:81721217:C:CA	donor_gain	1.0000
8:81702863:TTT:T	acceptor_gain	0.9900
8:81702866:C:CC	acceptor_gain	0.9900
8:81703121:CTGT:C	acceptor_gain	0.9900
8:81703125:C:CC	acceptor_gain	0.9900
8:81713934:T:C	donor_gain	0.9900

AlphaMissense

1788 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
8:81721253:C:G	C10S	0.973
8:81721254:A:T	C10S	0.973
8:81714890:C:G	R91P	0.969
8:81718183:A:G	C33R	0.969
8:81721254:A:G	C10R	0.968
8:81713943:G:T	A152D	0.966
8:81718184:A:C	F32L	0.966
8:81718184:A:T	F32L	0.966
8:81718186:A:G	F32L	0.966
8:81713951:C:A	K149N	0.963
8:81713951:C:G	K149N	0.963
8:81717279:G:C	H36Q	0.963
8:81717279:G:T	H36Q	0.963
8:81721238:C:G	C15S	0.963
8:81721239:A:T	C15S	0.963
8:81702861:A:G	L214S	0.958
8:81703059:G:C	F182L	0.958
8:81703059:G:T	F182L	0.958
8:81703061:A:G	F182L	0.958
8:81715018:A:G	C79R	0.958
8:81714891:G:T	R91S	0.957
8:81721252:G:C	C10W	0.957
8:81718211:A:C	F23L	0.955
8:81718211:A:T	F23L	0.955
8:81718213:A:G	F23L	0.955
8:81718220:A:C	F20L	0.953
8:81718220:A:T	F20L	0.953
8:81718222:A:G	F20L	0.953
8:81721239:A:G	C15R	0.952
8:81721253:C:T	C10Y	0.951

dbSNP variants (sampled 300 via entrez): RS1000130559 (8:81711111 G>A,C,T), RS1000142817 (8:81718952 G>C), RS1000251306 (8:81722812 T>A), RS1000403724 (8:81711836 A>C), RS1000436123 (8:81706459 G>GGGATAGGAGAGAGTCAACT), RS1000741026 (8:81709766 AGT>A), RS1000757743 (8:81716139 C>G), RS1000952512 (8:81713331 G>A), RS1001155783 (8:81720443 T>C,G), RS1001343399 (8:81706401 T>C), RS1001394779 (8:81721163 C>T), RS1001395939 (8:81713623 T>C), RS1001416938 (8:81704037 T>G), RS1001511718 (8:81703616 T>C), RS1001588706 (8:81701408 A>T)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST001941_13	Ovarian cancer	6.000000e-09
GCST001941_17	Ovarian cancer	7.000000e-10

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

37 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	increases expression, affects expression, decreases expression	5
Air Pollutants	affects cotreatment, increases abundance, increases expression, decreases expression	4
Cyclosporine	increases expression	4
sodium arsenite	decreases expression, increases expression	3
Tetrachlorodibenzodioxin	decreases expression	2
Tunicamycin	increases expression	2
Particulate Matter	increases expression, decreases expression, increases abundance	2
dicrotophos	decreases expression	1
triphenyl phosphate	affects expression	1
alpha-pinene	affects cotreatment, increases expression, increases abundance	1
kojic acid	decreases expression	1
arsenite	affects binding, increases reaction	1
mono-(2-ethylhexyl)phthalate	increases expression	1
tris(1,3-dichloro-2-propyl)phosphate	increases expression	1
methacrylaldehyde	increases abundance, affects cotreatment, increases expression	1
CGP 52608	affects binding, increases reaction	1
deguelin	increases expression	1
K 7174	increases expression	1
abrine	increases expression	1
2,2’,4,4’-tetrabromodiphenyl ether	increases expression	1
jinfukang	decreases expression	1
Sunitinib	increases expression	1
Leflunomide	increases expression	1
Acrolein	increases expression, increases abundance, affects cotreatment	1
Benzo(a)pyrene	increases methylation	1
Gold	decreases expression	1
Lead	affects splicing	1
Mitoxantrone	affects response to substance	1
Ozone	affects cotreatment, increases expression, increases abundance	1
Rotenone	increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.