ZFAND2B

Summary

ZFAND2B (zinc finger AN1-type containing 2B, HGNC:25206) is a protein-coding gene on chromosome 2q35, encoding AN1-type zinc finger protein 2B (Q8WV99). Plays a role in protein homeostasis by regulating both the translocation and the ubiquitin-mediated proteasomal degradation of nascent proteins at the endoplasmic reticulum.

This gene encodes a protein containing AN1-type zinc-fingers and ubiquitin-interacting motifs. The encoded protein likely associates with the proteosome to stimulate the degradation of toxic or misfolded proteins. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Source: NCBI Gene 130617 — RefSeq curated summary.

At a glance

• GWAS associations: 4
• Clinical variants (ClinVar): 55 total
• MANE Select transcript: NM_138802

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:25206
Approved symbol	ZFAND2B
Name	zinc finger AN1-type containing 2B
Location	2q35
Locus type	gene with protein product
Status	Approved
Aliases	AIRAPL
Ensembl gene	ENSG00000158552
Ensembl biotype	protein_coding
OMIM	613474
Entrez	130617

Gene structure

Transcript identifiers

Ensembl transcripts: 24 — 16 protein_coding, 5 retained_intron, 2 protein_coding_CDS_not_defined, 1 nonsense_mediated_decay

ENST00000289528, ENST00000409097, ENST00000409206, ENST00000409217, ENST00000409319, ENST00000409336, ENST00000409412, ENST00000409594, ENST00000422255, ENST00000425849, ENST00000436556, ENST00000444522, ENST00000448496, ENST00000464902, ENST00000468301, ENST00000469596, ENST00000475533, ENST00000476713, ENST00000486734, ENST00000489197, ENST00000621130, ENST00000873827, ENST00000912543, ENST00000912544

RefSeq mRNA: 3 — MANE Select: NM_138802 NM_001270998, NM_001270999, NM_138802

CCDS: CCDS2435, CCDS74656

Canonical transcript exons

ENST00000289528 — 9 exons

Exon	Start	End
ENSE00003514514	219207887	219208038
ENSE00003516865	219208426	219208486
ENSE00003537146	219208256	219208348
ENSE00003544855	219207648	219207779
ENSE00003574711	219208977	219209049
ENSE00003589601	219208572	219208639
ENSE00003787742	219207327	219207421
ENSE00003846263	219209262	219209648
ENSE00003847379	219206782	219207042

Expression profiles

Bgee: expression breadth ubiquitous, 245 present calls, max score 96.86.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 9.3822 / max 47.0897, expressed in 1774 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
25429	9.0052	1771
25430	0.3770	184

Top tissues by expression

262 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
lower esophagus mucosa	UBERON:0035834	96.86	gold quality
left lobe of thyroid gland	UBERON:0001120	96.21	gold quality
mucosa of transverse colon	UBERON:0004991	96.06	gold quality
right lobe of thyroid gland	UBERON:0001119	95.88	gold quality
granulocyte	CL:0000094	95.59	gold quality
thyroid gland	UBERON:0002046	95.38	gold quality
right hemisphere of cerebellum	UBERON:0014890	94.78	gold quality
small intestine Peyer’s patch	UBERON:0003454	94.38	gold quality
cerebellar hemisphere	UBERON:0002245	94.31	gold quality
right lobe of liver	UBERON:0001114	94.30	gold quality
transverse colon	UBERON:0001157	94.13	gold quality
metanephros cortex	UBERON:0010533	94.11	gold quality
cerebellar cortex	UBERON:0002129	94.06	gold quality
mucosa of stomach	UBERON:0001199	93.98	gold quality
right frontal lobe	UBERON:0002810	93.75	gold quality
esophagus mucosa	UBERON:0002469	93.68	gold quality
ascending aorta	UBERON:0001496	93.49	gold quality
thoracic aorta	UBERON:0001515	93.45	gold quality
small intestine	UBERON:0002108	93.42	gold quality
tibial artery	UBERON:0007610	93.38	gold quality
body of stomach	UBERON:0001161	93.37	gold quality
popliteal artery	UBERON:0002250	93.37	gold quality
aorta	UBERON:0000947	93.34	gold quality
adenohypophysis	UBERON:0002196	93.28	gold quality
skin of leg	UBERON:0001511	93.24	gold quality
right coronary artery	UBERON:0001625	93.23	gold quality
descending thoracic aorta	UBERON:0002345	93.16	gold quality
ectocervix	UBERON:0012249	93.09	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	93.04	gold quality
skin of abdomen	UBERON:0001416	92.97	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	6.37

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

14 targeting ZFAND2B, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-5193	100.00	67.26	1744
HSA-MIR-1236-3P	99.94	68.04	1695
HSA-MIR-18A-3P	99.56	65.68	1092
HSA-MIR-4489	99.50	65.56	785
HSA-MIR-766-3P	99.47	65.24	1811
HSA-MIR-7113-3P	98.75	65.71	1120
HSA-MIR-3179	98.22	65.90	1445
HSA-MIR-338-3P	98.14	67.38	1137
HSA-MIR-7113-5P	97.88	67.33	1735
HSA-MIR-146B-3P	97.83	65.29	782
HSA-MIR-7111-3P	97.80	66.75	1467
HSA-MIR-6085	96.57	64.11	621
HSA-MIR-6753-5P	94.70	64.08	470
HSA-MIR-6813-5P	94.68	64.20	588

Literature-anchored findings (GeneRIF, showing 5)

• An AIP-1 human homologue, ZFAND2B, has a similar protective effect against Abeta toxicity. (PMID:19414486)
• AIRAPL binds to p97 and forms a complex in the endoplasmic reticulum membrane. (PMID:24160817)
• Zinc finger proteins may be associated with pathophysiology of severe dry eye syndrome. (PMID:24215362)
• Results demonstrate that on specific translocation inhibition, a p97-AIRAPL complex directly binds and regulates the efficient processing of polyubiquitinated pQC substrates by the UPS. Results also demonstrate p97’s role in pQC processing of preproinsulin in cases of naturally occurring mutations within the signal sequence of insulin. (PMID:26337389)
• Consistent with its proposed role as a tumor suppressor of myeloid transformation, AIRAPL expression is widely abrogated in human myeloproliferative disorders. (PMID:26692333)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	zfand2a	ENSDARG00000103511
mus_musculus	Zfand2b	ENSMUSG00000026197
rattus_norvegicus	Zfand2b	ENSRNOG00000018639
drosophila_melanogaster	CG12795	FBGN0031535
caenorhabditis_elegans		WBGENE00000097

Paralogs (2): ZFAND1 (ENSG00000104231), ZFAND2A (ENSG00000178381)

Protein

Protein identifiers

AN1-type zinc finger protein 2B — Q8WV99 (reviewed: Q8WV99)

Alternative names: Arsenite-inducible RNA-associated protein-like protein

All UniProt accessions (9): A0A087X0D9, B4DEN4, B8ZZ56, C9J1R6, E7EV05, E9PFU9, Q8WV99, F8WEE4, H7C491

UniProt curated annotations — full annotation on UniProt →

Function. Plays a role in protein homeostasis by regulating both the translocation and the ubiquitin-mediated proteasomal degradation of nascent proteins at the endoplasmic reticulum. It is involved in the regulation of signal-mediated translocation of proteins into the endoplasmic reticulum. It also plays a role in the ubiquitin-mediated proteasomal degradation of proteins for which signal-mediated translocation to the endoplasmic reticulum has failed. May therefore function in the endoplasmic reticulum stress-induced pre-emptive quality control, a mechanism that selectively attenuates the translocation of newly synthesized proteins into the endoplasmic reticulum and reroutes them to the cytosol for proteasomal degradation. By controlling the steady-state expression of the IGF1R receptor, indirectly regulates the insulin-like growth factor receptor signaling pathway.

Subunit / interactions. Binds ‘Lys-48’-linked polyubiquitin chains of ubiquitinated proteins. Associates with the proteasome complex; upon exposure to arsenite. Interacts (via VIM motif) with VCP; the interaction is direct. Interacts with BAG6. Interacts with IGF1R (nascent precursor form). Interacts with DERL1, FAF2, NPLOC4 and UFD1; probably through VCP.

Subcellular location. Endoplasmic reticulum membrane.

Post-translational modifications. Phosphorylated by MAPK14. Phosphorylation has no effect on association with the proteasome complex.

Domain organisation. The UIM domains specifically bind ‘Lys-48’-linked ubiquitin polymers. The UIM domains mediate interaction with polyubiquitinated proteins.

Induction. Down-regulated by the miRNA miR-125a-3p in myelo-proliferative neoplasms.

Isoforms (2)

UniProt ID	Names	Canonical?
Q8WV99-1	1	yes
Q8WV99-2	2

RefSeq proteins (3): NP_001257927, NP_001257928, NP_620157* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000058	Znf_AN1	Domain
IPR003903	UIM_dom	Conserved_site
IPR035896	AN1-like_Znf	Homologous_superfamily
IPR057357	Znf-C2H2_ZFAND2A/B	Domain

Pfam: PF01428, PF02809, PF25403

UniProt features (34 total): binding site 16, modified residue 3, compositionally biased region 2, domain 2, zinc finger region 2, region of interest 2, chain 1, propeptide 1, lipid moiety-binding region 1, splice variant 1, strand 1, helix 1, short sequence motif 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
1X4V	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8WV99-F1	76.36	0.24

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (16): 10; 15; 25; 28; 33; 36; 42; 44; 100; 105; 115; 118 …

Post-translational modifications (4): 163, 173, 254, 254

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 97 (showing top): ATF_B, GOBP_INTRACELLULAR_PROTEIN_TRANSPORT, GOBP_PROTEIN_TARGETING, GOBP_MACROMOLECULE_CATABOLIC_PROCESS, GOBP_ESTABLISHMENT_OF_PROTEIN_LOCALIZATION_TO_ENDOPLASMIC_RETICULUM, GOBP_ESTABLISHMENT_OF_PROTEIN_LOCALIZATION_TO_ORGANELLE, GOBP_PROTEIN_TARGETING_TO_MEMBRANE, GOBP_INSULIN_LIKE_GROWTH_FACTOR_RECEPTOR_SIGNALING_PATHWAY, GOBP_ESTABLISHMENT_OF_PROTEIN_LOCALIZATION_TO_MEMBRANE, CREB_Q2_01, CREB_Q3, GOBP_PROTEIN_TRANSMEMBRANE_TRANSPORT, GOBP_REGULATION_OF_INSULIN_LIKE_GROWTH_FACTOR_RECEPTOR_SIGNALING_PATHWAY, GOBP_PROTEASOMAL_PROTEIN_CATABOLIC_PROCESS, GOBP_LOCALIZATION_WITHIN_MEMBRANE

GO Biological Process (4): SRP-dependent cotranslational protein targeting to membrane, translocation (GO:0006616), proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161), regulation of insulin-like growth factor receptor signaling pathway (GO:0043567), protein targeting to ER (GO:0045047)

GO Molecular Function (6): zinc ion binding (GO:0008270), K48-linked polyubiquitin modification-dependent protein binding (GO:0036435), ubiquitin binding (GO:0043130), protein binding (GO:0005515), polyubiquitin modification-dependent protein binding (GO:0031593), metal ion binding (GO:0046872)

GO Cellular Component (5): proteasome complex (GO:0000502), cytoplasm (GO:0005737), endoplasmic reticulum (GO:0005783), endoplasmic reticulum membrane (GO:0005789), membrane (GO:0016020)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	2
SRP-dependent cotranslational protein targeting to membrane	1
intracellular protein transmembrane transport	1
ubiquitin-dependent protein catabolic process	1
proteasomal protein catabolic process	1
regulation of signal transduction	1
insulin-like growth factor receptor signaling pathway	1
protein targeting	1
establishment of protein localization to endoplasmic reticulum	1
transition metal ion binding	1
polyubiquitin modification-dependent protein binding	1
ubiquitin-like protein binding	1
binding	1
modification-dependent protein binding	1
cation binding	1
intracellular protein-containing complex	1
endopeptidase complex	1
intracellular anatomical structure	1
cytoplasm	1
endomembrane system	1
intracellular membrane-bounded organelle	1
organelle membrane	1
nuclear outer membrane-endoplasmic reticulum membrane network	1
endoplasmic reticulum subcompartment	1

Protein interactions and networks

STRING

599 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
ZFAND2B	VCP	P55072	558
ZFAND2B	FAM219A	Q8IW50	532
ZFAND2B	ATOSA	Q32MH5	482
ZFAND2B	PAX6	P26367	456
ZFAND2B	ZNF511	Q8NB15	442
ZFAND2B	SOAT1	P35610	428
ZFAND2B	NGB	Q9NPG2	426
ZFAND2B	COL25A1	Q9BXS0	424
ZFAND2B	QPCT	Q16769	423
ZFAND2B	CCDC74B	Q96LY2	398
ZFAND2B	IDE	P14735	393
ZFAND2B	APBA2	Q99767	389
ZFAND2B	APP	P05067	388
ZFAND2B	PPIF	P30405	387
ZFAND2B	AIFM1	O95831	385

IntAct

42 interactions, top by confidence:

A	B	Type	Score
DAZAP2	ZFAND2B	psi-mi:“MI:0915”(physical association)	0.880
ZFAND2B	DAZAP2	psi-mi:“MI:0915”(physical association)	0.880
TARDBP	ZFAND2B	psi-mi:“MI:0915”(physical association)	0.560
UBQLN1	ZFAND2B	psi-mi:“MI:0915”(physical association)	0.560
ZFAND2B	TARDBP	psi-mi:“MI:0915”(physical association)	0.560
ZFAND2B	UBQLN1	psi-mi:“MI:0915”(physical association)	0.560
ZFAND2B	ASB7	psi-mi:“MI:0915”(physical association)	0.560
ZFAND2B	UBQLN2	psi-mi:“MI:0915”(physical association)	0.560
ASB7	POLR3A	psi-mi:“MI:0914”(association)	0.530
TMC7	HLCS	psi-mi:“MI:0914”(association)	0.530
TMEM31	PSMD11	psi-mi:“MI:0914”(association)	0.530
ZFAND2B	ECE1	psi-mi:“MI:0915”(physical association)	0.370
TANK	CNOT1	psi-mi:“MI:0914”(association)	0.350
RBCK1	KHNYN	psi-mi:“MI:0914”(association)	0.350
OR6M1	RPSA2	psi-mi:“MI:0914”(association)	0.350
OR6T1	PSMD11	psi-mi:“MI:0914”(association)	0.350
ATG9A	ABCD4	psi-mi:“MI:0914”(association)	0.350
ZFYVE27	SLC19A2	psi-mi:“MI:0914”(association)	0.350
ZFAND2B	UBB	psi-mi:“MI:0914”(association)	0.350

BioGRID (83): ZFAND2B (Two-hybrid), ZFAND2B (Two-hybrid), ZFAND2B (Two-hybrid), UBB (Affinity Capture-MS), HIST1H1A (Affinity Capture-MS), PSMC6 (Affinity Capture-MS), PSMC3 (Affinity Capture-MS), PSMC5 (Affinity Capture-MS), PSMD10 (Affinity Capture-MS), PSMD6 (Affinity Capture-MS), RAD50 (Affinity Capture-MS), PAAF1 (Affinity Capture-MS), GLUL (Affinity Capture-MS), ZFAND2B (Two-hybrid), ZFAND2B (Reconstituted Complex)

ESM2 similar proteins: E0X9N4, O42395, O65639, O74555, O77506, P0CO44, P0CO45, P34689, P36627, P49024, P53849, P53996, P62633, P62634, Q04832, Q09476, Q0JD07, Q14847, Q18034, Q3B7M5, Q3T0Q6, Q4JG17, Q4KLG9, Q4WXV6, Q54NW4, Q5NU13, Q5R5R5, Q5R5W0, Q5ZA07, Q61792, Q65XV7, Q69XQ3, Q6IDS6, Q7F8R0, Q7XPK1, Q7ZX83, Q8NIW7, Q8T8R1, Q8WV99, Q8WW36

Diamond homologs: P53899, Q0D5B9, Q4KLG9, Q55BU1, Q55GW8, Q5R966, Q5U2P3, Q67YE6, Q6H595, Q8BFR6, Q8N6M9, Q8TCF1, Q8VZ42, Q8WV99, Q91X58, Q9JII7, Q9SCM4

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 35 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Antigen processing: Ubiquitination & Proteasome degradation	5	7.2×	4e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

55 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	38
Likely benign	3
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1158 predictions. Top by Δscore:

Variant	Effect	Δscore
2:219207420:AGGTG:A	donor_loss	1.0000
2:219207421:GGTG:G	donor_loss	1.0000
2:219207422:GTG:G	donor_loss	1.0000
2:219208012:G:GT	donor_gain	1.0000
2:219208012:G:T	donor_gain	1.0000
2:219208013:G:T	donor_gain	1.0000
2:219208037:GG:G	donor_gain	1.0000
2:219208038:GG:G	donor_gain	1.0000
2:219208072:G:T	donor_gain	1.0000
2:219208424:A:AG	acceptor_gain	1.0000
2:219208425:G:GG	acceptor_gain	1.0000
2:219208571:GAGT:G	acceptor_gain	1.0000
2:219208975:A:AG	acceptor_gain	1.0000
2:219208976:G:GG	acceptor_gain	1.0000
2:219208976:GTT:G	acceptor_gain	1.0000
2:219207028:GCT:G	donor_gain	0.9900
2:219207041:GG:G	donor_gain	0.9900
2:219207042:GG:G	donor_gain	0.9900
2:219207255:A:AG	acceptor_gain	0.9900
2:219207256:G:GG	acceptor_gain	0.9900
2:219207423:T:G	donor_loss	0.9900
2:219207646:A:AG	acceptor_gain	0.9900
2:219207646:AG:A	acceptor_gain	0.9900
2:219207647:G:GG	acceptor_gain	0.9900
2:219207647:GG:G	acceptor_gain	0.9900
2:219207647:GGAT:G	acceptor_gain	0.9900
2:219207986:C:T	donor_gain	0.9900
2:219208013:G:GT	donor_gain	0.9900
2:219208035:C:T	donor_gain	0.9900
2:219208072:G:GT	donor_gain	0.9900

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000043499 (2:219204919 A>T), RS1000548792 (2:219206105 G>A), RS1001552057 (2:219207047 G>A,C), RS1001664944 (2:219205816 C>T), RS1001717272 (2:219206162 C>A,T), RS1002001716 (2:219206828 G>C,T), RS1002507110 (2:219208825 G>A), RS1003687791 (2:219208111 A>G), RS1004119780 (2:219210015 A>G), RS1004511582 (2:219205428 T>C), RS1004542480 (2:219208193 C>T), RS1005958470 (2:219209701 A>G), RS1006137297 (2:219206636 G>A,C), RS1006640619 (2:219205372 C>T), RS1006710849 (2:219206818 CCGGGGGCCGGCTGGCG>C,CCGGGGGCCGGCTGGCGCGGGGGCCGGCTGGCG)

Disease associations

OMIM: gene MIM:613474 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

4 associations (top):

Study	Trait	p-value
GCST90002393_391	Monocyte count	2.000000e-11
GCST90002396_180	Mean reticulocyte volume	1.000000e-21
GCST90002397_460	Mean spheric corpuscular volume	3.000000e-15
GCST90002407_38	White blood cell count	2.000000e-09

EFO canonical traits (2, from GWAS)

EFO ID	Trait name
EFO:0005091	monocyte count
EFO:0010701	mean reticulocyte volume

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

39 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Cisplatin	affects expression, decreases expression, increases expression	3
Valproic Acid	affects expression, decreases expression, affects cotreatment, increases expression	3
methacrylaldehyde	affects cotreatment, increases oxidation, increases abundance	2
Acrolein	affects cotreatment, increases oxidation, increases abundance	2
Ozone	affects cotreatment, increases oxidation, increases abundance	2
aristolochic acid I	decreases expression	1
triphenyl phosphate	affects expression	1
alpha-pinene	increases abundance, affects cotreatment, increases oxidation	1
pirinixic acid	affects binding, decreases expression, increases activity	1
bisphenol A	decreases expression	1
beta-lapachone	decreases expression	1
tris(1,3-dichloro-2-propyl)phosphate	increases expression	1
sodium arsenite	affects cotreatment, decreases expression, increases abundance	1
manganese chloride	decreases expression, increases abundance, affects cotreatment	1
perfluorooctane sulfonic acid	increases expression	1
K 7174	increases expression	1
ICG 001	increases expression	1
abrine	increases expression	1
Grape Seed Proanthocyanidins	affects cotreatment, increases expression	1
Temozolomide	decreases expression	1
Decitabine	affects expression	1
Sunitinib	increases expression	1
Air Pollutants	affects cotreatment, increases abundance, increases oxidation	1
Arsenic	affects cotreatment, decreases expression, increases abundance	1
Benzene	increases expression	1
Benzo(a)pyrene	decreases expression	1
Caffeine	increases phosphorylation	1
Catechin	affects cotreatment, increases expression	1
Hydralazine	affects cotreatment, increases expression	1
Manganese	affects cotreatment, decreases expression, increases abundance	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.