ZFHX4

Summary

ZFHX4 (zinc finger homeobox 4, HGNC:30939) is a protein-coding gene on chromosome 8q21.13, encoding Zinc finger homeobox protein 4 (Q86UP3). May play a role in neural and muscle differentiation. It is haploinsufficient (ClinGen: sufficient evidence).

Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to be located in chromatin. Predicted to be active in nucleus.

Source: NCBI Gene 79776 — RefSeq curated summary.

At a glance

• Gene–disease (curated): neurodevelopmental disorder (Definitive, GenCC) — +4 more curated relationships
• GWAS associations: 19
• Clinical variants (ClinVar): 741 total — 6 pathogenic, 8 likely-pathogenic
• Dosage sensitivity (ClinGen): haploinsufficiency sufficient evidence, triplosensitivity no evidence
• MANE Select transcript: NM_024721

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:30939
Approved symbol	ZFHX4
Name	zinc finger homeobox 4
Location	8q21.13
Locus type	gene with protein product
Status	Approved
Aliases	ZFH4, FLJ20980
Ensembl gene	ENSG00000091656
Ensembl biotype	protein_coding
OMIM	606940
Entrez	79776

Gene structure

Transcript identifiers

Ensembl transcripts: 14 — 7 protein_coding, 3 retained_intron, 2 protein_coding_CDS_not_defined, 2 nonsense_mediated_decay

ENST00000458716, ENST00000517585, ENST00000517683, ENST00000518282, ENST00000519536, ENST00000520307, ENST00000522409, ENST00000523625, ENST00000523809, ENST00000523885, ENST00000524290, ENST00000650716, ENST00000651020, ENST00000651372

RefSeq mRNA: 2 — MANE Select: NM_024721 NM_001410934, NM_024721

CCDS: CCDS47878, CCDS94320

Canonical transcript exons

ENST00000651372 — 11 exons

Exon	Start	End
ENSE00001087152	76850245	76850362
ENSE00001276957	76850886	76856300
ENSE00001326926	76849512	76849712
ENSE00001538539	76707546	76708048
ENSE00002103069	76863094	76867281
ENSE00003512923	76833338	76833406
ENSE00003569249	76848995	76849128
ENSE00003578368	76704043	76706678
ENSE00003579319	76778208	76778439
ENSE00003650080	76842655	76842771
ENSE00003844279	76681247	76681620

Expression profiles

Bgee: expression breadth ubiquitous, 230 present calls, max score 96.89.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 15.7859 / max 715.7134, expressed in 1178 samples.

FANTOM5 promoters (10 alternative TSS)

Promoter ID	TPM avg	Samples expressed
89439	11.6695	1148
89438	1.6631	415
89455	0.7461	288
89441	0.6962	345
89456	0.2469	93
89443	0.2317	120
89454	0.1750	52
89442	0.1614	87
89440	0.1273	55
89444	0.0688	26

Top tissues by expression

284 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
calcaneal tendon	UBERON:0003701	96.89	gold quality
tendon	UBERON:0000043	90.52	gold quality
adrenal tissue	UBERON:0018303	89.75	gold quality
corpus callosum	UBERON:0002336	89.00	gold quality
ventricular zone	UBERON:0003053	88.68	gold quality
seminal vesicle	UBERON:0000998	86.35	gold quality
substantia nigra pars reticulata	UBERON:0001966	85.64	gold quality
sural nerve	UBERON:0015488	85.59	gold quality
substantia nigra pars compacta	UBERON:0001965	84.33	gold quality
urethra	UBERON:0000057	83.79	gold quality
tendon of biceps brachii	UBERON:0008188	82.93	gold quality
ventral tegmental area	UBERON:0002691	82.82	gold quality
medial globus pallidus	UBERON:0002477	82.27	gold quality
globus pallidus	UBERON:0001875	81.26	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	80.37	gold quality
ganglionic eminence	UBERON:0004023	80.09	gold quality
tibialis anterior	UBERON:0001385	79.90	silver quality
colonic epithelium	UBERON:0000397	79.81	gold quality
subthalamic nucleus	UBERON:0001906	79.50	gold quality
biceps brachii	UBERON:0001507	79.39	gold quality
buccal mucosa cell	CL:0002336	79.33	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	79.19	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	78.66	gold quality
synovial joint	UBERON:0002217	78.20	gold quality
lateral nuclear group of thalamus	UBERON:0002736	77.92	gold quality
dorsal plus ventral thalamus	UBERON:0001897	77.83	gold quality
CA1 field of hippocampus	UBERON:0003881	77.65	gold quality
mucosa of paranasal sinus	UBERON:0005030	77.62	gold quality
diaphragm	UBERON:0001103	76.68	gold quality
olfactory bulb	UBERON:0002264	76.68	gold quality

Single-cell (SCXA)

Detected in 9 experiment(s), a significant marker in 8.

Experiment	Marker?	Max mean expression
E-MTAB-11121	yes	1007.55
E-MTAB-8894	yes	456.62
E-MTAB-10018	yes	412.81
E-CURD-112	yes	14.38
E-HCAD-5	yes	13.92
E-GEOD-93593	yes	9.96
E-HCAD-25	yes	7.76
E-MTAB-7381	no	44.59
E-ANND-3	no	0.00

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

2 targets.

Target	Regulation
BMAL1
CHD4

Upstream regulators (CollecTRI, top): AR

miRNA regulators (miRDB)

377 targeting ZFHX4, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-8485	100.00	77.57	4731
HSA-MIR-200B-3P	100.00	73.31	2693
HSA-MIR-200C-3P	100.00	73.35	2685
HSA-MIR-429	100.00	73.44	2698
HSA-MIR-9-5P	100.00	72.28	2361
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-4668-3P	100.00	68.74	2635
HSA-MIR-4262	100.00	73.26	3931
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-340-5P	100.00	72.50	4437
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-3662	99.99	73.82	5684
HSA-MIR-34A-5P	99.99	71.21	1784
HSA-MIR-449A	99.99	71.05	1776
HSA-MIR-513B-5P	99.99	69.96	2150
HSA-MIR-181A-5P	99.99	72.96	2995
HSA-MIR-181B-5P	99.99	72.97	2996
HSA-MIR-181C-5P	99.99	72.95	2996
HSA-MIR-181D-5P	99.99	73.04	2997
HSA-MIR-12136	99.98	72.81	5713
HSA-MIR-25-3P	99.98	74.60	1817
HSA-MIR-32-5P	99.98	75.21	1964
HSA-MIR-363-3P	99.98	74.72	1821
HSA-MIR-367-3P	99.98	74.83	1819
HSA-MIR-92A-3P	99.98	75.21	1960

Functional genomics

ClinGen dosage: haploinsufficiency 3 (sufficient evidence), triplosensitivity 0 (no evidence). ClinGen Gene Dosage Map

Literature-anchored findings (GeneRIF, showing 6)

• Human ZFH-4 is a candidate gene for congenital bilateral isolated ptosis, identified by molecular analysis of a de novo balanced translocation. (PMID:11935336)
• ZFHX4 interacts with and regulates CHD4. (PMID:24440720)
• rs28727938[G] is associated with susceptibility to cutaneous basal cell carcinoma. (PMID:25855136)
• Results showed that ZFHX4 was overexpressed in esophageal squamous cell carcinoma (ESCC) tumor compared to normal controls, and knockdown of ZFHX4 in vitro significantly inhibited cell migration and invasion. Mutations in ZFHX4 were strongly associated with poor prognosis and its down-regulation inhibits the progression of ESCC. (PMID:28694483)
• Prognostic Role of Zinc Finger Homeobox 4 in Ovarian Serous Cystadenocarcinoma. (PMID:32105524)
• A bioinformatics analysis: ZFHX4 is associated with metastasis and poor survival in ovarian cancer. (PMID:35915456)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	zfhx4	ENSDARG00000075542
mus_musculus	Zfhx4	ENSMUSG00000025255
rattus_norvegicus	Zfhx4	ENSRNOG00000008765

Paralogs (20): FHL1 (ENSG00000022267), LMO3 (ENSG00000048540), LHX5 (ENSG00000089116), LHX2 (ENSG00000106689), LHX6 (ENSG00000106852), LHX3 (ENSG00000107187), LHX4 (ENSG00000121454), LMO2 (ENSG00000135363), ZFHX2 (ENSG00000136367), LMX1B (ENSG00000136944), ZFHX3 (ENSG00000140836), LMO4 (ENSG00000143013), LHX9 (ENSG00000143355), CRIP3 (ENSG00000146215), LHX8 (ENSG00000162624), LMX1A (ENSG00000162761), LMO1 (ENSG00000166407), CRIP2 (ENSG00000182809), CRIP1 (ENSG00000213145), LHX1 (ENSG00000273706)

Protein

Protein identifiers

Zinc finger homeobox protein 4 — Q86UP3 (reviewed: Q86UP3)

Alternative names: Zinc finger homeodomain protein 4

All UniProt accessions (9): Q86UP3, A0A494BZV7, E5RG79, E5RGK3, E5RHS1, E5RI93, E7EVZ1, H0YBV0, H0YC81

UniProt curated annotations — full annotation on UniProt →

Function. May play a role in neural and muscle differentiation. May be involved in transcriptional regulation.

Subcellular location. Nucleus.

Tissue specificity. Expressed in brain, skeletal muscle and liver. Very low expression in stomach.

Disease relevance. A chromosomal aberration involving ZFHX4 is found in one patient with ptosis. Translocation t(1;8)(p34.3;q21.12).

Similarity. Belongs to the krueppel C2H2-type zinc-finger protein family.

Isoforms (5)

UniProt ID	Names	Canonical?
Q86UP3-1	1	yes
Q86UP3-2	2
Q86UP3-3	3
Q86UP3-4	4
Q86UP3-5	5

RefSeq proteins (2): NP_001397863, NP_078997* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001356	HD	Domain
IPR003604	Matrin/U1-like-C_Znf_C2H2	Domain
IPR009057	Homeodomain-like_sf	Homologous_superfamily
IPR013087	Znf_C2H2_type	Domain
IPR017970	Homeobox_CS	Conserved_site
IPR036236	Znf_C2H2_sf	Homologous_superfamily
IPR051968	ZnFinger_Homeobox_TR	Family

Pfam: PF00046, PF00096, PF12874, PF24056

UniProt features (95 total): compositionally biased region 30, zinc finger region 20, region of interest 19, splice variant 7, cross-link 6, DNA-binding region 4, sequence conflict 3, modified residue 2, sequence variant 2, chain 1, coiled-coil region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

No AlphaFold model available for Q86UP3 — AlphaFold DB does not currently provide models for proteins above ~3000 aa.

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (8): 1, 2663, 1149, 1299, 1324, 1546, 1790, 3154

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 270 (showing top): GSE18804_BRAIN_VS_COLON_TUMORAL_MACROPHAGE_DN, FREAC2_01, TAATAAT_MIR126, BUYTAERT_PHOTODYNAMIC_THERAPY_STRESS_DN, GGTGTGT_MIR329, TGCACTT_MIR519C_MIR519B_MIR519A, TTTGTAG_MIR520D, ACTGCAG_MIR173P, CHX10_01, AACWWCAANK_UNKNOWN, BLALOCK_ALZHEIMERS_DISEASE_UP, WTGAAAT_UNKNOWN, TCF11_01, ATTCTTT_MIR186, ONDER_CDH1_TARGETS_2_UP

GO Biological Process (2): regulation of transcription by RNA polymerase II (GO:0006357), regulation of DNA-templated transcription (GO:0006355)

GO Molecular Function (6): RNA polymerase II cis-regulatory region sequence-specific DNA binding (GO:0000978), DNA-binding transcription factor activity, RNA polymerase II-specific (GO:0000981), zinc ion binding (GO:0008270), nucleic acid binding (GO:0003676), DNA binding (GO:0003677), metal ion binding (GO:0046872)

GO Cellular Component (2): chromatin (GO:0000785), nucleus (GO:0005634)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
RNA polymerase II transcription regulatory region sequence-specific DNA binding	2
regulation of DNA-templated transcription	1
transcription by RNA polymerase II	1
DNA-templated transcription	1
regulation of gene expression	1
regulation of RNA biosynthetic process	1
cis-regulatory region sequence-specific DNA binding	1
chromatin	1
DNA-binding transcription factor activity	1
regulation of transcription by RNA polymerase II	1
transition metal ion binding	1
binding	1
nucleic acid binding	1
cation binding	1
chromosome	1
cellular anatomical structure	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

1110 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
ZFHX4	CSMD3	Q7Z407	658
ZFHX4	CHD4	Q14839	649
ZFHX4	LRP1B	Q9NZR2	600
ZFHX4	MUC16	Q8WXI7	583
ZFHX4	SYNE1	Q8NF91	578
ZFHX4	USH2A	O75445	574
ZFHX4	TTN	Q8WZ42	571
ZFHX4	RYR2	Q92736	570
ZFHX4	FAT3	Q8TDW7	545
ZFHX4	XIRP2	A4UGR9	544
ZFHX4	PCLO	Q9Y6V0	528
ZFHX4	FAT4	Q6V0I7	524
ZFHX4	KMT2D	O14686	518
ZFHX4	OBSCN	Q5VST9	507
ZFHX4	DNAH5	Q8TE73	474
ZFHX4	NAV3	Q8IVL0	474

IntAct

55 interactions, top by confidence:

A	B	Type	Score
KPNA1	TCERG1	psi-mi:“MI:0914”(association)	0.640
ALOXE3	HSPA8	psi-mi:“MI:0914”(association)	0.530
EN1	NFIB	psi-mi:“MI:2364”(proximity)	0.470
ZFHX4	RAP1B	psi-mi:“MI:0915”(physical association)	0.400
ZFHX4	ATP1A1	psi-mi:“MI:0915”(physical association)	0.400
ZFHX4	H2BC9	psi-mi:“MI:0915”(physical association)	0.400
FOXB1	DDX39A	psi-mi:“MI:0914”(association)	0.350
FOXJ2	TCERG1	psi-mi:“MI:0914”(association)	0.350
FOXL1	DDX39A	psi-mi:“MI:0914”(association)	0.350
TEAD2	DDX39A	psi-mi:“MI:0914”(association)	0.350
SOX2	SEC16A	psi-mi:“MI:0914”(association)	0.350
GRHL1	POLRMT	psi-mi:“MI:0914”(association)	0.350
SCRIB	CHD2	psi-mi:“MI:0914”(association)	0.350
MAGEA9	CIBAR1	psi-mi:“MI:0914”(association)	0.350
S100A4	VWA8	psi-mi:“MI:0914”(association)	0.350
OLFM2	ZSWIM8	psi-mi:“MI:0914”(association)	0.350
ZFHX3	CCS	psi-mi:“MI:0914”(association)	0.350
CCT8L2	DVL2	psi-mi:“MI:0914”(association)	0.350
HNRNPLL	TBX3	psi-mi:“MI:0914”(association)	0.350
AFG3L2	TBX3	psi-mi:“MI:0914”(association)	0.350
ZFHX3	TRAF7	psi-mi:“MI:0914”(association)	0.350
KLHL22	TRAV18	psi-mi:“MI:0914”(association)	0.350
SOX7	NFIB	psi-mi:“MI:2364”(proximity)	0.270
TBXT	BCL9	psi-mi:“MI:2364”(proximity)	0.270
ELK3	SMCHD1	psi-mi:“MI:2364”(proximity)	0.270
ERG	BCL9	psi-mi:“MI:2364”(proximity)	0.270
FEV	TAF4	psi-mi:“MI:2364”(proximity)	0.270
FOXI1	BCL9	psi-mi:“MI:2364”(proximity)	0.270
FOXL1	PGRMC1	psi-mi:“MI:2364”(proximity)	0.270

BioGRID (90): CHD4 (Affinity Capture-Western), ZFHX4 (Affinity Capture-Western), ZFHX4 (Biochemical Activity), ZFHX4 (Affinity Capture-MS), ZFHX4 (Affinity Capture-MS), ZFHX4 (Affinity Capture-MS), ZFHX4 (Affinity Capture-MS), ZFHX4 (Affinity Capture-MS), ZFHX4 (Affinity Capture-MS), ZFHX4 (Affinity Capture-MS), ZFHX4 (Affinity Capture-MS), ZFHX4 (Affinity Capture-MS), ZFHX4 (Proximity Label-MS), ZFHX4 (Proximity Label-MS), HIST1H2BH (Proximity Label-MS)

ESM2 similar proteins: A0JPB4, A1L1J6, A1L1R6, A1Z9R4, A2A935, A4IFJ6, E9Q6W4, E9Q8T2, G5E8B9, O08961, O13089, O15060, O42410, O57415, O73590, O95625, P14404, P57071, Q03112, Q03267, Q09452, Q13422, Q1L8W0, Q2M1K9, Q5DU09, Q5R9W9, Q5T0B9, Q5ZLR2, Q60821, Q62947, Q64318, Q6DBW0, Q6GNP2, Q6INV8, Q6KAS7, Q6NRM0, Q6NUD7, Q7TS63, Q802Y8, Q80TS5

Diamond homologs: A0A1L8FFY5, A0A1W2PPF3, A0JNI8, A1L0Z1, A1L2U9, A2PZF9, B0XS89, B1WAZ8, B1WBU4, G5EBU4, G5EC36, G5EE86, G5EEA1, O60315, O62836, O73590, P08048, P09088, P10925, P17010, P17012, P20154, P20662, P20912, P28166, P29674, P31362, P31363, P34764, P34765, P36197, P36198, P36200, P37137, P37275, P42571, P48742, P49335, P50458, P52739

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 72 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
TCF dependent signaling in response to WNT	5	12.0×	3e-03
Signaling by WNT	5	11.4×	3e-03

GO biological processes:

GO term	Partners	Fold	FDR
urogenital system development	5	70.8×	1e-06
inner ear morphogenesis	5	21.5×	2e-04
cell fate commitment	5	21.1×	2e-04
anatomical structure morphogenesis	10	19.9×	2e-08
neural tube closure	5	13.4×	1e-03
transcription by RNA polymerase II	10	10.1×	6e-06
kidney development	5	10.0×	3e-03
neuron differentiation	5	7.2×	8e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

741 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	6
Likely pathogenic	8
Uncertain significance	560
Likely benign	98
Benign	39

Top pathogenic / likely-pathogenic (14)

Variant ID	HGVS	Classification
1299125	NM_024721.5(ZFHX4):c.2969_2970del (p.Cys990fs)	Pathogenic
1699295	NM_024721.5(ZFHX4):c.5695C>T (p.Arg1899Ter)	Pathogenic
3067694	NM_024721.5(ZFHX4):c.7517_7524dup (p.Gln2509fs)	Pathogenic
3901199	NM_024721.5(ZFHX4):c.5286dup (p.Gly1763fs)	Pathogenic
4813839	NM_024721.5(ZFHX4):c.1202_1208del (p.Met401fs)	Pathogenic
563529	GRCh37/hg19 8q21.11-21.12(chr8:77345003-79544235)x1	Pathogenic
1699190	NM_024721.5(ZFHX4):c.4223_4224del (p.Thr1408fs)	Likely pathogenic
3363193	NM_024721.5(ZFHX4):c.3509_3510del (p.Ser1170fs)	Likely pathogenic
3911132	NM_024721.5(ZFHX4):c.3012T>A (p.Cys1004Ter)	Likely pathogenic
4535139	NM_024721.5(ZFHX4):c.1123_1124del (p.Leu375fs)	Likely pathogenic
4537418	NM_024721.5(ZFHX4):c.3640_3641insTC (p.Glu1214fs)	Likely pathogenic
4755993	NM_024721.5(ZFHX4):c.3094-2A>G	Likely pathogenic
4845606	NM_024721.5(ZFHX4):c.3813_3814del (p.Pro1273fs)	Likely pathogenic
930036	NM_024721.5(ZFHX4):c.3965-1G>A	Likely pathogenic

SpliceAI

2632 predictions. Top by Δscore:

Variant	Effect	Δscore
8:76756101:T:G	donor_gain	1.0000
8:76756101:T:TG	donor_gain	1.0000
8:76778206:A:AG	acceptor_gain	1.0000
8:76778207:G:GT	acceptor_gain	1.0000
8:76778207:GC:G	acceptor_gain	1.0000
8:76778207:GCA:G	acceptor_gain	1.0000
8:76778207:GCAC:G	acceptor_gain	1.0000
8:76778207:GCACT:G	acceptor_gain	1.0000
8:76778398:G:GG	donor_gain	1.0000
8:76778435:GCTTG:G	donor_gain	1.0000
8:76842653:A:AG	acceptor_gain	1.0000
8:76842654:G:GA	acceptor_gain	1.0000
8:76842654:GA:G	acceptor_gain	1.0000
8:76842654:GAA:G	acceptor_gain	1.0000
8:76842770:TGGT:T	donor_loss	1.0000
8:76842772:G:GC	donor_loss	1.0000
8:76842773:T:G	donor_loss	1.0000
8:76848985:T:TA	acceptor_gain	1.0000
8:76848986:G:A	acceptor_gain	1.0000
8:76848990:ATCAG:A	acceptor_gain	1.0000
8:76848992:CAGGG:C	acceptor_loss	1.0000
8:76848993:A:AG	acceptor_gain	1.0000
8:76848993:A:G	acceptor_loss	1.0000
8:76848993:AG:A	acceptor_gain	1.0000
8:76848993:AGG:A	acceptor_gain	1.0000
8:76848994:G:GC	acceptor_gain	1.0000
8:76848994:GG:G	acceptor_gain	1.0000
8:76848994:GGG:G	acceptor_gain	1.0000
8:76848994:GGGA:G	acceptor_gain	1.0000
8:76848994:GGGAT:G	acceptor_gain	1.0000

AlphaMissense

24006 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000008338 (8:76735907 G>A), RS1000008547 (8:76768125 GAAGATTGTGAACGAAGGCATGTAAATAATGGAGT>G), RS1000056715 (8:76729495 A>G), RS1000067234 (8:76820279 G>A), RS1000076388 (8:76779471 T>A,C), RS1000085402 (8:76863249 G>A,C), RS1000087369 (8:76754122 T>C), RS1000094912 (8:76810368 C>G,T), RS1000112861 (8:76694770 C>T), RS1000129659 (8:76779222 A>G), RS1000133940 (8:76819037 G>A), RS1000157174 (8:76837607 C>G), RS1000171184 (8:76771529 C>T), RS1000208034 (8:76681060 C>A,G,T), RS1000213418 (8:76859307 A>C)

Disease associations

OMIM: gene MIM:606940 | disease phenotypes: MIM:178300, MIM:602083

GenCC curated gene-disease

Disease	Classification	Inheritance
neurodevelopmental disorder	Definitive	Autosomal dominant
complex neurodevelopmental disorder	Moderate	Autosomal dominant
orofacial cleft	Limited	Autosomal dominant
congenital ptosis	No Known Disease Relationship	Autosomal dominant

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
syndromic complex neurodevelopmental disorder	Strong	AD

Mondo (6): ptosis, hereditary congenital, 1 (MONDO:0979905), neurodevelopmental disorder (MONDO:0700092), Usher syndrome type 1F (MONDO:0011186), orofacial cleft (MONDO:0000358), complex neurodevelopmental disorder (MONDO:0100038), congenital ptosis (MONDO:0008340)

Orphanet (3): Congenital ptosis (Orphanet:91411), Usher syndrome type 1 (Orphanet:231169), Usher syndrome (Orphanet:886)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

19 associations (top):

Study	Trait	p-value
GCST000175_13	Height	5.000000e-08
GCST002013_4	Menarche (age at onset)	5.000000e-06
GCST002842_12	Basal cell carcinoma	4.000000e-12
GCST003726_15	Basal cell carcinoma	5.000000e-15
GCST003996_31	Monobrow	6.000000e-21
GCST005867_17	Menarche (age at onset)	2.000000e-08
GCST005896_34	Non-melanoma skin cancer	2.000000e-16
GCST007096_52	Pulse pressure	2.000000e-08
GCST007099_11	Systolic blood pressure	4.000000e-06
GCST007565_68	Morning person	1.000000e-14
GCST007576_316	Chronotype	1.000000e-14
GCST008144_3	Fasting plasma glucose	3.000000e-07
GCST008363_66	Offspring birth weight	8.000000e-13
GCST009391_1209	Metabolite levels	6.000000e-06
GCST009391_304	Metabolite levels	5.000000e-06
GCST010988_302	Adult body size	5.000000e-17
GCST90000025_365	Appendicular lean mass	5.000000e-16
GCST90000026_32	Appendicular lean mass	8.000000e-09
GCST90000027_12	Appendicular lean mass	1.000000e-08

EFO canonical traits (11, from GWAS)

EFO ID	Trait name
EFO:0004703	age at menarche
EFO:0007906	synophrys measurement
EFO:0009260	non-melanoma skin carcinoma
EFO:0005763	pulse pressure measurement
EFO:0006335	systolic blood pressure
EFO:0008328	chronotype measurement
EFO:0004344	birth weight
EFO:0005939	parental genotype effect measurement
EFO:0010419	triacylglycerol 54:1 measurement
EFO:0010429	triacylglycerol 56:2 measurement
EFO:0004980	appendicular lean mass

MeSH disease descriptors (2)

Descriptor	Name	Tree numbers
D065886	Neurodevelopmental Disorders	F03.625
C566737	Ptosis, Hereditary Congenital 1 (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

51 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, decreases expression, decreases methylation, increases expression	8
bisphenol A	affects cotreatment, increases methylation, decreases expression	3
trichostatin A	affects cotreatment, decreases expression, increases expression	3
Arsenic	affects methylation, affects cotreatment, decreases expression, increases abundance	2
Benzo(a)pyrene	affects methylation, increases expression, increases methylation	2
Tobacco Smoke Pollution	affects expression, decreases expression	2
Aflatoxin B1	decreases methylation, increases methylation	2
Cadmium Chloride	decreases expression, increases abundance, increases expression	2
aristolochic acid I	decreases expression	1
FR900359	affects phosphorylation	1
bisphenol F	affects cotreatment, decreases expression	1
geldanamycin	increases expression	1
methylmercuric chloride	decreases expression	1
2-butenal	decreases expression	1
mono-(2-ethylhexyl)phthalate	decreases expression	1
sodium arsenite	affects cotreatment, decreases expression, increases abundance	1
manganese chloride	affects cotreatment, decreases expression, increases abundance	1
potassium chromate(VI)	decreases expression	1
aflatoxin B2	decreases methylation	1
nickel sulfate	decreases expression	1
perfluorooctane sulfonic acid	decreases expression	1
CGP 52608	affects binding, increases reaction	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
bisphenol S	affects cotreatment, decreases expression	1
jinfukang	decreases expression, affects cotreatment	1
Temozolomide	increases expression	1
Sunitinib	decreases expression	1
Fulvestrant	affects cotreatment, increases methylation	1
Vorinostat	decreases expression	1

Clinical trials (associated diseases)

214 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT04586348	PHASE4	UNKNOWN	Prenatal Iodine Supplementation and Early Childhood Neurodevelopment
NCT04873115	PHASE4	UNKNOWN	Double-blind, Placebo-controlled, Randomized Clinical Trial Comparing the Efficacy and Safety of Sialanar Plus orAl rehabiLitation Against Placebo Plus Oral Rehabilitation for chIldren and Adolescents With seVere Sialorrhoea and Neurodisabilties,
NCT02559102	PHASE3	COMPLETED	Dexmedetomidine Sedation Versus General Anaesthesia for Inguinal Hernia Surgery in Infants
NCT02757079	PHASE3	COMPLETED	Study of the Efficacy and Safety of NPC-15 for Sleep Disorders of Children With Neurodevelopmental Disorders
NCT06915480	PHASE3	RECRUITING	Reducing Missed Appointments
NCT07377032	PHASE3	RECRUITING	TAP-GRIN: Interventional Study on Patients With GRIN-related Neurodevelopmental Disorders
NCT02909959	PHASE2	COMPLETED	Sulforaphane for the Treatment of Young Men With Autism Spectrum Disorder
NCT06081348	PHASE2	RECRUITING	Sertraline vs. Placebo in the Treatment of Anxiety in Children and AdoLescents With NeurodevelopMental Disorders
NCT06352372	PHASE2	COMPLETED	Safety and Efficacy of tPBM for Epileptiform Activity in Autism
NCT00503191	PHASE1	COMPLETED	NeuroModulation Technique Treatment of Autism
NCT04475848	PHASE1	COMPLETED	A Study to Investigate the Safety, Tolerability, Pharmacokinetics, Pharmacodynamics and Food Effect of RO6953958 in Healthy Participants
NCT06300398	PHASE1	COMPLETED	IAMA-6 Oral Dose Study in Healthy Adults
NCT04342234	Not specified	RECRUITING	Neural Network to Calculate Morphology of the Cleft Palate to Reduce Cleft Lip and Palate Treatment Burden.
NCT05867862	Not specified	COMPLETED	Implementation of a Program to Strengthen Oral Hygiene in Patient With Cleft Deformities
NCT06880094	Not specified	RECRUITING	Study of Congenital Orofacial Clefts by Implementing Optical Genome Mapping
NCT07340008	Not specified	RECRUITING	Analgosedation With Ketamine, Nalbuphine, or Dexmedetomidine for Suture Removal in Children After Cleft Surgery
NCT07557576	Not specified	RECRUITING	Effect of Opioid-Free vs Opioid-Based Anesthesia on Postoperative Pain and Emergence Agitation in Children Undergoing Cleft Surgery
NCT06310681	Not specified	COMPLETED	Pilot Testing of a Co-adapted Group Programme for Parents/Carers of Children With Complex Neurodisability
NCT07303049	Not specified	NOT_YET_RECRUITING	Cognitive Benefit of Intensive Rehabilitation Using Rhythmic Music Training in Children With Complex Neurodevelopmental Disorder
NCT03240107	Not specified	COMPLETED	Levator Resection with3 Point Fixation Versus 2 Point Fixation Tucking for Congenital Ptosis
NCT04537169	Not specified	UNKNOWN	Clinical Significance of Whitnall Ligament Structure
NCT05895695	Not specified	UNKNOWN	Levator Muscle Reaction for Unilateral Congenital Ptosis Repair as Compared to Levator Plication
NCT07078552	Not specified	COMPLETED	Research on Precision Diagnosis and Treatment Decision of Common Eye Diseases Based on Artificial Intelligence
NCT07466706	Not specified	NOT_YET_RECRUITING	Levator Muscle and Its Aponeurotic Maldevelopment in Congenital Ptosis
NCT01783041	PHASE2/PHASE3	COMPLETED	Effect of Early L-Carnitine Supplementation on Neurodevelopmental Outcomes in Very Preterm Infants
NCT05767385	PHASE2/PHASE3	RECRUITING	Fetal Cerebrovascular Autoregulation in Congenital Heart Disease and Association With Neonatal Neurobehavior
NCT05675098	EARLY_PHASE1	NOT_YET_RECRUITING	Central Nervous System Stimulants and Physical Function in Children With Cerebral Palsy
NCT00783783	Not specified	COMPLETED	CYP2D6 Pharmacogenetics in Risperidone-Treated Children
NCT01778504	Not specified	RECRUITING	Studying Childhood-onset Behavioral, Psychiatric, and Developmental Disorders
NCT01850784	Not specified	UNKNOWN	High Energy Formula Feeding in Infants With Congenital Heart Disease
NCT01922791	Not specified	COMPLETED	Nutrition and Pregnancy Intervention Study
NCT01942525	Not specified	UNKNOWN	Influence of Intrauterine Growth Restriction on Amplitude-integrated EEG in Preterm Infants
NCT02003170	Not specified	COMPLETED	Etiology and Early Diagnosis of Neurodevelopmental Disorders
NCT02118649	Not specified	ACTIVE_NOT_RECRUITING	Enhancing Behavior and Brain Response to Visual Targets Using a Computer Game
NCT02557191	Not specified	TERMINATED	Biomarkers, Neurodevelopment and Preterm Infants
NCT02690675	Not specified	COMPLETED	Iron Supplement Effect on Child Development
NCT02694003	Not specified	COMPLETED	Better Nights, Better Days for Children With Neurodevelopment Disorders
NCT02792894	Not specified	COMPLETED	Family Networks (FaNs) for Children With Developmental Disorders and Delays
NCT02871674	Not specified	UNKNOWN	Good Night Project: Behavioural Sleep Interventions for Children With ADHD: A Randomised Controlled Trial
NCT02887157	Not specified	COMPLETED	Analyzing Retinal Microanatomy in ROP