ZFP36L2

Summary

ZFP36L2 (ZFP36 like 2 zinc finger CCCH-type, HGNC:1108) is a protein-coding gene on chromosome 2p21, encoding mRNA decay activator protein ZFP36L2 (P47974). Zinc-finger RNA-binding protein that destabilizes several cytoplasmic AU-rich element (ARE)-containing mRNA transcripts by promoting their poly(A) tail removal or deadenylation, and hence provide a mechanism for attenuating protein synthesis. It is a common-essential gene (DepMap: required in 99.9% of cancer cell lines).

This gene is a member of the TIS11 family of early response genes. Family members are induced by various agonists such as the phorbol ester TPA and the polypeptide mitogen EGF. The encoded protein contains a distinguishing putative zinc finger domain with a repeating cys-his motif. This putative nuclear transcription factor most likely functions in regulating the response to growth factors.

Source: NCBI Gene 678 — RefSeq curated summary.

At a glance

• Gene–disease (curated): oocyte maturation defect 13 (Limited, GenCC)
• GWAS associations: 40
• Clinical variants (ClinVar): 142 total — 1 pathogenic, 1 likely-pathogenic
• Phenotypes (HPO): 9
• Cancer dependency (DepMap): dependent in 99.9% of screened cell lines (common-essential)
• MANE Select transcript: NM_006887

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:1108
Approved symbol	ZFP36L2
Name	ZFP36 like 2 zinc finger CCCH-type
Location	2p21
Locus type	gene with protein product
Status	Approved
Aliases	ERF2, TIS11D
Ensembl gene	ENSG00000152518
Ensembl biotype	protein_coding
OMIM	612053
Entrez	678

Gene structure

Transcript identifiers

Ensembl transcripts: 4 — 4 protein_coding

ENST00000282388, ENST00000929033, ENST00000929034, ENST00000948981

RefSeq mRNA: 1 — MANE Select: NM_006887 NM_006887

CCDS: CCDS1811

Canonical transcript exons

ENST00000282388 — 2 exons

Exon	Start	End
ENSE00001005644	43222402	43225752
ENSE00001069476	43226265	43226606

Expression profiles

Bgee: expression breadth ubiquitous, 303 present calls, max score 99.59.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 18.3037 / max 189.5829, expressed in 1803 samples.

FANTOM5 promoters (5 alternative TSS)

Promoter ID	TPM avg	Samples expressed
28073	159.1847	1824
92711	18.3037	1803
28071	2.3423	902
28072	0.3997	145
28074	0.3992	102

Top tissues by expression

303 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
upper leg skin	UBERON:0004262	99.59	gold quality
skin of hip	UBERON:0001554	99.58	gold quality
mammary duct	UBERON:0001765	99.44	gold quality
epithelium of mammary gland	UBERON:0003244	99.42	gold quality
superficial temporal artery	UBERON:0001614	99.41	gold quality
trabecular bone tissue	UBERON:0002483	99.36	gold quality
mucosa of paranasal sinus	UBERON:0005030	99.26	gold quality
pericardium	UBERON:0002407	99.16	gold quality
nipple	UBERON:0002030	99.13	gold quality
synovial joint	UBERON:0002217	99.13	gold quality
thymus	UBERON:0002370	99.13	gold quality
endometrium epithelium	UBERON:0004811	99.11	gold quality
mammalian vulva	UBERON:0000997	99.08	gold quality
urethra	UBERON:0000057	99.07	gold quality
pylorus	UBERON:0001166	99.07	gold quality
mucosa of sigmoid colon	UBERON:0004993	98.97	gold quality
parotid gland	UBERON:0001831	98.96	gold quality
trachea	UBERON:0003126	98.95	gold quality
layer of synovial tissue	UBERON:0007616	98.94	gold quality
mammary gland	UBERON:0001911	98.93	gold quality
thoracic mammary gland	UBERON:0005200	98.93	gold quality
colonic mucosa	UBERON:0000317	98.83	gold quality
cardia of stomach	UBERON:0001162	98.82	gold quality
upper arm skin	UBERON:0004263	98.82	gold quality
trigeminal ganglion	UBERON:0001675	98.81	gold quality
vena cava	UBERON:0004087	98.81	gold quality
lower lobe of lung	UBERON:0008949	98.81	gold quality
germinal epithelium of ovary	UBERON:0001304	98.80	gold quality
cauda epididymis	UBERON:0004360	98.78	gold quality
caecum	UBERON:0001153	98.77	gold quality

Single-cell (SCXA)

Detected in 37 experiment(s), a significant marker in 27.

Experiment	Marker?	Max mean expression
E-HCAD-36	yes	6478.96
E-MTAB-8142	yes	4350.79
E-CURD-122	yes	4333.28
E-HCAD-15	yes	2495.91
E-HCAD-1	yes	2173.53
E-MTAB-8495	yes	2049.19
E-MTAB-6653	yes	1587.36
E-HCAD-4	yes	1342.91
E-MTAB-7052	yes	1291.33
E-MTAB-6701	yes	133.97
E-GEOD-93593	yes	101.86
E-CURD-46	yes	70.12
E-MTAB-10553	yes	65.76
E-HCAD-8	yes	64.04
E-CURD-114	yes	60.49

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

188 targeting ZFP36L2, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4262	100.00	73.26	3931
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-656-3P	100.00	72.15	2788
HSA-MIR-340-5P	100.00	72.50	4437
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-432-3P	100.00	67.86	705
HSA-MIR-30A-5P	100.00	76.31	3233
HSA-MIR-30B-5P	100.00	76.29	3248
HSA-MIR-30C-5P	100.00	76.29	3248
HSA-MIR-30D-5P	100.00	76.32	3233
HSA-MIR-30E-5P	100.00	76.32	3242
HSA-MIR-1193	100.00	65.93	529
HSA-MIR-181A-5P	99.99	72.96	2995
HSA-MIR-181B-5P	99.99	72.97	2996
HSA-MIR-181C-5P	99.99	72.95	2996
HSA-MIR-181D-5P	99.99	73.04	2997
HSA-MIR-513B-5P	99.99	69.96	2150
HSA-MIR-371B-5P	99.99	75.34	4759
HSA-MIR-4282	99.99	75.36	6408
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-186-5P	99.99	70.83	3707
HSA-MIR-6870-5P	99.99	68.55	2115
HSA-MIR-373-5P	99.98	75.36	4753
HSA-MIR-616-5P	99.98	75.58	4775
HSA-MIR-12136	99.98	72.81	5713
HSA-MIR-4803	99.98	71.99	3117
HSA-MIR-27A-3P	99.98	72.13	2955

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 99.9% of screened cell lines, common-essential.

Literature-anchored findings (GeneRIF, showing 23)

• polymorphisms sequenced in genomic DNA encoding the TTP protein (ZFP36) and those of its two known mammalian relatives, ZFP36L1 and ZFP36L2, from 72 to 92 anonymous human subjects from various geographical and ethnic backgrounds (PMID:14604009)
• Sequence specificity in RNA recognition is achieved by a network of intermolecular hydrogen bonds, mostly between TIS11d main-chain functional groups and the Watson-Crick edges of the bases (PMID:14981510)
• These data suggest TIS11D as a candidate p53 target gene that may be part of the network of genes responsible for p53-dependent apoptosis. (PMID:17172869)
• Multiple nanosecond timescale molecular dynamics trajectories of TIS11d wild-type and E157R/E195K mutant with different RNA sequences were performed to investigate the molecular basis for RNA binding specificities of this TZF domain. (PMID:20506496)
• Data suggest that the dysregulation of TIS11D function is associated with the pathogenesis of certain types of leukemia. (PMID:21109922)
• The roles of TTP and BRF proteins in regulated mRNA decay. (PMID:21278925)
• ZFP36L2 gene expression is decreased in both classic and follicular variants of papillary thyroid carcinoma. (PMID:21509594)
• Study of the role of the C-terminal residues in the structure of unbound TIS11d, the E220A mutant and the truncation mutant lacking the last two residues (D219/E220) using molecular dynamics, NMR spectroscopy, and biochemical methods (PMID:25809263)
• silencing ZFP36L2 inhibited cancer cell aggressiveness in pancreatic ductal adenocarcinoma cell lines, and overexpression of ZFP36L2 was confirmed in pancreatic ductal adenocarcinoma clinical specimens (PMID:27862697)
• Significantly mutated gene ZFP36L2 displayed strong antiproliferation function in Esophageal Squamous Cell Carcinoma but not in Esophageal Adenocarcinomas. (PMID:28860350)
• The results indicated that ZFP36L1 and ZFP36L2 play a negative role in cell proliferation; the underlying mechanisms might be mediated through a cyclin D-dependent and p53-independent pathway. (PMID:29426877)
• ZFP36L2 could be transactivated by AML1, which subsequently induced cell-cycle arrest and apoptosis of leukemia cells (PMID:29518627)
• Study describe diverse models of structural variations and affected genes in gastric cancer, of which we unveil a tandem-duplications hotspot involving the coding sequence and super-enhancer region of zinc finger protein 36 ring-finger protein-like 2 (ZFP36L2). (PMID:31048690)
• RNA-Binding Protein ZFP36L2 Downregulates Helios Expression and Suppresses the Function of Regulatory T Cells. (PMID:32655569)
• Silencing of ZFP36L2 increases sensitivity to temozolomide through G2/M cell cycle arrest and BAX mediated apoptosis in GBM cells. (PMID:33590411)
• Genomic evolution and diverse models of systemic metastases in colorectal cancer. (PMID:33632712)
• ZFP36 Family Members Regulate the Proinflammatory Features of Psoriatic Dermal Fibroblasts. (PMID:34333017)
• Biallelic variants in ZFP36L2 cause female infertility characterised by recurrent preimplantation embryo arrest. (PMID:34611029)
• A novel homozygous variant in ZFP36L2 cause female infertility due to oocyte maturation defect. (PMID:37211617)
• The RNA-Binding Proteins OAS1, ZFP36L2, and DHX58 Are Involved in the Regulation of CD44 mRNA Splicing in Colorectal Cancer Cells. (PMID:37336810)
• TREC mediated oncogenesis in human immature T lymphoid malignancies preferentially involves ZFP36L2. (PMID:37430263)
• Genetic association and functional validation of ZFP36L2 in non-syndromic orofacial cleft subtypes. (PMID:38321215)
• Variants in NLRP2 and ZFP36L2, non-core components of the human subcortical maternal complex, cause female infertility with embryonic development arrest. (PMID:39178021)

Cross-species orthologs

22 orthologs

Organism	Symbol	Gene ID
danio_rerio	zfp36l2	ENSDARG00000021806
mus_musculus	Zfp36l2	ENSMUSG00000045817
rattus_norvegicus	Zfp36l2	ENSRNOG00000005067
caenorhabditis_elegans		WBGENE00003230
caenorhabditis_elegans		WBGENE00003231
caenorhabditis_elegans		WBGENE00003388
caenorhabditis_elegans		WBGENE00003864
caenorhabditis_elegans		WBGENE00003865
caenorhabditis_elegans		WBGENE00004078
caenorhabditis_elegans		WBGENE00007961
caenorhabditis_elegans		WBGENE00009532
caenorhabditis_elegans		WBGENE00009537
caenorhabditis_elegans		WBGENE00009539
caenorhabditis_elegans	gla-3	WBGENE00011376
caenorhabditis_elegans		WBGENE00013319
caenorhabditis_elegans		WBGENE00013370
caenorhabditis_elegans		WBGENE00013794
caenorhabditis_elegans		WBGENE00013796
caenorhabditis_elegans		WBGENE00013797
caenorhabditis_elegans		WBGENE00017182
caenorhabditis_elegans		WBGENE00022438
caenorhabditis_elegans		WBGENE00022446

Paralogs (2): ZFP36 (ENSG00000128016), ZFP36L1 (ENSG00000185650)

Protein

Protein identifiers

mRNA decay activator protein ZFP36L2 — P47974 (reviewed: P47974)

Alternative names: Butyrate response factor 2, EGF-response factor 2, TPA-induced sequence 11d, Zinc finger protein 36, C3H1 type-like 2

All UniProt accessions (1): P47974

UniProt curated annotations — full annotation on UniProt →

Function. Zinc-finger RNA-binding protein that destabilizes several cytoplasmic AU-rich element (ARE)-containing mRNA transcripts by promoting their poly(A) tail removal or deadenylation, and hence provide a mechanism for attenuating protein synthesis. Acts as a 3’-untranslated region (UTR) ARE mRNA-binding adapter protein to communicate signaling events to the mRNA decay machinery. Functions by recruiting the CCR4-NOT deadenylase complex and probably other components of the cytoplasmic RNA decay machinery to the bound ARE-containing mRNAs, and hence promotes ARE-mediated mRNA deadenylation and decay processes. Binds to 3’-UTR ARE of numerous mRNAs. Promotes ARE-containing mRNA decay of the low-density lipoprotein (LDL) receptor (LDLR) mRNA in response to phorbol 12-myristate 13-acetate (PMA) treatment in a p38 MAPK-dependent manner. Positively regulates early adipogenesis by promoting ARE-mediated mRNA decay of immediate early genes (IEGs). Plays a role in mature peripheral neuron integrity by promoting ARE-containing mRNA decay of the transcriptional repressor REST mRNA. Plays a role in ovulation and oocyte meiotic maturation by promoting ARE-mediated mRNA decay of the luteinizing hormone receptor LHCGR mRNA. Acts as a negative regulator of erythroid cell differentiation: promotes glucocorticoid-induced self-renewal of erythroid cells by binding mRNAs that are induced or highly expressed during terminal erythroid differentiation and promotes their degradation, preventing erythroid cell differentiation. In association with ZFP36L1 maintains quiescence on developing B lymphocytes by promoting ARE-mediated decay of several mRNAs encoding cell cycle regulators that help B cells progress through the cell cycle, and hence ensuring accurate variable-diversity-joining (VDJ) recombination process and functional immune cell formation. Together with ZFP36L1 is also necessary for thymocyte development and prevention of T-cell acute lymphoblastic leukemia (T-ALL) transformation by promoting ARE-mediated mRNA decay of the oncogenic transcription factor NOTCH1 mRNA.

Subunit / interactions. Associates with the cytoplasmic CCR4-NOT deadenylase to trigger ARE-containing mRNA deadenylation and decay processes. Interacts with CNOT7; this interaction is inhibited in response to phorbol 12-myristate 13-acetate (PMA) treatment in a p38 MAPK-dependent manner. Interacts with CNOT6L.

Subcellular location. Nucleus. Cytoplasm.

Tissue specificity. Expressed mainly in the basal epidermal layer, weakly in the suprabasal epidermal layers. Expressed in epidermal keratinocytes (at protein level). Expressed in oocytes.

Post-translational modifications. Phosphorylated by RPS6KA1 at Ser-490 and Ser-492 upon phorbol 12-myristate 13-acetate (PMA) treatment; this phosphorylation results in dissociation of the CCR4-NOT-deadenylase complex and induces p38 MAPK-mediated stabilization of the low-density lipoprotein (LDL) receptor (LDLR) mRNA. Phosphorylation occurs during early preadipocyte differentiation.

Disease relevance. Oocyte/zygote/embryo maturation arrest 13 (OZEMA13) [MIM:620154] An autosomal recessive female infertility disorder characterized by embryonic development arrest and embryo implantation failure. The disease is caused by variants affecting the gene represented in this entry. A frameshift mutation disrupting ZFP36L2 have been found in a patient with acute myeloid leukemia, suggesting that defective ZFP36L2 might be involved in the pathogenesis of certain types of hematological cancers.

Induction. Up-regulated by butyrate in colorectal cancer cells. Up-regulated in keratinocytes after wounding. Up-regulated strongly by granulocyte macrophage colony-stimulating factor (GM-CSF) in keratinocytes. Up-regulated moderately by transforming growth factor (TGF-beta), epidermal growth factor (EGF), tumor necrosis factor (TNF) and fibroblast growth factor (FGF1) in keratinocytes. Up-regulated also by glucocorticoid dexamethasone in keratinocytes.

RefSeq proteins (1): NP_008818* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000571	Znf_CCCH	Domain
IPR007635	Tis11B_N	Domain
IPR036855	Znf_CCCH_sf	Homologous_superfamily
IPR045877	ZFP36-like	Family

Pfam: PF00642, PF04553

UniProt features (36 total): sequence conflict 6, modified residue 5, helix 5, region of interest 4, compositionally biased region 3, strand 3, zinc finger region 2, sequence variant 2, mutagenesis site 2, turn 2, chain 1, short sequence motif 1

Structure

Experimental structures (PDB)

3 structures.

PDB	Method	Resolution (Å)
1W0W	X-RAY DIFFRACTION	2.11
1W0V	X-RAY DIFFRACTION	2.27
1RGO	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P47974-F1	54.34	0.12

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (5): 57, 125, 238, 490, 492

Mutagenesis-validated functional residues (2):

Position	Phenotype
157	impaired mrna-binding; when associated with k-195.
195	impaired mrna-binding; when associated with r-157.

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-9820841	M-decay: degradation of maternal mRNAs by maternally stored factors

MSigDB gene sets: 712 (showing top): GOBP_REGULATION_OF_CELL_ACTIVATION, WILLIAMS_ESR1_TARGETS_DN, REACTOME_RNA_POLYMERASE_III_TRANSCRIPTION_INITIATION_FROM_TYPE_3_PROMOTER, GOBP_REGULATION_OF_FAT_CELL_DIFFERENTIATION, GOBP_SOMATIC_STEM_CELL_POPULATION_MAINTENANCE, AMIT_DELAYED_EARLY_GENES, GOBP_REGULATION_OF_MRNA_CATABOLIC_PROCESS, GOBP_RESPONSE_TO_PEPTIDE, GOBP_CELLULAR_RESPONSE_TO_LIPID, GOBP_B_CELL_ACTIVATION, GOBP_NEGATIVE_REGULATION_OF_FAT_CELL_DIFFERENTIATION, GOBP_RESPONSE_TO_CORTICOSTEROID, GOBP_NEGATIVE_REGULATION_OF_STEM_CELL_DIFFERENTIATION, KAAB_HEART_ATRIUM_VS_VENTRICLE_UP, ASTON_MAJOR_DEPRESSIVE_DISORDER_DN

GO Biological Process (23): nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288), mRNA catabolic process (GO:0006402), response to wounding (GO:0009611), hemopoiesis (GO:0030097), T cell differentiation in thymus (GO:0033077), somatic stem cell population maintenance (GO:0035019), regulation of mRNA stability (GO:0043488), cellular response to fibroblast growth factor stimulus (GO:0044344), regulation of B cell differentiation (GO:0045577), negative regulation of fat cell differentiation (GO:0045599), somatic stem cell division (GO:0048103), definitive hemopoiesis (GO:0060216), 3’-UTR-mediated mRNA destabilization (GO:0061158), ERK1 and ERK2 cascade (GO:0070371), cellular response to tumor necrosis factor (GO:0071356), cellular response to epidermal growth factor stimulus (GO:0071364), cellular response to glucocorticoid stimulus (GO:0071385), cellular response to transforming growth factor beta stimulus (GO:0071560), cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011), positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153), negative regulation of mitotic cell cycle phase transition (GO:1901991), negative regulation of stem cell differentiation (GO:2000737), MAPK cascade (GO:0000165)

GO Molecular Function (6): RNA binding (GO:0003723), zinc ion binding (GO:0008270), mRNA 3’-UTR AU-rich region binding (GO:0035925), mRNA binding (GO:0003729), protein binding (GO:0005515), metal ion binding (GO:0046872)

GO Cellular Component (3): nucleus (GO:0005634), cytoplasm (GO:0005737), ribonucleoprotein complex (GO:1990904)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Maternal to zygotic transition (MZT)	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular response to growth factor stimulus	3
mRNA destabilization	2
cellular response to cytokine stimulus	2
nuclear-transcribed mRNA catabolic process	1
RNA catabolic process	1
negative regulation of gene expression	1
mRNA metabolic process	1
response to stress	1
cell development	1
T cell differentiation	1
stem cell population maintenance	1
regulation of RNA stability	1
regulation of mRNA catabolic process	1
response to fibroblast growth factor	1
B cell differentiation	1
regulation of lymphocyte differentiation	1
regulation of B cell activation	1
fat cell differentiation	1
negative regulation of cell differentiation	1
regulation of fat cell differentiation	1
stem cell division	1
hemopoiesis	1
MAPK cascade	1
response to tumor necrosis factor	1
response to epidermal growth factor	1
response to glucocorticoid	1
cellular response to corticosteroid stimulus	1
response to transforming growth factor beta	1
response to granulocyte macrophage colony-stimulating factor	1
nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay	1
positive regulation of mRNA catabolic process	1
regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay	1
nucleic acid binding	1
transition metal ion binding	1
mRNA 3’-UTR binding	1
RNA binding	1
binding	1
cation binding	1
intracellular membrane-bounded organelle	1
intracellular anatomical structure	1

Protein interactions and networks

STRING

1836 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
ZFP36L2	GOLGA7	Q7Z5G4	918
ZFP36L2	ZDHHC9	Q9Y397	912
ZFP36L2	CNOT7	Q9UIV1	761
ZFP36L2	ZNF318	Q5VUA4	669
ZFP36L2	CNOT1	A5YKK6	668
ZFP36L2	CNOT6L	Q96LI5	620
ZFP36L2	BTG4	Q9NY30	615
ZFP36L2	CNOT8	Q9UFF9	576
ZFP36L2	LRRC9	Q6ZRR7	567
ZFP36L2	XPO1	O14980	489
ZFP36L2	ETF1	P46055	479
ZFP36L2	ELAVL1	Q15717	453
ZFP36L2	ZDHHC2	Q9UIJ5	447
ZFP36L2	HNRNPD	P07029	447
ZFP36L2	HBS1L	Q9Y450	447

IntAct

53 interactions, top by confidence:

A	B	Type	Score
YWHAH	ABLIM1	psi-mi:“MI:0914”(association)	0.800
HIF1AN	GMDS	psi-mi:“MI:0914”(association)	0.640
YWHAG	BLTP3B	psi-mi:“MI:0914”(association)	0.640
YWHAG	BLTP3B	psi-mi:“MI:2364”(proximity)	0.640
YWHAH	PLEKHG3	psi-mi:“MI:0914”(association)	0.610
YWHAB	BLTP3B	psi-mi:“MI:2364”(proximity)	0.610
YWHAB	BLTP3B	psi-mi:“MI:0914”(association)	0.610
ZFP36L2	YWHAE	psi-mi:“MI:0915”(physical association)	0.600
YWHAH	BLTP3B	psi-mi:“MI:0914”(association)	0.570
YWHAH	BLTP3B	psi-mi:“MI:2364”(proximity)	0.570
YWHAG	SHTN1	psi-mi:“MI:0914”(association)	0.560
YWHAZ	BLTP3B	psi-mi:“MI:0914”(association)	0.530
YWHAB	PLEKHG3	psi-mi:“MI:0914”(association)	0.480
YWHAQ	PLEKHG3	psi-mi:“MI:0914”(association)	0.480
SFN	ZFP36L2	psi-mi:“MI:0915”(physical association)	0.470
Akt2	ZFP36L2	psi-mi:“MI:0915”(physical association)	0.400
SMC6	IFT88	psi-mi:“MI:0914”(association)	0.350
GEMIN5	PFDN1	psi-mi:“MI:0914”(association)	0.350
Xpo1	IFT56	psi-mi:“MI:0914”(association)	0.350
ESR1	ESYT2	psi-mi:“MI:0914”(association)	0.350
CUL3	PXDNL	psi-mi:“MI:0914”(association)	0.350
YWHAB	PLEKHG3	psi-mi:“MI:0914”(association)	0.350
YWHAG	C1orf226	psi-mi:“MI:0914”(association)	0.350
YWHAZ	SPEG	psi-mi:“MI:0914”(association)	0.350
YWHAH	SHTN1	psi-mi:“MI:0914”(association)	0.350
YWHAE	DEPDC5	psi-mi:“MI:0914”(association)	0.350
YWHAG	BRAF	psi-mi:“MI:0914”(association)	0.350

BioGRID (243): ZFP36L2 (Affinity Capture-MS), ZFP36L2 (Affinity Capture-MS), ZFP36L2 (Affinity Capture-MS), ZFP36L2 (Affinity Capture-MS), ZFP36L2 (Affinity Capture-MS), CBY1 (Affinity Capture-MS), ZFP36L2 (Affinity Capture-MS), ZFP36L2 (Two-hybrid), ZFP36L2 (Affinity Capture-MS), ZYG11B (Affinity Capture-Western), AKR1C2 (Affinity Capture-MS), ARSK (Affinity Capture-MS), ATP2C1 (Affinity Capture-MS), ATP5B (Affinity Capture-MS), BANF1 (Affinity Capture-MS)

ESM2 similar proteins: A4IIN5, G1X9A9, O13023, O77459, P05527, P09145, P09775, P10035, P15370, P17431, P22809, P22816, P22893, P23949, P23950, P27609, P29775, P47974, P47980, P55879, P93755, Q01842, Q05192, Q07352, Q0VGT2, Q19291, Q1KKZ2, Q23359, Q26263, Q28D67, Q28HT3, Q4V5A3, Q5NDM2, Q6CQ07, Q6NR09, Q6P2Z3, Q7ZXW9, Q805B4, Q8I7Z8, Q8JIT5

Diamond homologs: A2ZVY5, A4IIN5, G5EC86, G5EF15, P17431, P22893, P23949, P23950, P26651, P47973, P47974, P47976, P47977, P47979, P47980, P53781, Q07352, Q10MN8, Q23359, Q5ISE2, Q5PP65, Q6L5G1, Q6S9E0, Q7ZXW9, Q805B4, Q84UQ3, Q9C7C3, Q9C9F5, Q9C9N3, Q9FG30, Q9LQM3, Q9LT81, Q9XV46, Q57W26, Q7F8R0, Q8L7S3, Q94131, Q69XQ3, Q7XPK1, Q5VR07

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 40 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Activation of BAD and translocation to mitochondria	7	177.6×	3e-13
Chk1/Chk2(Cds1) mediated inactivation of Cyclin B:Cdk1 complex	7	156.8×	4e-13
SARS-CoV-1 targets host intracellular signalling and regulatory pathways	7	156.8×	4e-13
Activation of BH3-only proteins	7	115.9×	4e-12
RHO GTPases activate PKNs	7	74.0×	1e-10
Intrinsic Pathway for Apoptosis	7	68.3×	2e-10
FOXO-mediated transcription	5	56.0×	3e-07
SARS-CoV-1-host interactions	7	41.0×	6e-09

GO biological processes:

GO term	Partners	Fold	FDR
protein targeting	5	53.9×	5e-06
intracellular protein localization	8	24.6×	3e-07

Disease & clinical

Clinical variants and AI predictions

ClinVar

142 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	1
Uncertain significance	118
Likely benign	11
Benign	4

Top pathogenic / likely-pathogenic (2)

Variant ID	HGVS	Classification
1802639	NM_006887.5(ZFP36L2):c.922T>G (p.Ser308Ala)	Pathogenic
1802638	NM_006887.5(ZFP36L2):c.922_930del (p.Ser308_Ser310del)	Likely pathogenic

SpliceAI

608 predictions. Top by Δscore:

Variant	Effect	Δscore
8:37845209:TGAAG:T	acceptor_gain	1.0000
8:37845210:GAAG:G	acceptor_gain	1.0000
8:37845211:AAGC:A	acceptor_loss	1.0000
8:37845212:AG:A	acceptor_gain	1.0000
8:37845213:GCTGA:G	acceptor_loss	1.0000
8:37845214:C:CC	acceptor_gain	1.0000
8:37846851:TAC:T	donor_loss	1.0000
8:37846852:A:AC	donor_gain	1.0000
8:37846853:C:CC	donor_gain	1.0000
8:37846853:C:CT	donor_loss	1.0000
8:37846853:CCTG:C	donor_gain	1.0000
8:37847046:T:TA	donor_gain	1.0000
8:37847174:ACCTA:A	acceptor_loss	1.0000
8:37847176:C:CA	acceptor_loss	1.0000
8:37847176:C:CC	acceptor_gain	1.0000
8:37847177:T:G	acceptor_loss	1.0000
8:37848592:TCACC:T	donor_loss	1.0000
8:37848593:CA:C	donor_loss	1.0000
8:37848595:C:CT	donor_loss	1.0000
8:37848656:C:CC	acceptor_gain	1.0000
8:37849625:AGTAC:A	donor_loss	1.0000
8:37849626:GTACC:G	donor_loss	1.0000
8:37849627:TACC:T	donor_loss	1.0000
8:37845211:AAG:A	acceptor_gain	0.9900
8:37845224:C:CT	acceptor_gain	0.9900
8:37845224:C:T	acceptor_gain	0.9900
8:37847050:T:TA	donor_gain	0.9900
8:37847172:AGAC:A	acceptor_gain	0.9900
8:37847173:GAC:G	acceptor_gain	0.9900
8:37847174:AC:A	acceptor_gain	0.9900

AlphaMissense

3175 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
2:43225156:G:C	H216Q	1.000
2:43225156:G:T	H216Q	1.000
2:43225157:T:A	H216L	1.000
2:43225157:T:C	H216R	1.000
2:43225158:G:A	H216Y	1.000
2:43225158:G:C	H216D	1.000
2:43225158:G:T	H216N	1.000
2:43225160:A:C	I215S	1.000
2:43225160:A:G	I215T	1.000
2:43225160:A:T	I215N	1.000
2:43225162:G:C	F214L	1.000
2:43225162:G:T	F214L	1.000
2:43225163:A:C	F214C	1.000
2:43225163:A:G	F214S	1.000
2:43225164:A:C	F214V	1.000
2:43225164:A:G	F214L	1.000
2:43225164:A:T	F214I	1.000
2:43225165:G:C	H213Q	1.000
2:43225165:G:T	H213Q	1.000
2:43225167:G:C	H213D	1.000
2:43225168:G:C	C212W	1.000
2:43225169:C:A	C212F	1.000
2:43225169:C:G	C212S	1.000
2:43225169:C:T	C212Y	1.000
2:43225170:A:C	C212G	1.000
2:43225170:A:G	C212R	1.000
2:43225170:A:T	C212S	1.000
2:43225172:C:A	R211L	1.000
2:43225172:C:T	R211H	1.000
2:43225173:G:A	R211C	1.000

dbSNP variants (sampled 300 via entrez): RS1000348230 (2:43224205 A>C,G), RS1000653563 (2:43224249 G>A,C,T), RS1000937047 (2:43227530 G>C), RS1001127236 (2:43226646 T>C), RS1001282627 (2:43227385 C>G,T), RS1001446210 (2:43227924 C>T), RS1002060403 (2:43224792 C>A,G,T), RS1002206320 (2:43224524 G>A), RS1002245169 (2:43224544 CCCGGCGGGGAGGGTCGCGCTGGGCGGCG>C), RS1002342417 (2:43224007 T>G), RS1002658830 (2:43221903 A>C), RS1002795423 (2:43227579 G>A), RS1002934517 (2:43226109 C>T), RS1003171078 (2:43222065 G>A), RS1003288643 (2:43226004 G>A,C)

Disease associations

OMIM: gene MIM:612053 | disease phenotypes: MIM:620154

GenCC curated gene-disease

Disease	Classification	Inheritance
oocyte maturation defect 13	Limited	Unknown

Mondo (2): prostate cancer (MONDO:0008315), oocyte maturation defect 13 (MONDO:0859330)

Orphanet (1): Familial prostate cancer (Orphanet:1331)

HPO phenotypes

9 total (9 of 9 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000147	Polycystic ovaries
HP:0008222	Female infertility
HP:0008669	Abnormal spermatogenesis
HP:0011462	Young adult onset
HP:0020155	Abnormal oocyte morphology
HP:0031515	Abnormal meiosis
HP:0031516	Metaphase I oocyte maturation arrest
HP:0033712	Repeated implantation failure

GWAS associations

40 associations (top):

Study	Trait	p-value
GCST000914_1	Polycystic ovary syndrome	2.000000e-23
GCST000914_5	Polycystic ovary syndrome	3.000000e-23
GCST002115_11	Axial length	3.000000e-06
GCST002726_33	Glucose homeostasis traits	5.000000e-07
GCST004131_59	Inflammatory bowel disease	6.000000e-09
GCST004132_60	Crohn’s disease	4.000000e-11
GCST004603_208	Platelet count	9.000000e-32
GCST004623_157	Neutrophil percentage of granulocytes	4.000000e-09
GCST004627_76	Lymphocyte count	2.000000e-25
GCST004632_128	Lymphocyte percentage of white cells	9.000000e-39
GCST004633_102	Neutrophil percentage of white cells	2.000000e-36
GCST004776_32	Systolic blood pressure	2.000000e-14
GCST004776_82	Systolic blood pressure	1.000000e-08
GCST005996_42	Red blood cell count	2.000000e-08
GCST006979_924	Heel bone mineral density	4.000000e-10
GCST007094_93	Diastolic blood pressure	2.000000e-13
GCST007098_123	Diastolic blood pressure	3.000000e-07
GCST007098_124	Diastolic blood pressure	1.000000e-06
GCST007099_250	Systolic blood pressure	9.000000e-09
GCST008058_152	Estimated glomerular filtration rate	2.000000e-14
GCST008059_43	Estimated glomerular filtration rate	7.000000e-14
GCST008363_26	Offspring birth weight	2.000000e-11
GCST008750_1	Diastolic blood pressure	4.000000e-07
GCST009391_754	Metabolite levels	5.000000e-06
GCST010697_19	Cortical surface area (min-P)	1.000000e-08
GCST010698_2	Subcortical volume (min-P)	4.000000e-08
GCST010699_4	Brain morphology (min-P)	4.000000e-11
GCST010700_31	Cortical thickness (MOSTest)	1.000000e-08
GCST010701_6	Cortical surface area (MOSTest)	2.000000e-08
GCST010702_67	Subcortical volume (MOSTest)	2.000000e-11

EFO canonical traits (19, from GWAS)

EFO ID	Trait name
EFO:0005318	axial length measurement
EFO:0004471	insulin sensitivity measurement
EFO:0004309	platelet count
EFO:0007994	neutrophil percentage of granulocytes
EFO:0004587	lymphocyte count
EFO:0007993	lymphocyte percentage of leukocytes
EFO:0007990	neutrophil percentage of leukocytes
EFO:0006335	systolic blood pressure
EFO:0004305	erythrocyte count
EFO:0009270	heel bone mineral density
EFO:0006336	diastolic blood pressure
EFO:0004344	birth weight
EFO:0005939	parental genotype effect measurement
EFO:0010390	sphingomyelin 14:0 measurement
EFO:0004346	neuroimaging measurement
EFO:0004840	cortical thickness
EFO:0007986	reticulocyte count
EFO:0004527	mean corpuscular hemoglobin
EFO:0007788	BMI-adjusted waist-hip ratio

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D011471	Prostatic Neoplasms	C04.588.945.440.770; C12.100.500.260.750; C12.100.500.565.625; C12.200.294.260.750; C12.200.294.565.625; C12.200.758.409.750; C12.900.619.750

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

72 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	increases expression, affects expression, decreases expression, affects cotreatment	6
trichostatin A	affects expression, decreases expression, affects cotreatment, increases expression	4
sodium arsenite	decreases expression	3
(+)-JQ1 compound	decreases expression	3
Cisplatin	affects response to substance, decreases expression, affects cotreatment, increases expression	3
Cadmium Chloride	decreases expression, increases abundance	3
Particulate Matter	increases abundance, increases expression, affects cotreatment, decreases expression	3
cobaltous chloride	decreases expression	2
epigallocatechin gallate	increases expression, affects cotreatment	2
Panobinostat	affects cotreatment, increases expression	2
Acetaminophen	decreases expression, increases expression	2
Air Pollutants	decreases expression, increases abundance, increases expression	2
Benzo(a)pyrene	decreases expression	2
Cadmium	increases expression, decreases expression, increases abundance	2
Dexamethasone	increases expression, affects cotreatment	2
Doxorubicin	affects response to substance, decreases response to substance	2
Estradiol	affects cotreatment, increases expression, decreases expression	2
Tetrachlorodibenzodioxin	affects expression, increases expression	2
Cyclosporine	decreases expression	2
3-((6-(2-methoxyphenyl)pyrimidin-4-yl)amino)phenyl)methane sulfonamide	decreases expression	1
FR900359	decreases phosphorylation	1
bisphenol F	affects cotreatment, increases expression	1
dicrotophos	increases expression	1
methylmercuric chloride	increases expression	1
triphenyl phosphate	affects expression	1
pirinixic acid	decreases expression, increases activity, affects binding	1
2-butenal	decreases expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
potassium chromate(VI)	affects cotreatment, increases expression	1
cupric chloride	increases expression	1

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00029224	PHASE4	COMPLETED	Treatment With Zoledronic Acid in Patients With Breast Cancer, Multiple Myeloma, and Prostate Cancer With Cancer Related Bone Lesions
NCT00035997	PHASE4	COMPLETED	Open-label Trial on the Effect of I.V. Zoledronic Acid 4 mg on Bone Density in Hormone Sensitive Prostate Cancer Patients With Bone Metastasis
NCT00063609	PHASE4	COMPLETED	The Effect of Zoledronic Acid on Bone Loss in Prostate Cancer Patients Undergoing Androgen Deprivation Therapy
NCT00103623	PHASE4	SUSPENDED	The Plenaxis® Experience Study
NCT00106392	PHASE4	COMPLETED	A Safety and Efficacy Study of Prograf in the Prevention of Erectile Dysfunction After Radical Prostatectomy
NCT00185029	PHASE4	UNKNOWN	MR-Lymphography and Lymph Node Staging in Prostate Cancer
NCT00199485	PHASE4	COMPLETED	Angelica Sinensis for the Treatment of Hot Flashes in Men Undergoing LHRH Therapy for Prostate Cancer
NCT00219219	PHASE4	COMPLETED	Zoledronic Acid in the Prevention of Skeletal-related Events in Hormone Refractory and Hormone-sensitive Prostate Cancer Patients With Bone Metastases
NCT00219271	PHASE4	COMPLETED	Effect Of Zoledronic Acid On Circulating And Bone Marrow-Residing Prostate Cancer Cells In Patients With Clinically Localized Prostate Cancer
NCT00237146	PHASE4	COMPLETED	Study to Evaluate Zoledronic Acid on Quality of Life and Skeletal-related Events as Adjuvant Treatment in Patients With Hormone-naïve Prostate Cancer and Bone Metastasis Who Have Undergone Orchiectomy
NCT00242554	PHASE4	COMPLETED	Open-label Phase IV Clinical Trial to Evaluate the Safety and Tolerability of Zoledronic Acid in Patients With Prostate Cancer and Bone Metastases
NCT00280098	PHASE4	COMPLETED	Docetaxel in the Treatment of Hormone Refractory Prostate Cancer
NCT00293696	PHASE4	COMPLETED	Casodex/Zoladex Biomarkers in Localised Prostate Cancer
NCT00334139	PHASE4	COMPLETED	Effect of Zoledronic Acid on Bone Metabolism in Patients With Bone Metastasis and Prostate or Breast Cancer
NCT00375765	PHASE4	COMPLETED	Effects On Dihydrotestosterone Regulated Gene Expression In Benign Prostatic Hyperplasia Or Prostate Cancer
NCT00391690	PHASE4	COMPLETED	Evaluation of Bone Markers as Diagnostic Tools for Early Detection of Bone Metastases in Patients With High Risk Prostate Cancer
NCT00422708	PHASE4	COMPLETED	Local Anesthesia for Prostate Biopsy
NCT00526331	PHASE4	COMPLETED	Evaluation of Arterial Pressure Based Cardiac Output for Goal-Directed Perioperative Therapy
NCT00590213	PHASE4	COMPLETED	Compare the Value of Prophylactic Versus Therapeutic Breast Radiotherapy in CASODEX
NCT00629330	PHASE4	TERMINATED	Dissemination of Prostate Cancer Screening to PCP’s in African American Communities
NCT00771966	PHASE4	COMPLETED	Radical Prostatectomy and Perioperative Fluid Therapy
NCT00805701	PHASE4	COMPLETED	Study Assessing The Efficacy And Safety Of Avodart (Dutasteride) At Improving Urinary Symptoms In Men With Prostate Cancer Who Are Undergoing Seed Implantation
NCT00859027	PHASE4	COMPLETED	Effect Of Risedronate On Bone Mass In Older Men Receiving Neoadjuvant Therapy For Prostate Cancer
NCT00906269	PHASE4	UNKNOWN	Can Hyperbaric Oxygen Improve Erectile Function Following Surgery for Prostate Cancer
NCT00953277	PHASE4	COMPLETED	Study of Nerve Reconstruction Using AVANCE in Subjects Who Undergo Robotic Assisted Prostatectomy for Treatment of Prostate Cancer
NCT00982800	PHASE4	COMPLETED	Does Postoperative Gabapentin Reduce Pain, Opioid Consumption and Anxiety and Have a Positive Effect on Health Related Quality of Life After Radical Prostatectomy?
NCT01083199	PHASE4	COMPLETED	Global Performance Evaluation of the AMS CONTINUUM™ Device
NCT01136226	PHASE4	COMPLETED	Evaluate Recovery of Testosterone for Patients Using Eligard
NCT01161563	PHASE4	COMPLETED	Randomized Crossover Trial to Assess the Tolerability of Gonadotropin Releasing Hormone (GnRH) Analogue Administration
NCT01230905	PHASE4	COMPLETED	Study to Monitor the Effects of Androgen Suppression Treatment on the Heart
NCT01296672	PHASE4	COMPLETED	3 Month Finasteride Challenge Test Can Significantly Improve the Performance of Screening for Prostate Cancer
NCT01365143	PHASE4	TERMINATED	Prospective Randomized Trial Comparing Robotic Versus Open Radical Prostatectomy
NCT01379742	PHASE4	UNKNOWN	Comparison of Between ThinSeed™ and OncoSeed™ for Permanent Prostate Brachytherapy
NCT01486563	PHASE4	COMPLETED	Hydroxyethyl Starch and Renal Function After Radical Prostatectomy
NCT01511874	PHASE4	COMPLETED	Efficacy and Safety Study of ELIGARD 22.5mg With Prostate Cancer
NCT01512472	PHASE4	TERMINATED	Firmagon (Degarelix) Intermittent Therapy
NCT01547416	PHASE4	COMPLETED	The Effect of Combined General/Epidural Anesthesia Versus General Anesthesia on Diaphragmatic Function
NCT01571544	PHASE4	COMPLETED	The Use of Thermal Suits as Preventing Hypothermia During Surgery
NCT01581749	PHASE4	UNKNOWN	Evaluation of Truebeam for Low-Intermediate Risk Prostate Cancer
NCT01649635	PHASE4	COMPLETED	Study of Cabazitaxel Combined With Prednisone and Prophylaxis of Neutropenia Complications in the Treatment of Patients With Metastatic Castration-resistant Prostate Cancer