ZNF579

Summary

ZNF579 (zinc finger protein 579, HGNC:26646) is a protein-coding gene on chromosome 19q13.42, encoding Zinc finger protein 579 (Q8NAF0). May be involved in transcriptional regulation.

Enables DNA-binding transcription factor activity, RNA polymerase II-specific and transcription cis-regulatory region binding activity. Involved in regulation of transcription by RNA polymerase II. Predicted to be located in nucleus.

Source: NCBI Gene 163033 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 83 total
• MANE Select transcript: NM_152600

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:26646
Approved symbol	ZNF579
Name	zinc finger protein 579
Location	19q13.42
Locus type	gene with protein product
Status	Approved
Aliases	FLJ35453
Ensembl gene	ENSG00000218891
Ensembl biotype	protein_coding
Entrez	163033

Gene structure

Transcript identifiers

Ensembl transcripts: 4 — 4 protein_coding

ENST00000325421, ENST00000592239, ENST00000856087, ENST00000926355

RefSeq mRNA: 1 — MANE Select: NM_152600 NM_152600

CCDS: CCDS12927

Canonical transcript exons

ENST00000325421 — 2 exons

Exon	Start	End
ENSE00001247861	55576774	55579641
ENSE00002962890	55580795	55580848

Expression profiles

Bgee: expression breadth ubiquitous, 240 present calls, max score 92.39.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 12.4357 / max 71.6348, expressed in 1765 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
182845	10.5049	1747
182846	1.9308	1224

Top tissues by expression

253 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
left ventricle myocardium	UBERON:0006566	92.39	gold quality
upper arm skin	UBERON:0004263	92.11	silver quality
right hemisphere of cerebellum	UBERON:0014890	91.07	gold quality
cerebellar hemisphere	UBERON:0002245	90.62	gold quality
cerebellar cortex	UBERON:0002129	90.56	gold quality
hindlimb stylopod muscle	UBERON:0004252	90.56	gold quality
cerebellum	UBERON:0002037	89.89	gold quality
gastrocnemius	UBERON:0001388	89.59	gold quality
body of stomach	UBERON:0001161	89.09	gold quality
metanephros cortex	UBERON:0010533	88.18	gold quality
muscle of leg	UBERON:0001383	87.99	gold quality
cerebellar vermis	UBERON:0004720	87.82	gold quality
apex of heart	UBERON:0002098	87.42	gold quality
right lobe of thyroid gland	UBERON:0001119	86.92	gold quality
left lobe of thyroid gland	UBERON:0001120	86.67	gold quality
kidney epithelium	UBERON:0004819	86.66	silver quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	86.52	gold quality
epithelial cell of pancreas	CL:0000083	86.14	silver quality
right uterine tube	UBERON:0001302	86.03	gold quality
fundus of stomach	UBERON:0001160	85.31	gold quality
stomach	UBERON:0000945	85.29	gold quality
quadriceps femoris	UBERON:0001377	85.22	silver quality
body of pancreas	UBERON:0001150	85.15	gold quality
tibialis anterior	UBERON:0001385	85.12	silver quality
metanephros	UBERON:0000081	85.07	gold quality
thyroid gland	UBERON:0002046	85.07	gold quality
muscle tissue	UBERON:0002385	84.75	gold quality
skeletal muscle tissue	UBERON:0001134	84.34	gold quality
vastus lateralis	UBERON:0001379	83.89	silver quality
heart left ventricle	UBERON:0002084	83.38	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	2.36

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

47 targeting ZNF579, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6798-5P	100.00	65.77	699
HSA-MIR-513A-5P	100.00	69.77	2465
HSA-MIR-6870-5P	99.99	68.55	2115
HSA-MIR-27A-3P	99.98	72.13	2955
HSA-MIR-27B-3P	99.98	72.13	2955
HSA-MIR-9985	99.98	72.11	2939
HSA-MIR-4723-5P	99.97	68.70	2034
HSA-MIR-5698	99.97	68.49	2029
HSA-MIR-7111-5P	99.97	68.48	2062
HSA-MIR-6825-5P	99.96	69.81	3431
HSA-MIR-23A-3P	99.95	74.24	3163
HSA-MIR-23B-3P	99.95	74.24	3163
HSA-MIR-23C	99.95	73.92	3192
HSA-MIR-7845-5P	99.88	64.88	771
HSA-MIR-6756-5P	99.82	67.97	2466
HSA-MIR-1825	99.72	68.11	1089
HSA-MIR-548AU-3P	99.70	68.22	1373
HSA-MIR-6766-5P	99.68	67.70	2325
HSA-MIR-12123	99.52	71.79	2990
HSA-MIR-199A-5P	99.51	69.71	1107
HSA-MIR-199B-5P	99.51	69.74	1098
HSA-MIR-3128	99.50	67.85	1258
HSA-MIR-1324	99.46	66.57	1302
HSA-MIR-584-3P	99.35	67.69	1082
HSA-MIR-7854-3P	99.08	66.26	1117
HSA-MIR-6868-5P	99.06	65.69	1284
HSA-MIR-3190-5P	98.87	64.89	1345
HSA-MIR-6769B-5P	98.73	64.91	1092
HSA-MIR-198	98.70	67.32	920
HSA-MIR-3179	98.22	65.90	1445

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Zfp579	ENSMUSG00000051550
rattus_norvegicus	Zfp579	ENSRNOG00000016608

Paralogs (4): PRDM5 (ENSG00000138738), ZNF668 (ENSG00000167394), ZNF358 (ENSG00000198816), ZNF850 (ENSG00000267041)

Protein

Protein identifiers

Zinc finger protein 579 — Q8NAF0 (reviewed: Q8NAF0)

All UniProt accessions (2): Q8NAF0, K7EJF4

UniProt curated annotations — full annotation on UniProt →

Function. May be involved in transcriptional regulation.

Subcellular location. Nucleus.

Similarity. Belongs to the krueppel C2H2-type zinc-finger protein family.

RefSeq proteins (1): NP_689813* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR013087	Znf_C2H2_type	Domain
IPR036236	Znf_C2H2_sf	Homologous_superfamily

Pfam: PF00096

UniProt features (24 total): zinc finger region 8, compositionally biased region 5, region of interest 4, modified residue 4, chain 1, sequence variant 1, sequence conflict 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8NAF0-F1	62.14	0.00

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (4): 92, 194, 196, 483

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 90 (showing top): GGGTGGRR_PAX4_03, ATGCTGG_MIR338, NRSF_01, THUM_SYSTOLIC_HEART_FAILURE_DN, GOMF_SEQUENCE_SPECIFIC_DNA_BINDING, ACACTGG_MIR199A_MIR199B, CACBINDINGPROTEIN_Q6, GOBERT_OLIGODENDROCYTE_DIFFERENTIATION_DN, FOSTER_KDM1A_TARGETS_DN, ZWANG_TRANSIENTLY_UP_BY_2ND_EGF_PULSE_ONLY, BREDEMEYER_RAG_SIGNALING_VIA_ATM_NOT_VIA_NFKB_UP, GOMF_TRANSCRIPTION_REGULATOR_ACTIVITY, ALKBH3_TARGET_GENES, F10_TARGET_GENES, GLI4_TARGET_GENES

GO Biological Process (1): regulation of transcription by RNA polymerase II (GO:0006357)

GO Molecular Function (7): transcription cis-regulatory region binding (GO:0000976), DNA-binding transcription factor activity, RNA polymerase II-specific (GO:0000981), RNA binding (GO:0003723), zinc ion binding (GO:0008270), DNA binding (GO:0003677), protein binding (GO:0005515), metal ion binding (GO:0046872)

GO Cellular Component (1): nucleus (GO:0005634)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
nucleic acid binding	2
regulation of DNA-templated transcription	1
transcription by RNA polymerase II	1
transcription regulatory region nucleic acid binding	1
sequence-specific double-stranded DNA binding	1
chromatin	1
RNA polymerase II transcription regulatory region sequence-specific DNA binding	1
DNA-binding transcription factor activity	1
regulation of transcription by RNA polymerase II	1
transition metal ion binding	1
binding	1
cation binding	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

492 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
ZNF579	ISOC2	Q96AB3	564
ZNF579	NAT14	Q8WUY8	562
ZNF579	PPP6R1	Q9UPN7	504
ZNF579	ZNF212	Q9UDV6	464
ZNF579	TSC22D2	O75157	398
ZNF579	RDH13	Q8NBN7	398
ZNF579	ECHDC3	Q96DC8	374
ZNF579	PPP1R12C	Q9BZL4	364
ZNF579	PRPF40B	Q6NWY9	350
ZNF579	UBE2L5	A0A1B0GUS4	336
ZNF579	SLU7	O95391	329
ZNF579	DUSP16	Q9BY84	325
ZNF579	ANKRD12	Q6UB98	324
ZNF579	C6orf15	Q6UXA7	313
ZNF579	MAGEB2	O15479	307

IntAct

90 interactions, top by confidence:

A	B	Type	Score
OSM	IL6ST	psi-mi:“MI:0914”(association)	0.760
LBR	MAD2L1BP	psi-mi:“MI:0914”(association)	0.730
NEUROG3	GXYLT2	psi-mi:“MI:0914”(association)	0.640
P4HA3	FAM171A2	psi-mi:“MI:0914”(association)	0.640
GET3	GET1	psi-mi:“MI:0914”(association)	0.640
CHCHD10	CLPX	psi-mi:“MI:0914”(association)	0.640
LBR	ZNF579	psi-mi:“MI:0915”(physical association)	0.560
tat	PPM1G	psi-mi:“MI:0914”(association)	0.560
ZNF707	ZNF316	psi-mi:“MI:0914”(association)	0.530
ODAPH	TCAF2	psi-mi:“MI:0914”(association)	0.530
E4F1	ZBTB24	psi-mi:“MI:0914”(association)	0.530
MRPS15	MRPS14	psi-mi:“MI:0914”(association)	0.530
BHLHA15	RPLP0	psi-mi:“MI:0914”(association)	0.530
TNFRSF13B	TNFRSF10B	psi-mi:“MI:0914”(association)	0.530
CLEC3A	ZZEF1	psi-mi:“MI:0914”(association)	0.530
MRPS15	PRKACG	psi-mi:“MI:0914”(association)	0.530
GTF3C2	C1QBP	psi-mi:“MI:0914”(association)	0.530
GNLY	YPEL5	psi-mi:“MI:0914”(association)	0.530
NOTCH2	ZNF316	psi-mi:“MI:0914”(association)	0.530
ZNF579		psi-mi:“MI:0915”(physical association)	0.500
ZNF579	KCNB1	psi-mi:“MI:0915”(physical association)	0.400

BioGRID (93): ZNF579 (Affinity Capture-MS), ZNF579 (Affinity Capture-MS), ZNF579 (Affinity Capture-MS), ZNF579 (Affinity Capture-MS), ZNF579 (Affinity Capture-MS), ZNF579 (Affinity Capture-MS), ZNF579 (Affinity Capture-MS), ZNF579 (Affinity Capture-MS), ZNF579 (Affinity Capture-MS), ZNF579 (Affinity Capture-MS), ZNF579 (Affinity Capture-MS), ZNF579 (Affinity Capture-MS), ZNF579 (Affinity Capture-MS), ZNF579 (Affinity Capture-MS), ZNF579 (Affinity Capture-MS)

ESM2 similar proteins: A2CE44, A6NFI3, A6NM28, A8K8V0, O15370, O70218, O95201, P0CJ78, P10075, P10754, P28698, P70338, Q04890, Q07120, Q14V87, Q19A40, Q569E7, Q58DK7, Q5DWN0, Q5FWU5, Q5RJR4, Q5T619, Q5TEC3, Q6DD87, Q6IQX8, Q6PD29, Q6PGE4, Q6ZMY9, Q7Z7K2, Q80VM4, Q8BIF9, Q8JZL0, Q8N8E2, Q8NAF0, Q8NCA9, Q8TD94, Q8WUU4, Q96C55, Q96H86, Q96MX3

Diamond homologs: A0A1V6NWD3, A2ANX9, O60315, P28166, P36197, P39956, P52739, P52740, P53243, P54785, P56270, P56670, P56671, P80944, Q03833, Q14119, Q29419, Q5NBY9, Q5RAU9, Q5U2T6, Q60542, Q62947, Q64318, Q65XX7, Q6IQX8, Q7TSH3, Q80VM4, Q8NAF0, Q92618, Q99PV8, Q9C0K0, Q9H165, Q9HBE1, Q9P2Y4, Q9QYE0, Q9QYE3, Q9R0G7, Q9VAB8, Q9Y462, B1H2Q6

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 104 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Peptide chain elongation	5	10.4×	7e-03
Viral mRNA Translation	5	10.4×	7e-03
PELO:HBS1L and ABCE1 dissociate a ribosome on a non-stop mRNA	5	10.3×	7e-03
Selenocysteine synthesis	5	9.8×	7e-03
Eukaryotic Translation Termination	5	9.8×	7e-03
Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC)	5	9.7×	7e-03
ZNF598 and the Ribosome-associated Quality Trigger (RQT) complex dissociate a ribosome stalled on a no-go mRNA	5	9.7×	7e-03
Formation of a pool of free 40S subunits	5	9.2×	7e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

83 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	80
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

132 predictions. Top by Δscore:

Variant	Effect	Δscore
19:55580789:TCTTA:T	donor_loss	0.9800
19:55580790:CTTA:C	donor_loss	0.9800
19:55580791:TTAC:T	donor_loss	0.9800
19:55580792:TACC:T	donor_loss	0.9800
19:55579639:TGCCT:T	acceptor_loss	0.9700
19:55579640:GCCTG:G	acceptor_loss	0.9700
19:55579642:CT:C	acceptor_loss	0.9700
19:55579643:T:A	acceptor_loss	0.9700
19:55579637:CATGC:C	acceptor_gain	0.9600
19:55580793:A:AC	donor_gain	0.9600
19:55580794:C:CC	donor_gain	0.9600
19:55579639:TGC:T	acceptor_gain	0.9500
19:55579642:C:CC	acceptor_gain	0.9500
19:55580794:CCT:C	donor_gain	0.9500
19:55580747:AGC:A	donor_gain	0.9300
19:55580794:CCTCG:C	donor_gain	0.9200
19:55577889:C:A	donor_gain	0.9100
19:55579638:ATGC:A	acceptor_gain	0.9000
19:55579640:GC:G	acceptor_gain	0.8900
19:55579641:CC:C	acceptor_gain	0.8900
19:55577995:C:CT	donor_gain	0.8700
19:55577996:T:TT	donor_gain	0.8700
19:55579644:G:GC	acceptor_gain	0.8500
19:55580650:T:TA	donor_gain	0.8500
19:55578114:T:TA	donor_gain	0.8400
19:55577888:T:TA	donor_gain	0.8300
19:55577992:TGTC:T	donor_gain	0.8300
19:55579644:G:C	acceptor_gain	0.8300
19:55578003:T:TA	donor_gain	0.7800
19:55580692:C:CA	donor_gain	0.7800

AlphaMissense

3557 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
19:55578803:G:C	F279L	1.000
19:55578803:G:T	F279L	1.000
19:55578805:A:G	F279L	1.000
19:55578263:G:C	H459Q	0.999
19:55578263:G:T	H459Q	0.999
19:55578265:G:C	H459D	0.999
19:55578265:G:T	H459N	0.999
19:55578290:G:C	F450L	0.999
19:55578290:G:T	F450L	0.999
19:55578291:A:G	F450S	0.999
19:55578292:A:G	F450L	0.999
19:55578313:A:G	C443R	0.999
19:55578377:G:C	F421L	0.999
19:55578377:G:T	F421L	0.999
19:55578378:A:G	F421S	0.999
19:55578379:A:G	F421L	0.999
19:55578404:G:C	F412L	0.999
19:55578404:G:T	F412L	0.999
19:55578406:A:G	F412L	0.999
19:55578461:G:C	F393L	0.999
19:55578461:G:T	F393L	0.999
19:55578462:A:G	F393S	0.999
19:55578463:A:G	F393L	0.999
19:55578720:A:G	F307S	0.999
19:55578742:A:G	C300R	0.999
19:55578804:A:G	F279S	0.999
19:55578815:G:C	C275W	0.999
19:55578816:C:T	C275Y	0.999
19:55578817:A:G	C275R	0.999
19:55578826:A:G	C272R	0.999

dbSNP variants (sampled 300 via entrez): RS1000081718 (19:55577817 G>A,T), RS1000979222 (19:55577820 C>A,T), RS1001259065 (19:55577074 C>G,T), RS1001607024 (19:55577296 A>G), RS1002330322 (19:55579186 C>G,T), RS1002643592 (19:55582088 G>C), RS1002858055 (19:55578884 G>T), RS1003601511 (19:55580933 C>T), RS1004099923 (19:55582739 A>C), RS1004102674 (19:55580786 G>A), RS1004152437 (19:55582435 T>C), RS1004668026 (19:55579785 A>G), RS1004730897 (19:55579540 TGCCACGGCCACGGCCCCGACCACGGCCTCG>T), RS1005154595 (19:55581003 G>A,C), RS1005193161 (19:55576403 A>G)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST002127_7	Periodontitis (Mean PAL)	5.000000e-06

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

27 total (human), top 27 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	increases methylation, affects cotreatment, decreases expression, affects expression	4
aristolochic acid I	increases expression	1
TAK-243	decreases sumoylation	1
sodium arsenite	increases expression	1
butyraldehyde	decreases expression	1
coumarin	increases phosphorylation	1
di-n-butylphosphoric acid	affects expression	1
CGP 52608	affects binding, increases reaction	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
abrine	increases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid	decreases expression	1
Resveratrol	affects cotreatment, decreases expression	1
Vorinostat	decreases expression	1
Arsenic	affects expression	1
Caffeine	decreases phosphorylation	1
Diazinon	increases methylation	1
Lead	affects methylation	1
Plant Extracts	affects cotreatment, decreases expression	1
Testosterone	decreases expression	1
Thiram	increases expression	1
Triclosan	increases expression	1
Urethane	decreases expression	1
Cyclosporine	increases expression	1
Aflatoxin B1	decreases expression	1
Cadmium Chloride	increases expression	1
Copper Sulfate	increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.