ZNF593OS

Summary

ZNF593OS (ZNF593 opposite strand, HGNC:41278) is a protein-coding gene on chromosome 1p36.11, encoding Transmembrane protein ZNF593OS (A0A0U1RRA0).

Predicted to be located in membrane.

Source: NCBI Gene 118568799 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 2 total
• MANE Select transcript: NM_001395468

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:41278
Approved symbol	ZNF593OS
Name	ZNF593 opposite strand
Location	1p36.11
Locus type	gene with protein product
Status	Approved
Aliases	ZNF593-AS
Ensembl gene	ENSG00000236782
Ensembl biotype	protein_coding
Entrez	118568799

Gene structure

Transcript identifiers

Ensembl transcripts: 8 — 5 protein_coding, 2 protein_coding_CDS_not_defined, 1 nonsense_mediated_decay

ENST00000407889, ENST00000414762, ENST00000433939, ENST00000444682, ENST00000448923, ENST00000648649, ENST00000952116, ENST00000952117

RefSeq mRNA: 1 — MANE Select: NM_001395468 NM_001395468

CCDS: CCDS90890

Canonical transcript exons

ENST00000433939 — 4 exons

Exon	Start	End
ENSE00001676178	26171156	26171335
ENSE00001801655	26171617	26171689
ENSE00003978293	26169521	26170598
ENSE00003978294	26171770	26171832

Expression profiles

Bgee: expression breadth ubiquitous, 129 present calls, max score 80.83.

Top tissues by expression

132 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	80.83	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	80.00	gold quality
gastrocnemius	UBERON:0001388	73.79	gold quality
muscle of leg	UBERON:0001383	72.03	gold quality
hindlimb stylopod muscle	UBERON:0004252	70.27	gold quality
cerebellum	UBERON:0002037	68.54	gold quality
cerebellar cortex	UBERON:0002129	68.45	gold quality
right hemisphere of cerebellum	UBERON:0014890	68.40	gold quality
cerebellar hemisphere	UBERON:0002245	68.37	gold quality
bone marrow cell	CL:0002092	68.22	gold quality
skeletal muscle tissue	UBERON:0001134	67.73	gold quality
prefrontal cortex	UBERON:0000451	67.19	gold quality
left uterine tube	UBERON:0001303	65.88	gold quality
left ovary	UBERON:0002119	64.56	gold quality
primary visual cortex	UBERON:0002436	64.52	gold quality
ovary	UBERON:0000992	64.51	gold quality
muscle tissue	UBERON:0002385	64.10	gold quality
frontal cortex	UBERON:0001870	64.09	gold quality
stromal cell of endometrium	CL:0002255	63.40	gold quality
superior frontal gyrus	UBERON:0002661	63.33	gold quality
bone marrow	UBERON:0002371	63.16	gold quality
right ovary	UBERON:0002118	62.34	gold quality
placenta	UBERON:0001987	62.26	gold quality
cortical plate	UBERON:0005343	62.12	gold quality
body of uterus	UBERON:0009853	61.63	gold quality
ganglionic eminence	UBERON:0004023	61.16	gold quality
cerebral cortex	UBERON:0000956	60.27	gold quality
hypothalamus	UBERON:0001898	59.75	gold quality
brain	UBERON:0000955	59.65	gold quality
fallopian tube	UBERON:0003889	59.56	gold quality

Single-cell (SCXA)

Detected in 6 experiment(s), a significant marker in 5.

Experiment	Marker?	Max mean expression
E-MTAB-7316	yes	809.29
E-MTAB-9543	yes	29.37
E-CURD-112	yes	9.42
E-GEOD-137537	yes	4.51
E-ANND-3	yes	4.33
E-MTAB-11121	no	510.71

Regulation

Is transcription factor: no

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Zfp593os	ENSMUSG00000086322
rattus_norvegicus	Zfp593os	ENSRNOG00000078201

Protein

Protein identifiers

Transmembrane protein ZNF593OS — A0A0U1RRA0 (reviewed: A0A0U1RRA0)

Alternative names: ZNF593 opposite strand protein

All UniProt accessions (1): A0A0U1RRA0

UniProt curated annotations — full annotation on UniProt →

Subcellular location. Membrane.

RefSeq proteins (1): NP_001382397* (*=MANE)

Domains & families (InterPro)

UniProt features (2 total): chain 1, transmembrane region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-A0A0U1RRA0-F1	71.02	0.20

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 3 (showing top): chr1p36, PBXIP1_TARGET_GENES, DESCARTES_FETAL_CEREBRUM_VASCULAR_ENDOTHELIAL_CELLS

GO Biological Process (0):

GO Molecular Function (0):

GO Cellular Component (1): membrane (GO:0016020)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	1

Protein interactions and networks

STRING

0 interactions, top by confidence (×1000):

IntAct

0 interactions, top by confidence:

ESM2 similar proteins: A0A0U1RRA0, A0T0A9, A2C0D1, A2CCQ0, A2CCQ1, A5GQF4, A5GWI2, B0C6T2, B2JA13, B8HTR1, D5AP83, E9Q9R3, O10337, P04123, P0C420, P0C421, P0C422, P0CZ12, P0DJZ4, P13293, P35089, P35090, P35091, P35098, P35099, P35101, P35104, P35105, P51769, P52587, P80107, P80587, P80654, Q00644, Q0IDJ7, Q10XU6, Q20F20, Q2JS34, Q2KS19, Q32RU4

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

2 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	0
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

659 predictions. Top by Δscore:

Variant	Effect	Δscore
1:26170180:GCGC:G	donor_gain	1.0000
1:26170182:GC:G	donor_gain	1.0000
1:26170184:G:GG	donor_gain	1.0000
1:26170416:A:AG	acceptor_gain	1.0000
1:26170416:AG:A	acceptor_gain	1.0000
1:26170417:G:GG	acceptor_gain	1.0000
1:26170417:GG:G	acceptor_gain	1.0000
1:26170417:GGA:G	acceptor_gain	1.0000
1:26170481:G:GA	donor_loss	1.0000
1:26170488:GGA:G	donor_gain	1.0000
1:26170489:GAG:G	donor_gain	1.0000
1:26170573:A:AG	acceptor_gain	1.0000
1:26170574:G:GG	acceptor_gain	1.0000
1:26170574:GGCT:G	acceptor_gain	1.0000
1:26171612:CTTA:C	donor_loss	1.0000
1:26171613:TTA:T	donor_loss	1.0000
1:26171614:TACCT:T	donor_loss	1.0000
1:26171615:A:AC	donor_gain	1.0000
1:26171615:AC:A	donor_gain	1.0000
1:26171616:C:CT	donor_gain	1.0000
1:26171616:CC:C	donor_gain	1.0000
1:26170099:G:T	donor_gain	0.9900
1:26170181:CGCG:C	donor_loss	0.9900
1:26170183:CG:C	donor_loss	0.9900
1:26170184:G:A	donor_loss	0.9900
1:26170185:TGA:T	donor_loss	0.9900
1:26170186:G:GC	donor_loss	0.9900
1:26170187:A:AC	donor_loss	0.9900
1:26170188:G:C	donor_loss	0.9900
1:26170194:G:GT	donor_gain	0.9900

AlphaMissense

377 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
1:26171257:C:G	G42R	0.948
1:26171265:G:T	A39D	0.942
1:26171256:C:T	G42D	0.936
1:26171251:C:G	G44R	0.926
1:26171621:A:G	L14S	0.922
1:26171262:A:T	V40D	0.905
1:26171250:C:T	G44D	0.899
1:26171277:G:T	A35D	0.864
1:26171242:A:G	C47R	0.856
1:26171629:G:C	F11L	0.853
1:26171629:G:T	F11L	0.853
1:26171631:A:G	F11L	0.853
1:26171253:A:C	L43R	0.848
1:26171232:A:T	V50D	0.847
1:26171634:A:G	Y10H	0.844
1:26171248:C:G	G45R	0.841
1:26171253:A:G	L43P	0.826
1:26171244:G:T	S46Y	0.822
1:26171268:A:C	L38R	0.821
1:26171645:A:G	L6S	0.804
1:26171259:A:T	L41H	0.799
1:26171247:C:T	G45D	0.797
1:26171630:A:G	F11S	0.794
1:26171642:G:A	T7I	0.790
1:26171333:C:A	M16I	0.788
1:26171333:C:G	M16I	0.788
1:26171333:C:T	M16I	0.788
1:26171253:A:T	L43Q	0.786
1:26171259:A:C	L41R	0.777
1:26171266:C:G	A39P	0.772

dbSNP variants (sampled 300 via entrez): RS1000438754 (1:26169162 A>G), RS1000753732 (1:26171442 C>A,T), RS1000958525 (1:26173404 A>G), RS1002736995 (1:26172007 T>TCAGGAGTCCCAGGCCTGGACCAGG), RS1003442049 (1:26170564 C>G), RS1003667885 (1:26173063 G>A,T), RS1003702382 (1:26173279 A>G), RS1005264087 (1:26169280 G>A), RS1005788142 (1:26169589 C>T), RS1006110141 (1:26172640 CACTTA>C), RS1007137972 (1:26172121 T>C), RS1007523236 (1:26171419 G>A), RS1008137840 (1:26170992 C>T), RS1008168906 (1:26171192 C>A,G,T), RS1008198633 (1:26171399 G>A,C)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.