ZNF620

Summary

ZNF620 (zinc finger protein 620, HGNC:28742) is a protein-coding gene on chromosome 3p22.1, encoding Zinc finger protein 620 (Q6ZNG0). May be involved in transcriptional regulation.

Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II transcription regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to be active in nucleus.

Source: NCBI Gene 253639 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 45 total
• MANE Select transcript: NM_175888

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:28742
Approved symbol	ZNF620
Name	zinc finger protein 620
Location	3p22.1
Locus type	gene with protein product
Status	Approved
Aliases	MGC50836
Ensembl gene	ENSG00000177842
Ensembl biotype	protein_coding
Entrez	253639

Gene structure

Transcript identifiers

Ensembl transcripts: 7 — 5 protein_coding, 2 nonsense_mediated_decay

ENST00000314529, ENST00000418905, ENST00000420891, ENST00000433723, ENST00000649142, ENST00000904716, ENST00000947739

RefSeq mRNA: 3 — MANE Select: NM_175888 NM_001256167, NM_001256168, NM_175888

CCDS: CCDS33740, CCDS58825

Canonical transcript exons

ENST00000314529 — 5 exons

Exon	Start	End
ENSE00001252770	40506039	40506138
ENSE00001498489	40512402	40512515
ENSE00001718596	40515860	40518736
ENSE00003580018	40506304	40506376
ENSE00003679435	40511470	40511596

Expression profiles

Bgee: expression breadth ubiquitous, 135 present calls, max score 80.65.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 5.5788 / max 82.5033, expressed in 1655 samples.

FANTOM5 promoters (4 alternative TSS)

Promoter ID	TPM avg	Samples expressed
36183	5.5788	1655
36186	2.3645	770
36184	1.3994	709
36185	0.0923	30

Top tissues by expression

135 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	80.65	gold quality
adrenal tissue	UBERON:0018303	77.15	gold quality
islet of Langerhans	UBERON:0000006	76.67	gold quality
ganglionic eminence	UBERON:0004023	76.13	gold quality
ventricular zone	UBERON:0003053	75.94	gold quality
cortical plate	UBERON:0005343	75.63	gold quality
pancreas	UBERON:0001264	72.29	gold quality
skeletal muscle tissue	UBERON:0001134	72.02	gold quality
colonic epithelium	UBERON:0000397	70.91	gold quality
muscle tissue	UBERON:0002385	70.43	gold quality
body of pancreas	UBERON:0001150	70.32	gold quality
placenta	UBERON:0001987	70.24	gold quality
popliteal artery	UBERON:0002250	69.95	gold quality
tibial artery	UBERON:0007610	69.92	gold quality
corpus callosum	UBERON:0002336	69.70	gold quality
calcaneal tendon	UBERON:0003701	69.67	gold quality
bone marrow	UBERON:0002371	69.45	gold quality
cerebellum	UBERON:0002037	69.06	gold quality
cerebellar cortex	UBERON:0002129	68.95	gold quality
cerebellar hemisphere	UBERON:0002245	68.89	gold quality
mucosa of stomach	UBERON:0001199	68.85	gold quality
rectum	UBERON:0001052	68.60	gold quality
descending thoracic aorta	UBERON:0002345	68.45	gold quality
endometrium	UBERON:0001295	68.28	gold quality
bone marrow cell	CL:0002092	68.27	silver quality
smooth muscle tissue	UBERON:0001135	68.19	gold quality
kidney	UBERON:0002113	67.94	gold quality
muscle of leg	UBERON:0001383	67.81	gold quality
thoracic aorta	UBERON:0001515	67.71	gold quality
hindlimb stylopod muscle	UBERON:0004252	67.66	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	4.37

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

53 targeting ZNF620, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6873-3P	100.00	71.42	2626
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-7110-3P	100.00	73.18	2486
HSA-MIR-8068	99.98	73.85	2376
HSA-MIR-433-3P	99.98	69.37	1203
HSA-MIR-2110	99.96	66.68	1930
HSA-MIR-1250-3P	99.96	70.04	4038
HSA-MIR-548AJ-3P	99.96	73.38	5345
HSA-MIR-548X-3P	99.96	73.38	5345
HSA-MIR-6778-3P	99.96	67.29	2693
HSA-MIR-548J-3P	99.94	72.61	4881
HSA-MIR-548AE-3P	99.93	72.66	4867
HSA-MIR-548AH-3P	99.93	72.54	4872
HSA-MIR-548AM-3P	99.93	72.54	4872
HSA-MIR-548AQ-3P	99.93	72.66	4867
HSA-MIR-153-5P	99.89	73.86	6317
HSA-MIR-5582-3P	99.86	72.48	4221
HSA-MIR-5010-3P	99.83	70.60	2357
HSA-MIR-580-3P	99.67	69.23	1841
HSA-MIR-452-5P	99.65	69.63	1762
HSA-MIR-4676-3P	99.65	69.31	1733
HSA-MIR-892C-3P	99.65	69.38	1745
HSA-MIR-325	99.58	66.55	358
HSA-MIR-3942-3P	99.57	69.03	2854
HSA-MIR-3120-3P	99.54	70.28	2669
HSA-MIR-6722-3P	99.45	67.62	1919
HSA-MIR-4762-3P	99.43	69.72	2363
HSA-MIR-942-5P	99.41	68.40	1977
HSA-MIR-1276	99.36	68.18	1642
HSA-MIR-4311	99.31	70.47	3041

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
drosophila_melanogaster	CG2712	FBGN0024975
drosophila_melanogaster	Phs	FBGN0036522
drosophila_melanogaster	CG3281	FBGN0260741

Paralogs (62): ZNF582 (ENSG00000018869), ZNF264 (ENSG00000083844), ZNF343 (ENSG00000088876), ZNF684 (ENSG00000117010), ZNF133 (ENSG00000125846), ZNF557 (ENSG00000130544), ZNF337 (ENSG00000130684), ZNF20 (ENSG00000132010), ZFP37 (ENSG00000136866), ZNF614 (ENSG00000142556), KRBOX4 (ENSG00000147121), ZNF599 (ENSG00000153896), ZNF19 (ENSG00000157429), ZNF589 (ENSG00000164048), PRDM9 (ENSG00000164256), ZNF180 (ENSG00000167384), ZNF558 (ENSG00000167785), ZNF35 (ENSG00000169981), ZNF778 (ENSG00000170100), ZNF439 (ENSG00000171291), ZNF440 (ENSG00000171295), ZNF556 (ENSG00000172000), ZNF554 (ENSG00000172006), ZNF596 (ENSG00000172748), ZNF80 (ENSG00000174255), ZNF266 (ENSG00000174652), ZNF25 (ENSG00000175395), ZNF77 (ENSG00000175691), ZNF169 (ENSG00000175787), ZNF404 (ENSG00000176222), ZNF491 (ENSG00000177599), ZNF619 (ENSG00000177873), ZNF875 (ENSG00000181666), ZNF329 (ENSG00000181894), ZFP90 (ENSG00000184939), ZNF566 (ENSG00000186017), ZNF529 (ENSG00000186020), ZNF749 (ENSG00000186230), ZNF555 (ENSG00000186300), ZNF70 (ENSG00000187792)

Protein

Protein identifiers

Zinc finger protein 620 — Q6ZNG0 (reviewed: Q6ZNG0)

All UniProt accessions (4): A0A3B3IU22, C9J967, Q6ZNG0, F8WC31

UniProt curated annotations — full annotation on UniProt →

Function. May be involved in transcriptional regulation.

Subcellular location. Nucleus.

Similarity. Belongs to the krueppel C2H2-type zinc-finger protein family.

Isoforms (2)

UniProt ID	Names	Canonical?
Q6ZNG0-1	1	yes
Q6ZNG0-2	2

RefSeq proteins (3): NP_001243096, NP_001243097, NP_787084* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001909	KRAB	Domain
IPR013087	Znf_C2H2_type	Domain
IPR036051	KRAB_dom_sf	Homologous_superfamily
IPR036236	Znf_C2H2_sf	Homologous_superfamily

Pfam: PF00096, PF01352, PF13465

UniProt features (11 total): zinc finger region 8, chain 1, domain 1, splice variant 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q6ZNG0-F1	67.36	0.18

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-212436	Generic Transcription Pathway

MSigDB gene sets: 32 (showing top): chr3p22, GOMF_SEQUENCE_SPECIFIC_DNA_BINDING, GOMF_TRANSCRIPTION_REGULATOR_ACTIVITY, ZNF37A_TARGET_GENES, ZNF423_TARGET_GENES, MIR5582_3P, MIR8068, MIR4311, MIR3120_3P, MIR3942_3P, MIR580_3P, MIR942_5P, MIR2110, GSE13485_CTRL_VS_DAY1_YF17D_VACCINE_PBMC_UP, GSE13485_CTRL_VS_DAY7_YF17D_VACCINE_PBMC_UP

GO Biological Process (2): regulation of transcription by RNA polymerase II (GO:0006357), regulation of DNA-templated transcription (GO:0006355)

GO Molecular Function (6): RNA polymerase II transcription regulatory region sequence-specific DNA binding (GO:0000977), DNA-binding transcription factor activity, RNA polymerase II-specific (GO:0000981), zinc ion binding (GO:0008270), DNA binding (GO:0003677), protein binding (GO:0005515), metal ion binding (GO:0046872)

GO Cellular Component (1): nucleus (GO:0005634)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
RNA Polymerase II Transcription	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
regulation of DNA-templated transcription	1
transcription by RNA polymerase II	1
DNA-templated transcription	1
regulation of gene expression	1
regulation of RNA biosynthetic process	1
transcription cis-regulatory region binding	1
chromatin	1
RNA polymerase II transcription regulatory region sequence-specific DNA binding	1
DNA-binding transcription factor activity	1
regulation of transcription by RNA polymerase II	1
transition metal ion binding	1
nucleic acid binding	1
binding	1
cation binding	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

248 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
ZNF620	ANKRD31	Q8N7Z5	478
ZNF620	AGAP6	Q5VW22	474
ZNF620	MGRN1	O60291	370
ZNF620	LNPK	Q9C0E8	324
ZNF620	GRAMD1A	Q96CP6	323
ZNF620	NOC3L	Q8WTT2	308
ZNF620	RALGPS1	Q5JS13	299
ZNF620	GPATCH2	Q9NW75	289
ZNF620	USP43	Q70EL4	279
ZNF620	PPHLN1	Q8NEY8	277
ZNF620	CHRNA5	P30532	259
ZNF620	ZNF395	Q9H8N7	253
ZNF620	ERGIC3	Q9Y282	252
ZNF620	GPR27	Q9NS67	250
ZNF620	BTBD9	Q96Q07	247

IntAct

225 interactions, top by confidence:

A	B	Type	Score
MYOZ3	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
ZIC1	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
TRAF4	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
DGCR6L	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
EEF2KMT	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
FHL2	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
NOXA1	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
PIBF1	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
TPM2	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
EIF4A2	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
CARD9	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
TENT5B	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
BOLA2-SMG1P6	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
USP20	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
CDKN2D	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
CCDC6	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
CIB3	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
RUSC1	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
SART3	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
OAZ3	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
CLIC3	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
MFAP1	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
CTNNA3	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
C1orf216	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
PLOD3	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
IGFN1	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
METTL21A	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
TRIM10	ZNF620	psi-mi:“MI:0915”(physical association)	0.560
GAS8	ZNF620	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (87): ZNF620 (Affinity Capture-MS), ZNF620 (Affinity Capture-MS), ZNF620 (Two-hybrid), ZNF620 (Two-hybrid), ZNF620 (Two-hybrid), ZNF620 (Two-hybrid), ZNF620 (Two-hybrid), ZNF620 (Two-hybrid), ZNF620 (Two-hybrid), ZNF620 (Two-hybrid), ZNF620 (Two-hybrid), ZNF620 (Two-hybrid), ZNF620 (Two-hybrid), ZNF620 (Two-hybrid), ZNF620 (Two-hybrid)

ESM2 similar proteins: A1L1L7, A3KN36, D3ZVT0, O43296, P08042, P13682, P16373, P17023, P17097, P52738, P85977, Q02975, Q12901, Q14590, Q14592, Q2M3W8, Q2VY69, Q4V8A8, Q571J5, Q5CZA5, Q5R7I8, Q5RB33, Q5RBX0, Q61751, Q61967, Q6GQR8, Q6PF04, Q6ZNG0, Q6ZS27, Q86Y25, Q8BFS8, Q8BQC8, Q8IZ26, Q8N782, Q8N9Z0, Q8R1D1, Q8TF47, Q8WTR7, Q96LW1, Q9BS31

Diamond homologs: A1L1L7, A3KN32, A3KN36, A6NFI3, A6NM28, A6NN14, A6QLU5, A7MBI1, A8K8V0, A8MTY0, A8MWA4, B4DU55, C9JBD0, G3X9G7, O60765, O75290, O94892, O95780, P0C7X2, P10072, P15622, P16373, P16374, P17023, P17032, P17097, P17098, P21506, P52742, P59923, Q06730, Q08DG8, Q16587, Q29RZ4, Q2TL60, Q3V080, Q49AA0, Q4R6C2, Q4V8A8, Q5FWF6

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

45 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	36
Likely benign	2
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1765 predictions. Top by Δscore:

Variant	Effect	Δscore
3:40506302:A:AG	acceptor_gain	1.0000
3:40506303:G:GA	acceptor_gain	1.0000
3:40506374:CAGG:C	donor_loss	1.0000
3:40477180:GGT:G	donor_gain	0.9900
3:40477331:G:GT	donor_gain	0.9900
3:40482015:GT:G	donor_gain	0.9900
3:40482017:G:GG	donor_gain	0.9900
3:40482586:A:AG	acceptor_gain	0.9900
3:40482587:G:GG	acceptor_gain	0.9900
3:40482587:GC:G	acceptor_gain	0.9900
3:40482587:GCA:G	acceptor_gain	0.9900
3:40482587:GCAGC:G	acceptor_gain	0.9900
3:40506303:GT:G	acceptor_gain	0.9900
3:40506303:GTTT:G	acceptor_gain	0.9900
3:40506303:GTTTC:G	acceptor_gain	0.9900
3:40506372:GCCAG:G	donor_gain	0.9900
3:40506377:GTGA:G	donor_gain	0.9900
3:40510013:G:GT	acceptor_gain	0.9900
3:40515854:T:TA	acceptor_gain	0.9900
3:40515857:TA:T	acceptor_loss	0.9900
3:40515858:A:AG	acceptor_gain	0.9900
3:40515858:AG:A	acceptor_gain	0.9900
3:40515858:AGG:A	acceptor_gain	0.9900
3:40515859:G:GC	acceptor_loss	0.9900
3:40515859:G:GG	acceptor_gain	0.9900
3:40515859:GG:G	acceptor_gain	0.9900
3:40515859:GGG:G	acceptor_gain	0.9900
3:40477222:G:GT	donor_gain	0.9800
3:40477368:G:T	donor_gain	0.9800
3:40478829:T:TA	acceptor_gain	0.9800

AlphaMissense

2807 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
3:40516711:T:C	F373L	0.993
3:40516713:C:A	F373L	0.993
3:40516713:C:G	F373L	0.993
3:40516745:G:C	R384P	0.986
3:40516459:T:C	F289L	0.985
3:40516461:C:A	F289L	0.985
3:40516461:C:G	F289L	0.985
3:40516795:T:C	F401L	0.982
3:40516797:C:A	F401L	0.982
3:40516797:C:G	F401L	0.982
3:40516661:G:C	R356P	0.980
3:40511494:G:C	A17P	0.978
3:40516742:A:C	Q383P	0.977
3:40516740:C:A	H382Q	0.976
3:40516740:C:G	H382Q	0.976
3:40516543:T:C	F317L	0.975
3:40516545:C:A	F317L	0.975
3:40516545:C:G	F317L	0.975
3:40516406:A:C	Q271P	0.973
3:40516738:C:G	H382D	0.972
3:40516752:C:A	H386Q	0.971
3:40516752:C:G	H386Q	0.971
3:40511551:T:G	Y36D	0.970
3:40516684:T:C	F364L	0.970
3:40516686:T:A	F364L	0.970
3:40516686:T:G	F364L	0.970
3:40516316:G:C	R241P	0.969
3:40516658:A:C	Q355P	0.969
3:40511518:T:A	W25R	0.967
3:40511518:T:C	W25R	0.967

dbSNP variants (sampled 300 via entrez): RS1000013528 (3:40504501 T>C), RS1000125293 (3:40511883 T>C), RS1000590552 (3:40516411 A>G), RS1000665546 (3:40517887 C>A,T), RS1000749434 (3:40513637 CCAAGGCAAGAGACTGAGGGCA>C), RS1000944025 (3:40518983 A>C), RS1000975099 (3:40518518 C>T), RS1001646916 (3:40515117 T>C), RS1001851761 (3:40509918 A>C,G), RS1001947756 (3:40517078 G>A,T), RS1002407644 (3:40512245 G>A), RS1002514229 (3:40506628 T>A,G), RS1002913947 (3:40508520 C>T), RS1003066343 (3:40513830 G>A), RS1003117966 (3:40507097 T>G)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST005232_29	Neuroticism	2.000000e-08

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0007660	neuroticism measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

17 total (human), top 17 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	decreases expression, increases methylation	2
Tetrachlorodibenzodioxin	decreases expression	2
Cyclosporine	decreases expression	2
GSK-J4	decreases expression	1
triphenyl phosphate	affects expression	1
benzo(e)pyrene	increases methylation	1
ferrous chloride	decreases expression	1
di-n-butylphosphoric acid	affects expression	1
abrine	increases expression	1
Sunitinib	increases expression	1
Dimethyl Sulfoxide	increases expression	1
Estradiol	affects cotreatment, decreases expression	1
Methapyrilene	increases methylation	1
Tobacco Smoke Pollution	decreases expression	1
Tretinoin	decreases expression	1
Urethane	decreases expression	1
Cadmium Chloride	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.