ZNF652

Summary

ZNF652 (zinc finger protein 652, HGNC:29147) is a protein-coding gene on chromosome 17q21.32, encoding Zinc finger protein 652 (Q9Y2D9). DNA-binding transcription repressor that acts together with CBFA2T2 to repress expression of target genes, such as TCF12.

Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to be active in nucleus.

Source: NCBI Gene 22834 — RefSeq curated summary.

At a glance

• GWAS associations: 60
• Clinical variants (ClinVar): 87 total
• MANE Select transcript: NM_001145365

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:29147
Approved symbol	ZNF652
Name	zinc finger protein 652
Location	17q21.32
Locus type	gene with protein product
Status	Approved
Aliases	KIAA0924
Ensembl gene	ENSG00000198740
Ensembl biotype	protein_coding
OMIM	613907
Entrez	22834

Gene structure

Transcript identifiers

Ensembl transcripts: 16 — 14 protein_coding, 1 nonsense_mediated_decay, 1 protein_coding_CDS_not_defined

ENST00000362063, ENST00000430262, ENST00000508237, ENST00000513488, ENST00000899840, ENST00000899841, ENST00000899842, ENST00000899843, ENST00000899844, ENST00000923162, ENST00000923163, ENST00000949717, ENST00000949718, ENST00000949719, ENST00000949720, ENST00000949721

RefSeq mRNA: 2 — MANE Select: NM_001145365 NM_001145365, NM_014897

CCDS: CCDS32677

Canonical transcript exons

ENST00000430262 — 6 exons

Exon	Start	End
ENSE00000736266	49312698	49312845
ENSE00001137248	49316826	49317983
ENSE00001600373	49361909	49362250
ENSE00001623620	49311312	49311456
ENSE00001770080	49311927	49312042
ENSE00001792354	49289206	49298924

Expression profiles

Bgee: expression breadth ubiquitous, 284 present calls, max score 96.10.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 16.2833 / max 238.1247, expressed in 1758 samples.

FANTOM5 promoters (5 alternative TSS)

Promoter ID	TPM avg	Samples expressed
166800	9.9192	1650
166801	5.3931	1507
166799	0.8314	527
166797	0.1180	36
166798	0.0216	5

Top tissues by expression

295 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
medial globus pallidus	UBERON:0002477	96.10	gold quality
globus pallidus	UBERON:0001875	95.35	gold quality
inferior vagus X ganglion	UBERON:0005363	94.29	gold quality
nipple	UBERON:0002030	94.09	gold quality
cardia of stomach	UBERON:0001162	92.70	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	92.32	gold quality
subthalamic nucleus	UBERON:0001906	92.11	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	91.96	gold quality
pylorus	UBERON:0001166	91.87	gold quality
skin of hip	UBERON:0001554	91.76	gold quality
ventral tegmental area	UBERON:0002691	91.73	gold quality
upper leg skin	UBERON:0004262	91.73	gold quality
superior vestibular nucleus	UBERON:0007227	91.66	gold quality
spinal cord	UBERON:0002240	91.27	gold quality
adult organism	UBERON:0007023	91.21	gold quality
superior surface of tongue	UBERON:0007371	91.04	gold quality
muscle layer of sigmoid colon	UBERON:0035805	90.73	gold quality
penis	UBERON:0000989	90.60	gold quality
saphenous vein	UBERON:0007318	90.58	gold quality
cranial nerve II	UBERON:0000941	90.25	gold quality
renal medulla	UBERON:0000362	90.24	gold quality
pigmented layer of retina	UBERON:0001782	90.20	gold quality
mucosa of paranasal sinus	UBERON:0005030	89.95	gold quality
medulla oblongata	UBERON:0001896	89.91	gold quality
pons	UBERON:0000988	89.86	gold quality
fundus of stomach	UBERON:0001160	89.71	gold quality
lateral globus pallidus	UBERON:0002476	89.56	gold quality
skin of leg	UBERON:0001511	89.51	gold quality
parotid gland	UBERON:0001831	89.38	gold quality
seminal vesicle	UBERON:0000998	89.33	gold quality

Single-cell (SCXA)

Detected in 3 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-MTAB-6379	no	562.74
E-MTAB-6142	no	60.93
E-ANND-3	no	8.10

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

1 targets.

Target	Regulation
TCF12

JASPAR motifs

Motif	Name	Family
MA1657.1	ZNF652	More than 3 adjacent zinc fingers
MA1657.2	ZNF652	More than 3 adjacent zinc fingers

JASPAR matrix evidence (PMIDs): PMID:23332764

Upstream regulators (CollecTRI, top): CBFA2T3

miRNA regulators (miRDB)

413 targeting ZNF652, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-340-5P	100.00	72.50	4437
HSA-MIR-4510	100.00	66.60	2050
HSA-MIR-5692B	100.00	71.32	2622
HSA-MIR-5692C	100.00	71.32	2622
HSA-MIR-200B-3P	100.00	73.31	2693
HSA-MIR-200C-3P	100.00	73.35	2685
HSA-MIR-429	100.00	73.44	2698
HSA-MIR-6127	100.00	66.76	2188
HSA-MIR-6129	100.00	66.46	2080
HSA-MIR-6130	100.00	66.69	2012
HSA-MIR-6133	100.00	66.48	2064
HSA-MIR-518D-5P	100.00	67.51	979
HSA-MIR-518F-5P	100.00	67.51	979
HSA-MIR-520C-5P	100.00	67.51	979
HSA-MIR-526A-5P	100.00	67.51	979
HSA-MIR-4668-3P	100.00	68.74	2635
HSA-MIR-6758-5P	100.00	66.21	1470
HSA-MIR-6833-3P	100.00	70.63	3197
HSA-MIR-6856-5P	100.00	65.47	1298
HSA-MIR-4768-5P	100.00	69.49	2861

Literature-anchored findings (GeneRIF, showing 7)

• CBFA2T3 interacts with ZNF652 to repress HEB expression, and in addition CBFA2T3 interacts with the HEB protein to inhibit its activator function. (PMID:18456661)
• High levels of expression of both the androgen receptor and ZNF652 in clinically organ-defined prostate cancer are associated with a statistically increased risk of relapse (PMID:20204290)
• variation in FGF5 and ZNF652 gene upstream regions with altered susceptibility to hypertension in Han Chinese (PMID:20542020)
• De novo motif scanning of the ZNF652 binding sites identified a novel ZNF652 recognition motif that closely resembles the previously characterised in vitro binding site, being a 10 nucleotide core of that 13 nucleotide sequence. (PMID:21678463)
• Genetic association studies identify a novel variant in ZNF652 gene suggesting its role in prostate cancer. (PMID:25335771)
• Circular RNA circVRK1 suppresses the proliferation, migration and invasion of osteosarcoma cells by regulating zinc finger protein ZNF652 expression via microRNA miR-337-3p. (PMID:34424826)
• ZNF652-Induced circRHOT1 Promotes SMAD5 Expression to Modulate Tumorigenic Properties and Nature Killer Cell-Mediated Toxicity in Bladder Cancer via Targeting miR-3666. (PMID:34926705)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	znf652	ENSDARG00000062302
mus_musculus	Zfp652	ENSMUSG00000075595
rattus_norvegicus	Zfp652	ENSRNOG00000017001
drosophila_melanogaster	dwg	FBGN0000520
drosophila_melanogaster	CG6654	FBGN0038301
caenorhabditis_elegans		WBGENE00003933

Paralogs (6): ZNF324 (ENSG00000083812), ZBTB47 (ENSG00000114853), GTF3A (ENSG00000122034), ZUP1 (ENSG00000153975), ZNF513 (ENSG00000163795), ZNF324B (ENSG00000249471)

Protein

Protein identifiers

Zinc finger protein 652 — Q9Y2D9 (reviewed: Q9Y2D9)

All UniProt accessions (2): Q9Y2D9, D6RF85

UniProt curated annotations — full annotation on UniProt →

Function. DNA-binding transcription repressor that acts together with CBFA2T2 to repress expression of target genes, such as TCF12. Specifically binds the DNA consensus sequence 5’-CGAAAGGGTTAAT-3'.

Subunit / interactions. Interacts with CBFA2T3. Interacts with TCF12; inhibiting TCF12 transcription factor activity. Interacts with Zincore complex components QRICH1 and SEPHS1; probably stabilizing ZNF652 at DNA-binding sites across the genome.

Subcellular location. Nucleus.

Tissue specificity. Widely expressed with higher expression in breast, prostate, vulva and pancreas.

Similarity. Belongs to the krueppel C2H2-type zinc-finger protein family.

RefSeq proteins (2): NP_001138837, NP_055712 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR013087	Znf_C2H2_type	Domain
IPR036236	Znf_C2H2_sf	Homologous_superfamily

Pfam: PF00096

UniProt features (24 total): zinc finger region 9, compositionally biased region 6, modified residue 5, region of interest 3, chain 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9Y2D9-F1	56.60	0.00

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (5): 57, 100, 103, 197, 204

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 228 (showing top): WANG_RECURRENT_LIVER_CANCER_UP, PATIL_LIVER_CANCER, HUTTMANN_B_CLL_POOR_SURVIVAL_DN, SMID_BREAST_CANCER_LUMINAL_B_UP, TCCAGAG_MIR518C, CCAGGGG_MIR331, NIKOLSKY_BREAST_CANCER_17Q21_Q25_AMPLICON, AGCATTA_MIR155, RODRIGUES_THYROID_CARCINOMA_POORLY_DIFFERENTIATED_DN, LAIHO_COLORECTAL_CANCER_SERRATED_DN, CAGCTTT_MIR320, KRIGE_RESPONSE_TO_TOSEDOSTAT_24HR_UP, GEORGES_TARGETS_OF_MIR192_AND_MIR215, GCACTTT_MIR175P_MIR20A_MIR106A_MIR106B_MIR20B_MIR519D, MODULE_456

GO Biological Process (2): negative regulation of transcription by RNA polymerase II (GO:0000122), regulation of transcription by RNA polymerase II (GO:0006357)

GO Molecular Function (6): DNA-binding transcription factor activity, RNA polymerase II-specific (GO:0000981), DNA-binding transcription repressor activity, RNA polymerase II-specific (GO:0001227), DNA binding (GO:0003677), zinc ion binding (GO:0008270), protein binding (GO:0005515), metal ion binding (GO:0046872)

GO Cellular Component (1): nucleus (GO:0005634)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
regulation of transcription by RNA polymerase II	2
transcription by RNA polymerase II	2
RNA polymerase II transcription regulatory region sequence-specific DNA binding	2
negative regulation of DNA-templated transcription	1
regulation of DNA-templated transcription	1
chromatin	1
DNA-binding transcription factor activity	1
negative regulation of transcription by RNA polymerase II	1
DNA-binding transcription factor activity, RNA polymerase II-specific	1
DNA-binding transcription repressor activity	1
nucleic acid binding	1
transition metal ion binding	1
binding	1
cation binding	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

896 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
ZNF652	CBFA2T3	O75081	758
ZNF652	CABCOCO1	Q8IVU9	668
ZNF652	GUCD1	Q96NT3	603
ZNF652	PLCD3	Q8N3E9	576
ZNF652	PLEKHA7	Q6IQ23	447
ZNF652	ULK4	Q96C45	417
ZNF652	OR4K15	Q8NH41	403
ZNF652	SH2B3	Q9UQQ2	403
ZNF652	NUDT11	Q96G61	380
ZNF652	ATP2B1	P20020	374
ZNF652	JAG1	P78504	373
ZNF652	ULK3	Q6PHR2	370
ZNF652	CDC7	O00311	368
ZNF652	SATL1	Q86VE3	362
ZNF652	MAD2L1	Q13257	360

IntAct

9 interactions, top by confidence:

A	B	Type	Score
CBFA2T3	ZNF652	psi-mi:“MI:0915”(physical association)	0.510
ZNF652	RUNX1T1	psi-mi:“MI:0915”(physical association)	0.400
ZNF652	CBFA2T2	psi-mi:“MI:0915”(physical association)	0.400
ZNF652	PDIA4	psi-mi:“MI:0915”(physical association)	0.400
ESR1	ESYT2	psi-mi:“MI:0914”(association)	0.350
AFG2B	MMP24OS	psi-mi:“MI:0914”(association)	0.350
ZNF652	FOS	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (7): ZNF652 (Two-hybrid), ZNF652 (Affinity Capture-MS), ZNF652 (Affinity Capture-MS), ZNF652 (Proximity Label-MS), ZNF652 (Affinity Capture-MS), ZNF652 (Proximity Label-MS), ZNF652 (Affinity Capture-MS)

ESM2 similar proteins: A0JPB4, A1L1J6, A4IFJ6, D3ZUU2, E9Q8T2, G5E8B9, O08954, O15060, O42409, O43623, O57415, O70237, O75626, O95625, P19382, P25932, P36197, P37275, P97469, Q20082, Q2EI20, Q3MHQ4, Q3UH06, Q4VBD9, Q5DU09, Q5R9W9, Q5SVQ8, Q5T0B9, Q5ZLR2, Q60542, Q60636, Q62947, Q64318, Q6DCW1, Q6GNP2, Q6INV8, Q6NRM0, Q7TS63, Q7ZVR6, Q80X44

Diamond homologs: A1L1J6, Q5DU09, Q6GNP2, Q6INV8, Q8BI66, Q8TF50, Q9UFB7, Q9Y2D9, A0JC51, A2ANX9, A6QR00, A7Y7X5, D3ZUU2, O60315, O95863, P28166, P36197, P39956, Q02026, Q02027, Q02085, Q03833, Q22678, Q29RK0, Q4R8S8, Q4VBD9, Q504L7, Q569E7, Q5R4P8, Q5TEC3, Q60542, Q62947, Q642B2, Q64318, Q6GL52, Q6ZN55, Q8BY46, Q99LH4, Q99M85, Q9BWW7

SIGNOR signaling

2 interactions.

A	Effect	B	Mechanism
CBFA2T3	“down-regulates activity”	ZNF652	binding
CBFA2T3/ZNF651	“down-regulates quantity by repression”	ZNF652	“transcriptional regulation”

Disease & clinical

Clinical variants and AI predictions

ClinVar

87 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	75
Likely benign	1
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1715 predictions. Top by Δscore:

Variant	Effect	Δscore
17:49298922:CTC:C	acceptor_gain	1.0000
17:49298925:C:CC	acceptor_gain	1.0000
17:49311308:TTAC:T	donor_loss	1.0000
17:49311309:TA:T	donor_loss	1.0000
17:49311310:A:AC	donor_gain	1.0000
17:49311310:A:AT	donor_loss	1.0000
17:49311311:C:CC	donor_gain	1.0000
17:49311452:CAGTT:C	acceptor_gain	1.0000
17:49312691:AACTT:A	donor_loss	1.0000
17:49312692:ACTTA:A	donor_loss	1.0000
17:49312693:CTTA:C	donor_loss	1.0000
17:49312694:TTACC:T	donor_loss	1.0000
17:49312695:TA:T	donor_loss	1.0000
17:49312696:A:AC	donor_gain	1.0000
17:49312696:A:T	donor_loss	1.0000
17:49312696:AC:A	donor_gain	1.0000
17:49312697:C:CA	donor_gain	1.0000
17:49312697:C:G	donor_loss	1.0000
17:49312697:CC:C	donor_gain	1.0000
17:49312697:CCA:C	donor_gain	1.0000
17:49312697:CCAA:C	donor_gain	1.0000
17:49312841:ACACA:A	acceptor_gain	1.0000
17:49312842:CACA:C	acceptor_gain	1.0000
17:49312842:CACAC:C	acceptor_gain	1.0000
17:49312843:ACA:A	acceptor_gain	1.0000
17:49312844:CA:C	acceptor_gain	1.0000
17:49312844:CAC:C	acceptor_gain	1.0000
17:49312846:C:CC	acceptor_gain	1.0000
17:49312846:CTGA:C	acceptor_loss	1.0000
17:49312852:A:T	acceptor_gain	1.0000

AlphaMissense

4080 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
17:49298775:G:C	H487D	1.000
17:49298783:A:G	L484P	1.000
17:49298794:G:C	F480L	1.000
17:49298794:G:T	F480L	1.000
17:49298796:A:G	F480L	1.000
17:49298800:G:C	F478L	1.000
17:49298800:G:T	F478L	1.000
17:49298801:A:G	F478S	1.000
17:49298802:A:G	F478L	1.000
17:49298813:C:T	C474Y	1.000
17:49298814:A:G	C474R	1.000
17:49298822:C:T	C471Y	1.000
17:49298823:A:G	C471R	1.000
17:49298845:G:C	H463Q	1.000
17:49298845:G:T	H463Q	1.000
17:49298846:T:C	H463R	1.000
17:49298847:G:A	H463Y	1.000
17:49298847:G:C	H463D	1.000
17:49298847:G:T	H463N	1.000
17:49298851:T:A	R461S	1.000
17:49298851:T:G	R461S	1.000
17:49298855:C:G	R460P	1.000
17:49298857:G:C	H459Q	1.000
17:49298857:G:T	H459Q	1.000
17:49298858:T:C	H459R	1.000
17:49298859:G:C	H459D	1.000
17:49298859:G:T	H459N	1.000
17:49298860:T:A	R458S	1.000
17:49298860:T:G	R458S	1.000
17:49298884:G:C	F450L	1.000

dbSNP variants (sampled 300 via entrez): RS1000019830 (17:49292630 G>A), RS1000045933 (17:49303145 G>T), RS1000074174 (17:49336648 A>C,G), RS1000089625 (17:49294149 T>C), RS1000112474 (17:49293673 A>C,G), RS1000143947 (17:49362162 GGCGGGGCGGGCAGC>G,GGCGGGGCGGGCAGCGCGGGGCGGGCAGC), RS1000165408 (17:49360610 TCGA>T), RS1000197974 (17:49296869 A>G), RS1000231376 (17:49336747 C>T), RS1000270668 (17:49334835 C>A,G,T), RS1000333132 (17:49305491 G>C), RS1000344944 (17:49342686 C>T), RS1000386980 (17:49342958 T>C,G), RS1000429100 (17:49348661 A>G,T), RS1000478496 (17:49328487 G>A,C)

Disease associations

OMIM: gene MIM:613907 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

60 associations (top):

Study	Trait	p-value
GCST000394_6	Diastolic blood pressure	5.000000e-09
GCST000817_138	Height	4.000000e-08
GCST001078_1	Prostate cancer	3.000000e-13
GCST001236_27	Blood pressure	2.000000e-07
GCST001612_13	Sex hormone-binding globulin levels	4.000000e-14
GCST001612_30	Sex hormone-binding globulin levels	2.000000e-10
GCST001942_17	Prostate cancer	2.000000e-09
GCST004600_146	Eosinophil percentage of white cells	5.000000e-13
GCST004606_24	Eosinophil count	1.000000e-13
GCST004617_124	Eosinophil percentage of granulocytes	1.000000e-11
GCST004623_86	Neutrophil percentage of granulocytes	9.000000e-10
GCST004777_55	Diastolic blood pressure	1.000000e-08
GCST005038_100	Allergic disease (asthma, hay fever or eczema)	1.000000e-15
GCST005195_141	Coronary artery disease	2.000000e-15
GCST005196_220	Coronary artery disease	3.000000e-16
GCST005212_35	Asthma	7.000000e-09
GCST005275_26	Cancer	7.000000e-07
GCST005728_1	Egg allergy (maternal genetic effects)	4.000000e-07
GCST006020_37	Diastolic blood pressure	3.000000e-07
GCST006166_22	Diastolic blood pressure x alcohol consumption interaction (2df test)	1.000000e-18
GCST006166_41	Diastolic blood pressure x alcohol consumption interaction (2df test)	3.000000e-17
GCST006167_17	Mean arterial pressure x alcohol consumption interaction (2df test)	6.000000e-10
GCST006169_14	Diastolic blood pressure x alcohol consumption (light vs heavy) interaction (2df test)	2.000000e-09
GCST006169_27	Diastolic blood pressure x alcohol consumption (light vs heavy) interaction (2df test)	1.000000e-10
GCST006172_11	Mean arterial pressure x alcohol consumption (light vs heavy) interaction (2df test)	5.000000e-09
GCST006258_55	Diastolic blood pressure	1.000000e-12
GCST006259_15	Systolic blood pressure	7.000000e-08
GCST006412_99	Intraocular pressure	8.000000e-08
GCST006434_49	Systolic blood pressure x alcohol consumption interaction (2df test)	3.000000e-11
GCST006862_3	Asthma	3.000000e-09

EFO canonical traits (17, from GWAS)

EFO ID	Trait name
EFO:0006336	diastolic blood pressure
EFO:0006340	mean arterial pressure
EFO:0004696	sex hormone-binding globulin measurement
EFO:0007991	eosinophil percentage of leukocytes
EFO:0004842	eosinophil count
EFO:0007996	eosinophil percentage of granulocytes
EFO:0007994	neutrophil percentage of granulocytes
EFO:0005939	parental genotype effect measurement
EFO:0007018	egg allergy measurement
EFO:0004329	alcohol drinking
EFO:0006335	systolic blood pressure
EFO:0004695	intraocular pressure measurement
EFO:0004341	body fat distribution
EFO:1002011	adult onset asthma
EFO:0004530	triglyceride measurement
EFO:0004346	neuroimaging measurement
EFO:0010701	mean reticulocyte volume

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

PharmGKB variants

1 variants.

Variant	Genes	Level	Score	#Clin annots	Drugs
rs16948048	ZNF652		0.00	0

CTD chemical–gene interactions

57 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects expression, decreases expression	6
Benzo(a)pyrene	affects expression, decreases expression, decreases methylation	4
Formaldehyde	decreases expression	2
Phenylmercuric Acetate	decreases expression, affects cotreatment	2
Quercetin	decreases expression, decreases phosphorylation	2
Tetrachlorodibenzodioxin	decreases expression	2
Cyclosporine	decreases expression, increases expression	2
Aflatoxin B1	affects expression, decreases expression	2
Cadmium Chloride	increases expression, decreases expression, increases abundance	2
aristolochic acid I	decreases expression	1
FR900359	increases phosphorylation	1
bisphenol F	affects cotreatment, decreases expression	1
triphenyl phosphate	affects expression	1
2-butenal	decreases expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
sodium arsenite	decreases expression	1
butyraldehyde	decreases expression	1
ochratoxin A	decreases expression	1
benzo(e)pyrene	increases methylation	1
beta-methylcholine	affects expression	1
pentanal	decreases expression	1
gadodiamide	increases expression	1
2-palmitoylglycerol	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	decreases expression, affects cotreatment	1
erucylphospho-N,N,N-trimethylpropylammonium	increases expression	1
ICG 001	increases expression	1
abrine	decreases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
bisphenol S	affects cotreatment, decreases expression	1
jinfukang	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.