ZNF660

Summary

ZNF660 (zinc finger protein 660, HGNC:26720) is a protein-coding gene on chromosome 3p21.31, encoding Zinc finger protein 660 (Q6AZW8). May be involved in transcriptional regulation.

This gene encodes a protein that contains multiple C2H2 zinc finger domains, and is located in a cluster of zinc-finger encoding genes on chromosome 3. Naturally-occurring readthrough transcription is observed between this gene and the downstream zinc finger protein 197 gene and is represented by GeneID:110354863.

Source: NCBI Gene 285349 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 2 total
• MANE Select transcript: NM_173658

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:26720
Approved symbol	ZNF660
Name	zinc finger protein 660
Location	3p21.31
Locus type	gene with protein product
Status	Approved
Aliases	FLJ36870
Ensembl gene	ENSG00000144792
Ensembl biotype	protein_coding
Entrez	285349

Gene structure

Transcript identifiers

Ensembl transcripts: 8 — 7 protein_coding, 1 protein_coding_CDS_not_defined

ENST00000322734, ENST00000416644, ENST00000441021, ENST00000468987, ENST00000853529, ENST00000913944, ENST00000913945, ENST00000954821

RefSeq mRNA: 1 — MANE Select: NM_173658 NM_173658

CCDS: CCDS2716

Canonical transcript exons

ENST00000322734 — 3 exons

Exon	Start	End
ENSE00001264058	44584964	44585007
ENSE00001264071	44594014	44599694
ENSE00003517804	44586105	44586213

Expression profiles

Bgee: expression breadth ubiquitous, 133 present calls, max score 78.26.

FANTOM5 (CAGE): breadth broad, TPM avg 2.8776 / max 234.2335, expressed in 741 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
36334	2.8776	741

Top tissues by expression

134 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
calcaneal tendon	UBERON:0003701	78.26	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	78.19	gold quality
ganglionic eminence	UBERON:0004023	77.97	gold quality
corpus callosum	UBERON:0002336	77.60	gold quality
adrenal tissue	UBERON:0018303	75.55	gold quality
ventricular zone	UBERON:0003053	74.53	gold quality
sural nerve	UBERON:0015488	74.14	gold quality
cortical plate	UBERON:0005343	73.11	gold quality
ovary	UBERON:0000992	72.79	gold quality
endometrium	UBERON:0001295	72.76	gold quality
left ovary	UBERON:0002119	72.41	gold quality
right ovary	UBERON:0002118	71.18	gold quality
islet of Langerhans	UBERON:0000006	70.32	gold quality
smooth muscle tissue	UBERON:0001135	69.74	gold quality
body of uterus	UBERON:0009853	69.36	gold quality
cerebellar cortex	UBERON:0002129	69.01	gold quality
cerebellum	UBERON:0002037	68.96	gold quality
cerebellar hemisphere	UBERON:0002245	68.93	gold quality
descending thoracic aorta	UBERON:0002345	68.65	gold quality
myometrium	UBERON:0001296	68.57	gold quality
colonic epithelium	UBERON:0000397	68.43	gold quality
stromal cell of endometrium	CL:0002255	68.42	gold quality
right hemisphere of cerebellum	UBERON:0014890	68.36	gold quality
adenohypophysis	UBERON:0002196	68.25	gold quality
pituitary gland	UBERON:0000007	68.01	gold quality
left uterine tube	UBERON:0001303	67.82	gold quality
mucosa of stomach	UBERON:0001199	67.78	gold quality
right lobe of thyroid gland	UBERON:0001119	67.56	gold quality
urinary bladder	UBERON:0001255	67.48	gold quality
muscle tissue	UBERON:0002385	67.00	gold quality

Single-cell (SCXA)

Detected in 3 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-MTAB-6678	yes	24.77
E-CURD-11	no	50.34
E-ANND-3	no	0.57

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

50 targeting ZNF660, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-548AW	99.99	72.57	3559
HSA-MIR-141-3P	99.94	72.79	2421
HSA-MIR-200A-3P	99.94	72.68	2420
HSA-MIR-3143	99.93	71.96	3104
HSA-MIR-552-5P	99.93	68.56	1583
HSA-MIR-6508-5P	99.92	70.67	2465
HSA-MIR-8067	99.86	69.59	2260
HSA-MIR-4779	99.86	66.50	1583
HSA-MIR-8080	99.82	67.52	1342
HSA-MIR-944	99.82	70.85	3042
HSA-MIR-3133	99.81	70.92	3506
HSA-MIR-4659A-3P	99.80	72.62	4248
HSA-MIR-4659B-3P	99.80	72.62	4248
HSA-MIR-6739-5P	99.80	67.87	2806
HSA-MIR-448	99.79	72.37	2103
HSA-MIR-202-5P	99.78	67.65	991
HSA-MIR-6764-5P	99.75	67.89	2304
HSA-MIR-6733-5P	99.74	67.94	2759
HSA-MIR-4422	99.72	72.07	2908
HSA-MIR-1208	99.70	68.28	1533
HSA-MIR-3158-5P	99.65	67.51	1763
HSA-MIR-4276	99.56	67.66	2514
HSA-MIR-3153	99.55	67.59	2337
HSA-MIR-549A-3P	99.54	68.17	825
HSA-MIR-5004-3P	99.54	68.27	1371
HSA-MIR-409-3P	99.50	66.33	1192
HSA-MIR-653-5P	99.46	67.35	1300
HSA-MIR-578	99.46	68.36	1787

Literature-anchored findings (GeneRIF, showing 1)

• Biomarker potential of ST6GALNAC3 and ZNF660 promoter hypermethylation in prostate cancer tissue and liquid biopsies (PMID:29465788)

Cross-species orthologs

1 orthologs

Organism	Symbol	Gene ID
rattus_norvegicus	Znf660	ENSRNOG00000053687

Paralogs (38): ZFX (ENSG00000005889), ZBTB11 (ENSG00000066422), ZFAT (ENSG00000066827), ZFY (ENSG00000067646), ZNF586 (ENSG00000083828), IKZF5 (ENSG00000095574), ZNF419 (ENSG00000105136), ZNF549 (ENSG00000121406), ZSCAN20 (ENSG00000121903), ZNF304 (ENSG00000131845), PRDM15 (ENSG00000141956), ZNF711 (ENSG00000147180), ZNF773 (ENSG00000152439), ZNF256 (ENSG00000152454), ZNF837 (ENSG00000152475), ZNF691 (ENSG00000164011), ZNF610 (ENSG00000167554), E4F1 (ENSG00000167967), ZNF562 (ENSG00000171466), ZNF561 (ENSG00000171469), ZNF584 (ENSG00000171574), ZIK1 (ENSG00000171649), ZNF570 (ENSG00000171827), ZSCAN2 (ENSG00000176371), ZNF552 (ENSG00000178935), ZNF154 (ENSG00000179909), ZNF792 (ENSG00000180884), ZNF793 (ENSG00000188227), ZNF548 (ENSG00000188785), ZNF79 (ENSG00000196152), ZNF418 (ENSG00000196724), ZNF772 (ENSG00000197128), ZNF583 (ENSG00000198440), ZNF480 (ENSG00000198464), ZNF551 (ENSG00000204519), ZNF134 (ENSG00000213762), ZNF587B (ENSG00000269343), ZNF8 (ENSG00000278129)

Protein

Protein identifiers

Zinc finger protein 660 — Q6AZW8 (reviewed: Q6AZW8)

All UniProt accessions (3): Q6AZW8, C9J3D4, C9J3N9

UniProt curated annotations — full annotation on UniProt →

Function. May be involved in transcriptional regulation.

Subcellular location. Nucleus.

Similarity. Belongs to the krueppel C2H2-type zinc-finger protein family.

RefSeq proteins (1): NP_775929* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR013087	Znf_C2H2_type	Domain
IPR036236	Znf_C2H2_sf	Homologous_superfamily

Pfam: PF00096

UniProt features (15 total): zinc finger region 10, chain 1, region of interest 1, compositionally biased region 1, modified residue 1, sequence conflict 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q6AZW8-F1	82.75	0.65

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1): 23

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-212436	Generic Transcription Pathway

MSigDB gene sets: 26 (showing top): ACEVEDO_METHYLATED_IN_LIVER_CANCER_DN, GOMF_SEQUENCE_SPECIFIC_DNA_BINDING, chr3p21, GOMF_TRANSCRIPTION_REGULATOR_ACTIVITY, MIR3143, MIR548L, MIR448, MIR511_5P, MIR653_5P, MIR10A_5P_MIR10B_5P, MIR409_3P, MIR134_3P, MIR1912_5P, MIR3935, MANNE_COVID19_NONICU_VS_HEALTHY_DONOR_PLATELETS_DN

GO Biological Process (1): regulation of transcription by RNA polymerase II (GO:0006357)

GO Molecular Function (7): RNA polymerase II cis-regulatory region sequence-specific DNA binding (GO:0000978), DNA-binding transcription factor activity (GO:0003700), zinc ion binding (GO:0008270), sequence-specific double-stranded DNA binding (GO:1990837), DNA binding (GO:0003677), protein binding (GO:0005515), metal ion binding (GO:0046872)

GO Cellular Component (1): nucleus (GO:0005634)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
RNA Polymerase II Transcription	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
regulation of DNA-templated transcription	2
transcription by RNA polymerase II	1
RNA polymerase II transcription regulatory region sequence-specific DNA binding	1
cis-regulatory region sequence-specific DNA binding	1
transcription cis-regulatory region binding	1
transcription regulator activity	1
transition metal ion binding	1
double-stranded DNA binding	1
sequence-specific DNA binding	1
nucleic acid binding	1
binding	1
cation binding	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

176 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
ZNF660	CCDC181	Q5TID7	608
ZNF660	ST6GALNAC3	Q8NDV1	569
ZNF660	HAPLN3	Q96S86	544
ZNF660	KIN	O60870	312
ZNF660	HOXD3	P31249	300
ZNF660	LAGE3	Q14657	284
ZNF660	SAXO5	Q8NA69	276
ZNF660	SCUBE3	Q8IX30	271
ZNF660	RASSF1	Q9NS23	248
ZNF660	CRIP3	Q6Q6R5	247
ZNF660	MDFI	Q99750	246
ZNF660	CREB3L3	Q68CJ9	243
ZNF660	HEXIM1	O94992	229
ZNF660	ZFR	Q96KR1	226
ZNF660	CDO1	P78513	225

IntAct

17 interactions, top by confidence:

A	B	Type	Score
ZNF660	MAP3K20	psi-mi:“MI:0915”(physical association)	0.560
ZNF124	ZNF660	psi-mi:“MI:0915”(physical association)	0.560
SDCBP	ZNF660	psi-mi:“MI:0915”(physical association)	0.560
RNPS1	ZNF660	psi-mi:“MI:0915”(physical association)	0.560
ECE1	ZNF660	psi-mi:“MI:0915”(physical association)	0.370
M		psi-mi:“MI:0914”(association)	0.350
APP	ZNF660	psi-mi:“MI:0915”(physical association)	0.000
ZNF660	MAP3K20	psi-mi:“MI:0915”(physical association)	0.000
ZNF124	ZNF660	psi-mi:“MI:0915”(physical association)	0.000
SDCBP	ZNF660	psi-mi:“MI:0915”(physical association)	0.000
RNPS1	ZNF660	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (7): ZNF660 (Two-hybrid), ZNF660 (Two-hybrid), ZNF124 (Two-hybrid), RNPS1 (Two-hybrid), ZNF660 (Affinity Capture-RNA), ZNF660 (Affinity Capture-MS), ZNF660 (Two-hybrid)

ESM2 similar proteins: C9JN71, E9QAG8, O75820, P08043, P0CG24, P10751, P15620, P17017, P17039, P18716, P18718, P18732, P18735, P18736, P18744, P18746, P24399, Q14585, Q15072, Q28151, Q3KP31, Q3SYV7, Q3ZCT1, Q4R4C7, Q4VA44, Q52M93, Q5MCW4, Q5R5U3, Q5R8X1, Q5R9F0, Q5RAM9, Q5RB30, Q5RDX1, Q5REI6, Q5RF70, Q5RFP4, Q60493, Q62513, Q62981, Q6AZW8

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

2 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	2
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

470 predictions. Top by Δscore:

Variant	Effect	Δscore
3:44586103:A:AG	acceptor_gain	1.0000
3:44586104:G:GG	acceptor_gain	1.0000
3:44586103:AGT:A	acceptor_gain	0.9900
3:44586104:GT:G	acceptor_gain	0.9900
3:44586104:GTG:G	acceptor_gain	0.9900
3:44586212:GG:G	donor_gain	0.9900
3:44586213:GG:G	donor_gain	0.9900
3:44587236:G:GT	donor_gain	0.9900
3:44587251:G:GG	donor_gain	0.9900
3:44586100:TACA:T	acceptor_loss	0.9800
3:44586102:CA:C	acceptor_loss	0.9800
3:44586103:A:AC	acceptor_loss	0.9800
3:44586104:G:GT	acceptor_loss	0.9800
3:44586211:TGGG:T	donor_loss	0.9800
3:44586214:G:GG	donor_gain	0.9800
3:44586215:TGAGT:T	donor_loss	0.9800
3:44586216:G:GG	donor_loss	0.9800
3:44584987:GAT:G	donor_gain	0.9700
3:44586104:GTGA:G	acceptor_gain	0.9700
3:44586218:G:C	donor_loss	0.9700
3:44586093:ATCT:A	acceptor_loss	0.9500
3:44586094:T:G	acceptor_loss	0.9300
3:44585137:T:TA	donor_gain	0.9100
3:44586211:TGG:T	donor_gain	0.9000
3:44586212:GGG:G	donor_gain	0.9000
3:44587250:A:AG	donor_gain	0.9000
3:44585004:TTCG:T	donor_loss	0.8900
3:44585005:TCGG:T	donor_loss	0.8900
3:44585008:GTGAG:G	donor_loss	0.8900
3:44585009:T:A	donor_loss	0.8900

AlphaMissense

2214 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
3:44594402:G:C	R70P	0.999
3:44594452:T:C	F87L	0.999
3:44594454:C:A	F87L	0.999
3:44594454:C:G	F87L	0.999
3:44594536:T:C	F115L	0.999
3:44594538:C:A	F115L	0.999
3:44594538:C:G	F115L	0.999
3:44594620:T:C	F143L	0.999
3:44594622:T:A	F143L	0.999
3:44594622:T:G	F143L	0.999
3:44594704:T:C	F171L	0.999
3:44594706:T:A	F171L	0.999
3:44594706:T:G	F171L	0.999
3:44594368:T:C	F59L	0.998
3:44594370:T:A	F59L	0.998
3:44594370:T:G	F59L	0.998
3:44594555:T:C	L121P	0.998
3:44594956:T:C	F255L	0.998
3:44594958:T:A	F255L	0.998
3:44594958:T:G	F255L	0.998
3:44594387:T:C	L65P	0.997
3:44594471:T:C	L93P	0.997
3:44594561:G:C	R123P	0.996
3:44594563:C:G	H124D	0.996
3:44594453:T:C	F87S	0.995
3:44594565:C:A	H124Q	0.995
3:44594565:C:G	H124Q	0.995
3:44594639:T:C	L149P	0.995
3:44594723:T:C	L177P	0.995
3:44594872:T:C	F227L	0.995

dbSNP variants (sampled 300 via entrez): RS1000001117 (3:44593654 G>C), RS1000096946 (3:44593409 C>A), RS1000144545 (3:44587720 C>T), RS1000231525 (3:44586555 A>G), RS1000685274 (3:44586075 G>A), RS1000999936 (3:44588437 T>G), RS1001053902 (3:44588637 G>A), RS1001119853 (3:44591918 A>G), RS1001229960 (3:44584656 T>C), RS1001343290 (3:44595583 C>T), RS1001629135 (3:44595261 TTCTACTTCTAAGAATCATAC>T), RS1001817642 (3:44588064 A>G), RS1001827529 (3:44588363 A>G), RS1001897773 (3:44597247 T>C), RS1002067717 (3:44590711 A>G)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST009255_15	Fourth ventricle volume	5.000000e-06

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

26 total (human), top 26 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	decreases methylation, decreases expression	4
trichostatin A	affects cotreatment, decreases expression	3
Tretinoin	decreases expression	2
GSK-J4	decreases expression	1
geldanamycin	increases expression	1
triphenyl phosphate	affects expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
sodium arsenite	decreases expression	1
nickel sulfate	decreases expression	1
CGP 52608	affects binding, increases reaction	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
bisphenol S	affects cotreatment, decreases expression	1
Vorinostat	decreases expression	1
Arsenic	affects methylation	1
Benzo(a)pyrene	increases methylation	1
Dexamethasone	affects cotreatment, decreases expression	1
Doxorubicin	decreases expression	1
Endosulfan	increases expression	1
Indomethacin	decreases expression, affects cotreatment	1
Lead	affects expression	1
Oxygen	increases expression	1
Silicon Dioxide	decreases expression	1
Tobacco Smoke Pollution	decreases expression	1
1-Methyl-3-isobutylxanthine	affects cotreatment, decreases expression	1
Cyclosporine	decreases methylation	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.