ZNF740

Summary

ZNF740 (zinc finger protein 740, HGNC:27465) is a protein-coding gene on chromosome 12q13.13, encoding Zinc finger protein 740 (Q8NDX6). May be involved in transcriptional regulation.

Enables sequence-specific double-stranded DNA binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to be located in chromatin.

Source: NCBI Gene 283337 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 28 total — 1 pathogenic
• MANE Select transcript: NM_001004304

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:27465
Approved symbol	ZNF740
Name	zinc finger protein 740
Location	12q13.13
Locus type	gene with protein product
Status	Approved
Aliases	Zfp740
Ensembl gene	ENSG00000139651
Ensembl biotype	protein_coding
OMIM	620976
Entrez	283337

Gene structure

Transcript identifiers

Ensembl transcripts: 7 — 4 protein_coding, 2 retained_intron, 1 protein_coding_CDS_not_defined

ENST00000416904, ENST00000549739, ENST00000551514, ENST00000552593, ENST00000859084, ENST00000859085, ENST00000936752

RefSeq mRNA: 1 — MANE Select: NM_001004304 NM_001004304

CCDS: CCDS44896

Canonical transcript exons

ENST00000416904 — 7 exons

Exon	Start	End
ENSE00000939493	53186391	53186509
ENSE00001267807	53187501	53195142
ENSE00001698434	53181677	53181992
ENSE00002385745	53180722	53180837
ENSE00003472223	53185954	53186077
ENSE00003533352	53184891	53185040
ENSE00003656820	53185387	53185476

Expression profiles

Bgee: expression breadth ubiquitous, 223 present calls, max score 91.83.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 12.2700 / max 91.6704, expressed in 1780 samples.

FANTOM5 promoters (4 alternative TSS)

Promoter ID	TPM avg	Samples expressed
125713	9.6514	1758
125711	1.2583	841
125712	0.9393	634
125714	0.4210	231

Top tissues by expression

248 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
ileal mucosa	UBERON:0000331	91.83	gold quality
kidney epithelium	UBERON:0004819	90.51	gold quality
stromal cell of endometrium	CL:0002255	89.99	gold quality
colonic epithelium	UBERON:0000397	89.66	gold quality
mucosa of stomach	UBERON:0001199	88.89	gold quality
sural nerve	UBERON:0015488	88.69	gold quality
granulocyte	CL:0000094	88.51	gold quality
upper arm skin	UBERON:0004263	88.13	silver quality
right uterine tube	UBERON:0001302	88.01	gold quality
left lobe of thyroid gland	UBERON:0001120	87.83	gold quality
right lobe of thyroid gland	UBERON:0001119	87.71	gold quality
tibialis anterior	UBERON:0001385	87.58	silver quality
body of uterus	UBERON:0009853	87.57	gold quality
thyroid gland	UBERON:0002046	87.49	gold quality
left ovary	UBERON:0002119	87.48	gold quality
bone marrow cell	CL:0002092	87.42	gold quality
ganglionic eminence	UBERON:0004023	87.32	gold quality
right coronary artery	UBERON:0001625	87.24	gold quality
popliteal artery	UBERON:0002250	87.19	gold quality
tibial artery	UBERON:0007610	87.19	gold quality
smooth muscle tissue	UBERON:0001135	87.14	gold quality
ventricular zone	UBERON:0003053	87.05	gold quality
right hemisphere of cerebellum	UBERON:0014890	87.00	gold quality
cortical plate	UBERON:0005343	86.99	gold quality
cerebellar hemisphere	UBERON:0002245	86.89	gold quality
metanephros cortex	UBERON:0010533	86.87	gold quality
cerebellar cortex	UBERON:0002129	86.85	gold quality
descending thoracic aorta	UBERON:0002345	86.79	gold quality
aorta	UBERON:0000947	86.63	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	86.60	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-MTAB-9543	yes	4.88
E-ANND-3	no	2.73

Regulation

Is transcription factor: yes

JASPAR motifs

Motif	Name	Family
MA0753.1	ZNF740	Other factors with up to three adjacent zinc fingers
MA0753.2	ZNF740	Other factors with up to three adjacent zinc fingers
MA0753.3	ZNF740	Other factors with up to three adjacent zinc fingers

JASPAR matrix evidence (PMIDs): PMID:23354101

miRNA regulators (miRDB)

127 targeting ZNF740, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-8485	100.00	77.57	4731
HSA-MIR-3162-3P	100.00	65.37	363
HSA-MIR-4476	100.00	68.18	2030
HSA-MIR-6876-5P	100.00	67.68	2126
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-4795-3P	100.00	74.62	4024
HSA-MIR-548P	99.98	72.25	3784
HSA-MIR-548AN	99.97	70.91	2817
HSA-MIR-1468-3P	99.96	72.74	3797
HSA-MIR-548AJ-3P	99.96	73.38	5345
HSA-MIR-548X-3P	99.96	73.38	5345
HSA-MIR-1250-3P	99.96	70.04	4038
HSA-MIR-4487	99.96	64.58	1252
HSA-MIR-3910	99.95	71.13	2227
HSA-MIR-3912-5P	99.95	66.11	925
HSA-MIR-548J-3P	99.94	72.61	4881
HSA-MIR-548AE-3P	99.93	72.66	4867
HSA-MIR-548AH-3P	99.93	72.54	4872
HSA-MIR-548AM-3P	99.93	72.54	4872
HSA-MIR-548AQ-3P	99.93	72.66	4867
HSA-MIR-4648	99.91	67.00	710
HSA-MIR-329-3P	99.91	66.56	1234
HSA-MIR-362-3P	99.91	66.38	1267
HSA-MIR-345-3P	99.89	70.23	1421
HSA-MIR-6780A-5P	99.88	66.69	2776
HSA-MIR-3140-3P	99.88	68.47	2069
HSA-MIR-548D-3P	99.87	70.67	4362
HSA-MIR-548BB-3P	99.86	70.58	4354
HSA-MIR-548AC	99.84	70.77	4351
HSA-MIR-548H-3P	99.84	70.80	4349

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	znf740b	ENSDARG00000061174
mus_musculus	Zfp740	ENSMUSG00000046897
rattus_norvegicus	Znf740	ENSRNOG00000012192
drosophila_melanogaster	klu	FBGN0013469
drosophila_melanogaster	CG4318	FBGN0030455
caenorhabditis_elegans	klu-2	WBGENE00022592

Paralogs (4): ZNF367 (ENSG00000165244), ZBTB5 (ENSG00000168795), ZBTB43 (ENSG00000169155), ZBTB7A (ENSG00000178951)

Protein

Protein identifiers

Zinc finger protein 740 — Q8NDX6 (reviewed: Q8NDX6)

Alternative names: OriLyt TD-element-binding protein 7

All UniProt accessions (1): Q8NDX6

UniProt curated annotations — full annotation on UniProt →

Function. May be involved in transcriptional regulation.

Subcellular location. Nucleus.

Similarity. Belongs to the krueppel C2H2-type zinc-finger protein family.

RefSeq proteins (1): NP_001004304* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR013087	Znf_C2H2_type	Domain
IPR036236	Znf_C2H2_sf	Homologous_superfamily

Pfam: PF00096, PF13894

UniProt features (8 total): zinc finger region 3, chain 1, region of interest 1, compositionally biased region 1, modified residue 1, cross-link 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8NDX6-F1	66.79	0.06

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (2): 44, 34

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-212436	Generic Transcription Pathway

MSigDB gene sets: 112 (showing top): IVANOVA_HEMATOPOIESIS_MATURE_CELL, GGGGCCC_MIR296, GOMF_SEQUENCE_SPECIFIC_DNA_BINDING, MIKKELSEN_ES_ICP_WITH_H3K4ME3, WAKABAYASHI_ADIPOGENESIS_PPARG_RXRA_BOUND_8D, PEDRIOLI_MIR31_TARGETS_UP, ZWANG_DOWN_BY_2ND_EGF_PULSE, GOMF_TRANSCRIPTION_REGULATOR_ACTIVITY, CBX5_TARGET_GENES, CREB3L4_TARGET_GENES, DACH1_TARGET_GENES, FEV_TARGET_GENES, HOXB4_TARGET_GENES, HOXC6_TARGET_GENES, NAB2_TARGET_GENES

GO Biological Process (1): regulation of transcription by RNA polymerase II (GO:0006357)

GO Molecular Function (7): RNA polymerase II cis-regulatory region sequence-specific DNA binding (GO:0000978), DNA-binding transcription factor activity, RNA polymerase II-specific (GO:0000981), DNA-binding transcription factor activity (GO:0003700), zinc ion binding (GO:0008270), sequence-specific double-stranded DNA binding (GO:1990837), protein binding (GO:0005515), metal ion binding (GO:0046872)

GO Cellular Component (2): chromatin (GO:0000785), nucleus (GO:0005634)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
RNA Polymerase II Transcription	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
regulation of DNA-templated transcription	2
RNA polymerase II transcription regulatory region sequence-specific DNA binding	2
transcription by RNA polymerase II	1
cis-regulatory region sequence-specific DNA binding	1
chromatin	1
DNA-binding transcription factor activity	1
regulation of transcription by RNA polymerase II	1
transcription cis-regulatory region binding	1
transcription regulator activity	1
transition metal ion binding	1
double-stranded DNA binding	1
sequence-specific DNA binding	1
binding	1
cation binding	1
chromosome	1
cellular anatomical structure	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

1018 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
ZNF740	REEP5	Q00765	774
ZNF740	IFNG	P01579	663
ZNF740	TBRG1	Q3YBR2	626
ZNF740	PDE6B	P35913	621
ZNF740	TMSB10	P13472	543
ZNF740	KLF16	Q9BXK1	420
ZNF740	ELF2	Q15723	417
ZNF740	POU2F3	Q9UKI9	404
ZNF740	ETV2	O00321	398
ZNF740	CD4	P01730	395
ZNF740	IRF5	Q13568	390
ZNF740	ZNF821	O75541	388
ZNF740	ZBTB26	Q9HCK0	381
ZNF740	EGR4	Q05215	381
ZNF740	TMSB15A	P0CG34	370

IntAct

15 interactions, top by confidence:

A	B	Type	Score
ZNF740	M1AP	psi-mi:“MI:0915”(physical association)	0.560
CCL24	ZNF740	psi-mi:“MI:0915”(physical association)	0.370
CCL26	ZNF740	psi-mi:“MI:0915”(physical association)	0.370
CXCL5	ZNF740	psi-mi:“MI:0915”(physical association)	0.370
	ZNF740	psi-mi:“MI:0915”(physical association)	0.370
RRP1B	ZNF785	psi-mi:“MI:0914”(association)	0.350
COMMD3	VPS26C	psi-mi:“MI:0914”(association)	0.350
ZBP1	BCKDK	psi-mi:“MI:0914”(association)	0.350
MYC		psi-mi:“MI:0914”(association)	0.350
ATF3	C11orf98	psi-mi:“MI:0914”(association)	0.350
AIM2	DDX39A	psi-mi:“MI:0914”(association)	0.350
ZNF740	M1AP	psi-mi:“MI:0915”(physical association)	0.000
PRNP	ZNF740	psi-mi:“MI:0407”(direct interaction)	0.000

BioGRID (28): ZNF740 (Affinity Capture-RNA), ZNF740 (Affinity Capture-RNA), ZNF740 (Affinity Capture-MS), ZNF740 (Affinity Capture-MS), ZNF740 (Reconstituted Complex), ZNF740 (Proximity Label-MS), ZNF740 (Affinity Capture-MS), ZNF740 (Affinity Capture-MS), ZNF740 (Affinity Capture-MS), ZNF740 (Affinity Capture-MS), ZNF740 (Affinity Capture-MS), ZNF740 (Affinity Capture-MS), M1AP (Two-hybrid), ZNF740 (Affinity Capture-MS), ZNF740 (Affinity Capture-MS)

ESM2 similar proteins: A0JPB4, A1L1J6, A1L1R6, A1Z9R4, A2A935, A4IFJ6, E9Q6W4, E9Q8T2, G5E8B9, O08961, O13089, O15060, O42410, O57415, O73590, O95625, P14404, P57071, Q03112, Q03267, Q09452, Q13422, Q1L8W0, Q2M1K9, Q5DU09, Q5R9W9, Q5T0B9, Q5ZLR2, Q60821, Q62947, Q64318, Q6DBW0, Q6GNP2, Q6INV8, Q6KAS7, Q6NRM0, Q6NUD7, Q7TS63, Q802Y8, Q80TS5

Diamond homologs: A0MS83, Q3Y4E1, Q5R782, Q61624, Q62806, Q6NZQ6, Q8NDX6, Q99LI5, Q9UQR1, Q9Y2X9, P56670, Q96N77

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

28 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	0
Uncertain significance	17
Likely benign	1
Benign	2

Top pathogenic / likely-pathogenic (1)

Variant ID	HGVS	Classification
441984	GRCh37/hg19 12p13.33-q24.33(chr12:173787-133777902)	Pathogenic

SpliceAI

2669 predictions. Top by Δscore:

Variant	Effect	Δscore
12:53181929:A:T	donor_gain	1.0000
12:53182406:G:GG	donor_gain	1.0000
12:53185006:C:T	donor_gain	1.0000
12:53191854:CTCA:C	donor_loss	1.0000
12:53191856:CA:C	donor_loss	1.0000
12:53191857:A:AG	donor_loss	1.0000
12:53191858:C:CT	donor_loss	1.0000
12:53192015:TCCCT:T	acceptor_gain	1.0000
12:53192016:CCCT:C	acceptor_gain	1.0000
12:53192016:CCCTC:C	acceptor_gain	1.0000
12:53192017:CCTC:C	acceptor_gain	1.0000
12:53192018:CT:C	acceptor_gain	1.0000
12:53192020:C:CC	acceptor_gain	1.0000
12:53192020:CTGT:C	acceptor_loss	1.0000
12:53192021:T:C	acceptor_loss	1.0000
12:53192327:TA:T	donor_loss	1.0000
12:53192328:A:AC	donor_gain	1.0000
12:53192328:ACTTT:A	donor_gain	1.0000
12:53192329:C:CT	donor_gain	1.0000
12:53192329:CT:C	donor_gain	1.0000
12:53192329:CTT:C	donor_gain	1.0000
12:53192329:CTTT:C	donor_gain	1.0000
12:53192329:CTTTC:C	donor_gain	1.0000
12:53192332:T:A	donor_gain	1.0000
12:53192344:A:AC	donor_gain	1.0000
12:53192345:C:CC	donor_gain	1.0000
12:53192345:CT:C	donor_gain	1.0000
12:53192355:G:GT	donor_gain	1.0000
12:53192436:C:CT	acceptor_gain	1.0000
12:53192437:A:T	acceptor_gain	1.0000

AlphaMissense

1293 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
12:53186032:T:C	F110L	1.000
12:53186034:T:A	F110L	1.000
12:53186034:T:G	F110L	1.000
12:53186429:T:C	F138L	1.000
12:53186430:T:C	F138S	1.000
12:53186431:C:A	F138L	1.000
12:53186431:C:G	F138L	1.000
12:53187504:T:C	F166L	1.000
12:53187506:T:A	F166L	1.000
12:53187506:T:G	F166L	1.000
12:53186022:C:G	C106W	0.999
12:53186033:T:C	F110S	0.999
12:53186051:T:C	L116P	0.999
12:53186061:C:A	H119Q	0.999
12:53186061:C:G	H119Q	0.999
12:53186073:C:A	H123Q	0.999
12:53186073:C:G	H123Q	0.999
12:53186402:T:C	F129L	0.999
12:53186404:T:A	F129L	0.999
12:53186404:T:G	F129L	0.999
12:53186408:T:C	C131R	0.999
12:53186448:T:C	L144P	0.999
12:53186454:G:C	R146P	0.999
12:53186456:C:G	H147D	0.999
12:53186463:G:C	R149P	0.999
12:53186470:C:A	H151Q	0.999
12:53186470:C:G	H151Q	0.999
12:53187505:T:C	F166S	0.999
12:53187511:G:C	R168P	0.999
12:53186011:T:A	C103S	0.998

dbSNP variants (sampled 300 via entrez): RS1000085610 (12:53181394 G>A,C), RS1000651417 (12:53184804 G>A), RS1000833153 (12:53185773 C>CCCACT), RS1001303148 (12:53188101 A>G), RS1001444508 (12:53190984 C>T), RS1001651247 (12:53188369 A>G), RS1001856855 (12:53179963 G>A,C), RS1002378927 (12:53192269 C>G,T), RS1002543441 (12:53190208 C>G), RS1002741760 (12:53183540 G>A), RS1003015501 (12:53183321 G>A,C), RS1003023614 (12:53194637 A>G), RS1003082418 (12:53194435 C>G,T), RS1003221836 (12:53184138 TGTGTGTGTGTGTGCGCGCGCGCGCTCTGAAGCTAAGGG>T), RS1003383338 (12:53189295 G>T)

Disease associations

OMIM: gene MIM:620976 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST005026_17	Initial pursuit acceleration in psychotic disorders	2.000000e-08

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0008434	initial pursuit acceleration

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

18 total (human), top 18 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	decreases expression, affects expression, affects cotreatment	6
FR900359	increases phosphorylation	1
triphenyl phosphate	affects expression	1
bisphenol A	increases expression	1
perfluorooctane sulfonic acid	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
torcetrapib	increases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
Resveratrol	affects cotreatment, increases expression	1
Sunitinib	increases expression	1
Leflunomide	decreases expression	1
Enzyme Inhibitors	decreases activity, increases O-linked glycosylation	1
Plant Extracts	affects cotreatment, increases expression	1
Potassium Dichromate	increases expression	1
Smoke	decreases expression	1
Asbestos, Crocidolite	affects methylation	1
Cadmium Chloride	decreases expression	1
Lactic Acid	decreases expression	1

Cellosaurus cell lines

1 cell lines: 1 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_HA08	K562 eGFP-ZNF740	Cancer cell line	Female

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.