ZSWIM6

Summary

ZSWIM6 (zinc finger SWIM-type containing 6, HGNC:29316) is a protein-coding gene on chromosome 5q12.1, encoding Zinc finger SWIM domain-containing protein 6 (Q9HCJ5). involved in nervous system development, important for striatal morphology and motor regulation.

The protein encoded by this gene contains a zinc finger SWI2/SNF2 and MuDR (SWIM) domain. Proteins with SWIM domains have been found in a diverse number of species and are predicted to interact with DNA or proteins. Mutations in this gene result in acromelic frontonasal dysostosis.

Source: NCBI Gene 57688 — RefSeq curated summary.

At a glance

• Gene–disease (curated): acromelic frontonasal dysostosis (Definitive, ClinGen) — +1 more curated relationship
• GWAS associations: 39
• Clinical variants (ClinVar): 1,051 total — 1 pathogenic, 2 likely-pathogenic
• Phenotypes (HPO): 111
• MANE Select transcript: NM_020928

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:29316
Approved symbol	ZSWIM6
Name	zinc finger SWIM-type containing 6
Location	5q12.1
Locus type	gene with protein product
Status	Approved
Aliases	KIAA1577
Ensembl gene	ENSG00000130449
Ensembl biotype	protein_coding
OMIM	615951
Entrez	57688

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding

ENST00000252744

RefSeq mRNA: 1 — MANE Select: NM_020928 NM_020928

CCDS: CCDS47215

Canonical transcript exons

ENST00000252744 — 14 exons

Exon	Start	End
ENSE00000748135	61525800	61525976
ENSE00000748209	61531465	61531725
ENSE00000748236	61535484	61535619
ENSE00000807629	61521263	61521442
ENSE00000807630	61526250	61526396
ENSE00000807631	61530052	61530198
ENSE00000894264	61538814	61538971
ENSE00000894265	61539596	61539759
ENSE00000894266	61541884	61541965
ENSE00001021752	61543455	61546172
ENSE00001593860	61332258	61332948
ENSE00001610428	61490786	61490934
ENSE00001721808	61494260	61494410
ENSE00001738262	61472681	61473037

Expression profiles

Bgee: expression breadth ubiquitous, 251 present calls, max score 97.35.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 25.5757 / max 953.5979, expressed in 1795 samples.

FANTOM5 promoters (3 alternative TSS)

Promoter ID	TPM avg	Samples expressed
56622	24.6211	1791
56631	0.6568	288
56621	0.2978	152

Top tissues by expression

255 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
oviduct epithelium	UBERON:0004804	97.35	gold quality
cauda epididymis	UBERON:0004360	96.80	gold quality
subthalamic nucleus	UBERON:0001906	95.45	gold quality
medulla oblongata	UBERON:0001896	95.35	gold quality
ileal mucosa	UBERON:0000331	95.18	gold quality
inferior vagus X ganglion	UBERON:0005363	95.18	gold quality
trigeminal ganglion	UBERON:0001675	94.98	gold quality
buccal mucosa cell	CL:0002336	94.88	gold quality
caput epididymis	UBERON:0004358	94.52	gold quality
superior vestibular nucleus	UBERON:0007227	94.34	gold quality
dorsal plus ventral thalamus	UBERON:0001897	93.99	gold quality
Brodmann (1909) area 46	UBERON:0006483	93.55	gold quality
globus pallidus	UBERON:0001875	93.37	gold quality
medial globus pallidus	UBERON:0002477	93.28	gold quality
substantia nigra pars reticulata	UBERON:0001966	93.25	gold quality
dorsal root ganglion	UBERON:0000044	93.05	gold quality
mucosa of paranasal sinus	UBERON:0005030	92.60	gold quality
corpus callosum	UBERON:0002336	92.09	gold quality
bronchial epithelial cell	CL:0002328	92.06	gold quality
ventral tegmental area	UBERON:0002691	92.01	gold quality
postcentral gyrus	UBERON:0002581	91.99	gold quality
nasal cavity epithelium	UBERON:0005384	91.95	gold quality
pons	UBERON:0000988	91.87	gold quality
bronchus	UBERON:0002185	91.85	gold quality
substantia nigra pars compacta	UBERON:0001965	91.81	gold quality
corpus epididymis	UBERON:0004359	91.81	gold quality
parietal lobe	UBERON:0001872	91.79	gold quality
mucosa of sigmoid colon	UBERON:0004993	91.69	gold quality
cerebellar vermis	UBERON:0004720	91.68	gold quality
lateral globus pallidus	UBERON:0002476	91.54	gold quality

Single-cell (SCXA)

Detected in 5 experiment(s), a significant marker in 4.

Experiment	Marker?	Max mean expression
E-HCAD-35	yes	49.50
E-CURD-119	yes	37.53
E-HCAD-25	yes	20.68
E-ANND-3	yes	11.42
E-MTAB-9543	no	2.44

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

312 targeting ZSWIM6, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-5692B	100.00	71.32	2622
HSA-MIR-5692C	100.00	71.32	2622
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-518D-5P	100.00	67.51	979
HSA-MIR-518E-5P	100.00	67.66	954
HSA-MIR-518F-5P	100.00	67.51	979
HSA-MIR-519A-5P	100.00	67.66	954
HSA-MIR-519B-5P	100.00	67.66	954
HSA-MIR-519C-5P	100.00	67.66	954
HSA-MIR-520C-5P	100.00	67.51	979
HSA-MIR-522-5P	100.00	67.66	954
HSA-MIR-523-5P	100.00	67.66	954
HSA-MIR-526A-5P	100.00	67.51	979
HSA-MIR-3925-3P	100.00	69.95	1237
HSA-MIR-6833-3P	100.00	70.63	3197
HSA-MIR-8485	100.00	77.57	4731
HSA-MIR-6867-5P	100.00	82.21	3464
HSA-MIR-4768-5P	100.00	69.49	2861
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-340-5P	100.00	72.50	4437
HSA-MIR-3689D	100.00	66.14	1181
HSA-MIR-6851-5P	100.00	65.63	1294
HSA-MIR-7110-3P	100.00	73.18	2486
HSA-MIR-513A-5P	100.00	69.77	2465
HSA-MIR-656-3P	100.00	72.15	2788
HSA-MIR-6740-5P	100.00	65.64	932

Literature-anchored findings (GeneRIF, showing 4)

• Exome sequencing of one trio and two unrelated probands revealed the same heterozygous variant (c.3487C>T [p. Arg1163Trp])associated with acromelic frontonasal dysostosis in a highly conserved protein domain of ZSWIM6; this variant has not been seen in the 1000 Genomes data, dbSNP, or the Exome Sequencing Project (PMID:25105228)
• A single recurrent heterozygous missense substitution in ZSWIM6, encoding a protein of unknown function, was previously shown to underlie this disorder in four unrelated cases. Here we describe four additional individuals from three families, comprising two sporadic subjects (one of whom had no limb malformation) and a mildly affected female with a severely affected son (PMID:26706854)
• This study builds support for a key role for ZSWIM6 in neuronal development and function, in addition to its putative roles in limb and craniofacial development, and provides a striking example of different variants in the same gene leading to distinct phenotypes. (PMID:29198722)
• Classification of early age facial growth pattern and identification of the genetic basis in two Korean populations. (PMID:35970861)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	zswim6	ENSDARG00000101282
mus_musculus	Zswim6	ENSMUSG00000032846
rattus_norvegicus	Zswim6	ENSRNOG00000014528

Paralogs (3): ZSWIM4 (ENSG00000132003), ZSWIM5 (ENSG00000162415), ZSWIM8 (ENSG00000214655)

Protein

Protein identifiers

Zinc finger SWIM domain-containing protein 6 — Q9HCJ5 (reviewed: Q9HCJ5)

All UniProt accessions (1): Q9HCJ5

UniProt curated annotations — full annotation on UniProt →

Function. involved in nervous system development, important for striatal morphology and motor regulation.

Disease relevance. Acromelic frontonasal dysostosis (AFND) [MIM:603671] A rare variant form of frontonasal dysplasia, an array of abnormalities affecting the eyes, forehead and nose and linked to midfacial dysraphia. The clinical picture is highly variable. Major findings include true ocular hypertelorism, broadening of the nasal root, median facial cleft affecting the nose and/or upper lip and palate, unilateral or bilateral clefting of the alae nasi, lack of formation of the nasal tip, anterior cranium bifidum occultum, a V-shaped or widow’s peak frontal hairline. AFND is characterized by the association of frontonasal malformations with various combinations of polydactyly, tibial hypoplasia, epibulbar dermoid, encephalocoele, corpus callosum agenesis and Dandy-Walker malformation. The disease is caused by variants affecting the gene represented in this entry. Neurodevelopmental disorder with movement abnormalities, abnormal gait, and autistic features (NEDMAGA) [MIM:617865] An autosomal dominant neurodevelopmental disorder characterized by infantile-onset global developmental delay, severe to profound intellectual disability, mildly delayed walking with broad-based and unsteady gait, and absence of meaningful language. Patients have features of autism, with repetitive behaviors and poor communication, but usually are socially reactive and have a happy demeanor. More variable neurologic features include mild seizures, spasticity, and peripheral neuropathy. The disease is caused by variants affecting the gene represented in this entry.

RefSeq proteins (1): NP_065979* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR007527	Znf_SWIM	Domain
IPR048370	ZSWIM4-8_C	Domain

Pfam: PF21055

UniProt features (9 total): sequence variant 3, region of interest 2, compositionally biased region 2, chain 1, zinc finger region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9HCJ5-F1	79.99	0.52

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 455 (showing top): PEREZ_TP63_TARGETS, GOZGIT_ESR1_TARGETS_DN, LINDGREN_BLADDER_CANCER_CLUSTER_3_DN, GOBP_NEUROGENESIS, GOBP_FOREBRAIN_DEVELOPMENT, GOBP_GABAERGIC_NEURON_DIFFERENTIATION, GOBP_FOREBRAIN_GENERATION_OF_NEURONS, GOBP_CENTRAL_NERVOUS_SYSTEM_NEURON_DIFFERENTIATION, SCHAEFFER_PROSTATE_DEVELOPMENT_48HR_DN, GOBP_HEAD_DEVELOPMENT, PEREZ_TP53_AND_TP63_TARGETS, chr5q12, GOBP_STRIATUM_DEVELOPMENT, GOBP_TELENCEPHALON_DEVELOPMENT, RIGGI_EWING_SARCOMA_PROGENITOR_UP

GO Biological Process (2): striatal medium spiny neuron differentiation (GO:0021773), nervous system development (GO:0007399)

GO Molecular Function (2): zinc ion binding (GO:0008270), metal ion binding (GO:0046872)

GO Cellular Component (1): Cul2-RING ubiquitin ligase complex (GO:0031462)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
striatum development	1
forebrain neuron differentiation	1
GABAergic neuron differentiation	1
system development	1
transition metal ion binding	1
cation binding	1
cullin-RING ubiquitin ligase complex	1

Protein interactions and networks

STRING

544 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
ZSWIM6	ALX3	O95076	369
ZSWIM6	CCDC15	Q0P6D6	337
ZSWIM6	TRIM67	Q6ZTA4	328
ZSWIM6	SKOR2	Q2VWA4	326
ZSWIM6	ZNF574	Q6ZN55	325
ZSWIM6	SLC45A4	Q5BKX6	322
ZSWIM6	KIAA1328	Q86T90	322
ZSWIM6	G3V325	G3V325	320
ZSWIM6	ANKRD13C	Q8N6S4	309
ZSWIM6	KANSL1L	A0AUZ9	307
ZSWIM6	PRMT2IP	Q6ZRI6	305
ZSWIM6	C2orf69	Q8N8R5	304
ZSWIM6	ZSWIM2	Q8NEG5	299
ZSWIM6	PPP1R37	O75864	295
ZSWIM6	TGFBR3L	H3BV60	294
ZSWIM6	GPR88	Q9GZN0	294

IntAct

7 interactions, top by confidence:

A	B	Type	Score
GLMN	FKBP5	psi-mi:“MI:0914”(association)	0.640
HNRNPH2	PLOD2	psi-mi:“MI:0914”(association)	0.530
GLMN	CUL1	psi-mi:“MI:0914”(association)	0.530
CDC42	BBX	psi-mi:“MI:0914”(association)	0.350
Cdk1	IFT88	psi-mi:“MI:0914”(association)	0.350
ZWINT	ARHGAP32	psi-mi:“MI:0914”(association)	0.350

BioGRID (14): ZSWIM6 (Affinity Capture-MS), ZSWIM6 (Affinity Capture-RNA), ZSWIM6 (Affinity Capture-MS), ZSWIM6 (Affinity Capture-MS), ZSWIM6 (Negative Genetic), ZSWIM6 (Affinity Capture-RNA), ZSWIM6 (Affinity Capture-MS), ZSWIM6 (Affinity Capture-MS), ZSWIM6 (Affinity Capture-MS), ZSWIM6 (Affinity Capture-Western), NAT10 (Affinity Capture-Western), ZSWIM6 (Affinity Capture-MS), ZSWIM6 (Affinity Capture-RNA), ZSWIM6 (Affinity Capture-MS)

ESM2 similar proteins: A1L3I3, A2AHC3, A7E2V4, A7E305, D3Z8E6, E9Q0S6, O70405, O75385, P0C0T2, P53995, Q13009, Q29RJ0, Q3UHH1, Q3UHU5, Q5DTT2, Q5T5Y3, Q5VWQ0, Q5ZHX5, Q60610, Q62233, Q6GQX6, Q6NZR2, Q6P0Q8, Q6P1R3, Q6P2E9, Q6ZPY7, Q6ZQF7, Q76I79, Q76LL6, Q76N89, Q7TNN8, Q80TB7, Q80TC6, Q80TT8, Q80VC9, Q80Y50, Q8C7B8, Q8CGB6, Q8IWT3, Q8WYL5

Diamond homologs: A7E2V4, A7E305, Q3UHH1, Q80TB7, Q80TC6, Q8C7B8, Q9H7M6, Q9HCJ5, Q9P217, Q9VWN9

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

1051 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	2
Uncertain significance	485
Likely benign	400
Benign	73

Top pathogenic / likely-pathogenic (3)

Variant ID	HGVS	Classification
4072042	NM_020928.2(ZSWIM6):c.2195del (p.Asp732fs)	Pathogenic
450504	NM_020928.2(ZSWIM6):c.3491A>G (p.His1164Arg)	Likely pathogenic
4680891	NM_020928.2(ZSWIM6):c.2785G>A (p.Gly929Arg)	Likely pathogenic

SpliceAI

4150 predictions. Top by Δscore:

Variant	Effect	Δscore
5:61361954:G:GG	donor_gain	1.0000
5:61472672:A:AG	acceptor_gain	1.0000
5:61472673:C:G	acceptor_gain	1.0000
5:61472676:TCAA:T	acceptor_loss	1.0000
5:61472677:CAA:C	acceptor_loss	1.0000
5:61472679:A:G	acceptor_gain	1.0000
5:61490781:TCTA:T	acceptor_loss	1.0000
5:61490782:CTA:C	acceptor_loss	1.0000
5:61490783:TA:T	acceptor_loss	1.0000
5:61490784:A:AG	acceptor_gain	1.0000
5:61490784:A:T	acceptor_loss	1.0000
5:61490785:G:GA	acceptor_loss	1.0000
5:61490785:G:GG	acceptor_gain	1.0000
5:61490907:G:T	donor_gain	1.0000
5:61490930:CAAAG:C	donor_loss	1.0000
5:61490931:AAAG:A	donor_loss	1.0000
5:61490932:AAGGT:A	donor_loss	1.0000
5:61490935:G:GA	donor_loss	1.0000
5:61490936:T:G	donor_loss	1.0000
5:61494258:A:T	acceptor_loss	1.0000
5:61494259:GGT:G	acceptor_gain	1.0000
5:61494406:GCTGG:G	donor_gain	1.0000
5:61494407:CTGGG:C	donor_loss	1.0000
5:61494409:GG:G	donor_gain	1.0000
5:61494409:GGGT:G	donor_loss	1.0000
5:61494410:GG:G	donor_gain	1.0000
5:61494410:GGT:G	donor_loss	1.0000
5:61494411:G:C	donor_loss	1.0000
5:61494411:G:GG	donor_gain	1.0000
5:61494412:T:A	donor_loss	1.0000

AlphaMissense

7931 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
5:61332612:T:C	F114L	1.000
5:61332614:C:A	F114L	1.000
5:61332614:C:G	F114L	1.000
5:61332891:T:C	F207L	1.000
5:61332892:T:C	F207S	1.000
5:61332892:T:G	F207C	1.000
5:61332893:C:A	F207L	1.000
5:61332893:C:G	F207L	1.000
5:61332900:G:C	G210R	1.000
5:61332900:G:T	G210C	1.000
5:61332901:G:A	G210D	1.000
5:61332901:G:T	G210V	1.000
5:61332910:T:C	L213P	1.000
5:61332940:T:C	L223P	1.000
5:61332948:G:C	G226R	1.000
5:61472681:G:A	G226D	1.000
5:61472683:T:C	F227L	1.000
5:61472683:T:G	F227V	1.000
5:61472684:T:C	F227S	1.000
5:61472685:C:A	F227L	1.000
5:61472685:C:G	F227L	1.000
5:61472690:T:C	L229S	1.000
5:61472690:T:G	L229W	1.000
5:61472695:G:C	G231R	1.000
5:61472696:G:A	G231D	1.000
5:61472696:G:T	G231V	1.000
5:61472702:T:A	V233E	1.000
5:61472747:T:A	V248E	1.000
5:61472758:T:C	F252L	1.000
5:61472759:T:C	F252S	1.000

dbSNP variants (sampled 300 via entrez): RS1000053656 (5:61420996 T>C), RS1000068149 (5:61436568 G>T), RS1000083412 (5:61481081 T>A), RS1000089420 (5:61346037 C>G,T), RS1000109521 (5:61381258 A>G,T), RS1000132355 (5:61407741 C>G,T), RS1000134780 (5:61390448 G>A,T), RS1000148347 (5:61528630 C>A), RS1000149400 (5:61462174 T>G), RS1000159084 (5:61384578 T>G), RS1000188398 (5:61516444 ATATATATATATATAAAAAC>A), RS1000199301 (5:61333928 AGGCAGAGG>A), RS1000199531 (5:61364061 T>A,C), RS1000204178 (5:61505306 T>G), RS1000205563 (5:61469560 G>A)

Disease associations

OMIM: gene MIM:615951 | disease phenotypes: MIM:603671, MIM:617865

GenCC curated gene-disease

Disease	Classification	Inheritance
acromelic frontonasal dysostosis	Strong	Autosomal dominant
neurodevelopmental disorder with movement abnormalities, abnormal gait, and autistic features	Strong	Autosomal dominant

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
acromelic frontonasal dysostosis	Definitive	AD

Mondo (5): acromelic frontonasal dysostosis (MONDO:0011359), neurodevelopmental disorder with movement abnormalities, abnormal gait, and autistic features (MONDO:0060642), neurodevelopmental disorder (MONDO:0700092), hereditary ataxia (MONDO:0100309), intellectual disability (MONDO:0001071)

Orphanet (3): Acromelic frontonasal dysplasia (Orphanet:1827), Hereditary ataxia (Orphanet:183518), NON RARE IN EUROPE: Unexplained intellectual disability (Orphanet:319658)

HPO phenotypes

111 total (30 of 111 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000028	Cryptorchidism
HP:0000154	Wide mouth
HP:0000161	Median cleft upper lip
HP:0000175	Cleft palate
HP:0000194	Open mouth
HP:0000204	Cleft upper lip
HP:0000232	Everted lower lip vermilion
HP:0000239	Large fontanelles
HP:0000248	Brachycephaly
HP:0000253	Progressive microcephaly
HP:0000256	Macrocephaly
HP:0000280	Coarse facial features
HP:0000316	Hypertelorism
HP:0000336	Prominent supraorbital ridges
HP:0000369	Low-set ears
HP:0000431	Wide nasal bridge
HP:0000455	Broad nasal tip
HP:0000456	Bifid nasal tip
HP:0000486	Strabismus
HP:0000494	Downslanted palpebral fissures
HP:0000501	Glaucoma
HP:0000506	Telecanthus
HP:0000508	Ptosis
HP:0000545	Myopia
HP:0000565	Esotropia
HP:0000574	Thick eyebrow
HP:0000609	Optic nerve hypoplasia
HP:0000687	Widely spaced teeth
HP:0000729	Autistic behavior

GWAS associations

39 associations (top):

Study	Trait	p-value
GCST002149_22	Schizophrenia	4.000000e-08
GCST002539_57	Schizophrenia	1.000000e-14
GCST002799_12	Number of pregnancies	4.000000e-06
GCST002801_4	Number of children	4.000000e-06
GCST004521_137	Autism spectrum disorder or schizophrenia	2.000000e-09
GCST004521_26	Autism spectrum disorder or schizophrenia	1.000000e-09
GCST004904_26	Body mass index	3.000000e-08
GCST005316_571	Intelligence (MTAG)	2.000000e-08
GCST005316_572	Intelligence (MTAG)	4.000000e-08
GCST005316_577	Intelligence (MTAG)	2.000000e-10
GCST005991_12	Platelet count	1.000000e-15
GCST006269_1213	General cognitive ability	4.000000e-08
GCST006269_1242	General cognitive ability	5.000000e-08
GCST006803_17	Schizophrenia	4.000000e-14
GCST007201_149	Schizophrenia	9.000000e-13
GCST007201_215	Schizophrenia	1.000000e-09
GCST007201_439	Schizophrenia	5.000000e-13
GCST009523_32	Household income	1.000000e-13
GCST009523_33	Household income	5.000000e-10
GCST009523_34	Household income	6.000000e-10
GCST009524_132	Household income (MTAG)	4.000000e-08
GCST009524_217	Household income (MTAG)	9.000000e-09
GCST009524_223	Household income (MTAG)	8.000000e-21
GCST009524_235	Household income (MTAG)	7.000000e-17
GCST009524_336	Household income (MTAG)	3.000000e-13
GCST009524_56	Household income (MTAG)	8.000000e-11
GCST009600_26	Anorexia nervosa, attention-deficit/hyperactivity disorder, autism spectrum disorder, bipolar disorder, major depression, obsessive-compulsive disorder, schizophrenia, or Tourette syndrome (pleiotropy)	1.000000e-10
GCST009723_82	Vertical cup-disc ratio (adjusted for vertical disc diameter)	3.000000e-06
GCST009724_45	Vertical cup-disc ratio (multi-trait analysis)	4.000000e-08
GCST010002_28	Refractive error	9.000000e-09

EFO canonical traits (11, from GWAS)

EFO ID	Trait name
EFO:0006918	female fertility
EFO:0004340	body mass index
EFO:0004337	intelligence
EFO:0004309	platelet count
EFO:0009695	household income
EFO:0006939	cup-to-disc ratio measurement
EFO:0008111	diet measurement
EFO:0004346	neuroimaging measurement
EFO:0009819	comparative body size at age 10, self-reported
EFO:0005665	white matter hyperintensity measurement
EFO:0004980	appendicular lean mass

MeSH disease descriptors (4)

Descriptor	Name	Tree numbers
D008607	Intellectual Disability	C10.597.606.360; C23.888.592.604.646; F01.700.687; F03.625.539
D065886	Neurodevelopmental Disorders	F03.625
C566345	Acromelic Frontonasal Dysostosis (supp.)
C531684	Hereditary spinal ataxia (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

52 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
(+)-JQ1 compound	increases expression	5
sodium arsenite	decreases expression, increases expression	3
Acetaminophen	increases expression	3
Air Pollutants	decreases expression, increases abundance	2
Valproic Acid	affects expression, increases methylation	2
Cyclosporine	increases expression	2
Cadmium Chloride	decreases expression, increases abundance, increases expression	2
Particulate Matter	decreases expression, increases abundance	2
triphenyl phosphate	affects expression	1
bisphenol A	increases expression	1
arsenite	affects binding, decreases reaction	1
methylparaben	increases expression	1
tris(1,3-dichloro-2-propyl)phosphate	increases expression	1
zinc chromate	increases abundance, increases expression	1
cupric chloride	affects expression	1
di-n-butylphosphoric acid	affects expression	1
chromium hexavalent ion	increases expression, increases abundance	1
perfluorooctane sulfonic acid	increases expression	1
cylindrospermopsin	increases expression	1
CGP 52608	affects binding, increases reaction	1
abrine	increases expression	1
(4-amino-1,4-dihydro-3-(2-pyridyl)-5-thioxo-1,2,4-triazole)copper(II)	increases expression	1
jinfukang	affects cotreatment, decreases expression	1
NSC 689534	affects binding, increases expression	1
PCI 5002	affects cotreatment, increases expression	1
Resveratrol	decreases expression	1
Sunitinib	decreases expression	1
Leflunomide	increases expression	1
Air Pollutants, Occupational	decreases expression	1
Cadmium	decreases expression, increases abundance	1

Clinical trials (associated diseases)

299 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT04586348	PHASE4	UNKNOWN	Prenatal Iodine Supplementation and Early Childhood Neurodevelopment
NCT04873115	PHASE4	UNKNOWN	Double-blind, Placebo-controlled, Randomized Clinical Trial Comparing the Efficacy and Safety of Sialanar Plus orAl rehabiLitation Against Placebo Plus Oral Rehabilitation for chIldren and Adolescents With seVere Sialorrhoea and Neurodisabilties,
NCT05657860	PHASE4	COMPLETED	Guanfacine Extended Release for the Reduction of Aggression and Self-injurious Behavior Associated With Prader-Willi Syndrome
NCT05744479	PHASE4	RECRUITING	Metformin for Antipsychotic-induced Weight Gain in Adults With Intellectual Disability
NCT06107829	PHASE4	WITHDRAWN	Valbenazine Treatment of Tardive Dyskinesia in Adults With Intellectual/Developmental Disabilities
NCT06997198	PHASE4	NOT_YET_RECRUITING	Deutetrabenazine Treatment for Tardive Dyskinesia in Intellectual/Developmental Disabilities
NCT02559102	PHASE3	COMPLETED	Dexmedetomidine Sedation Versus General Anaesthesia for Inguinal Hernia Surgery in Infants
NCT02757079	PHASE3	COMPLETED	Study of the Efficacy and Safety of NPC-15 for Sleep Disorders of Children With Neurodevelopmental Disorders
NCT06915480	PHASE3	RECRUITING	Reducing Missed Appointments
NCT07377032	PHASE3	RECRUITING	TAP-GRIN: Interventional Study on Patients With GRIN-related Neurodevelopmental Disorders
NCT02270736	PHASE3	COMPLETED	Clinical Study to Investigate the Efficacy and Safety of NT 201 Compared to Placebo in the Treatment of Chronic Troublesome Drooling Associated With Neurological Disorders and/or Intellectual Disability
NCT02909959	PHASE2	COMPLETED	Sulforaphane for the Treatment of Young Men With Autism Spectrum Disorder
NCT06081348	PHASE2	RECRUITING	Sertraline vs. Placebo in the Treatment of Anxiety in Children and AdoLescents With NeurodevelopMental Disorders
NCT06352372	PHASE2	COMPLETED	Safety and Efficacy of tPBM for Epileptiform Activity in Autism
NCT00202397	PHASE2	COMPLETED	Effect of Riluzole as a Symptomatic Approach in Patients With Chronic Cerebellar Ataxia
NCT02304302	PHASE2	COMPLETED	Down Syndrome Memantine Follow-up Study
NCT03862950	PHASE2	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome (Met)
NCT04529226	PHASE2	UNKNOWN	Study to Compare Clozapine vs Treatment as Usual in People With Intellectual Disability & Treatment-resistant Psychosis
NCT04821856	PHASE2	COMPLETED	Evaluation of the Effectiveness of Cannabidiol in Treating Severe Behavioural Problems in Children and Adolescents With Intellectual Disability
NCT00503191	PHASE1	COMPLETED	NeuroModulation Technique Treatment of Autism
NCT04475848	PHASE1	COMPLETED	A Study to Investigate the Safety, Tolerability, Pharmacokinetics, Pharmacodynamics and Food Effect of RO6953958 in Healthy Participants
NCT06300398	PHASE1	COMPLETED	IAMA-6 Oral Dose Study in Healthy Adults
NCT05273320	PHASE1	COMPLETED	Clinical Trial of Nabilone for Aggression in Adults With Intellectual and Developmental Disabilities
NCT05301361	PHASE1	ENROLLING_BY_INVITATION	Sensitivity of the NIH Toolbox to Stimulant Treatment in Intellectual Disabilities
NCT06016764	PHASE1	COMPLETED	Use of MRI and cTBS for Catatonia in Autism
NCT06586827	PHASE1	COMPLETED	Impact of Competency-Based Training and Technical Assistance Employment Outcomes of Individuals With ID/DD
NCT07531940	PHASE1	NOT_YET_RECRUITING	Escalating Doses of Memantine in Down Syndrome (MEDS-123)
NCT01783041	PHASE2/PHASE3	COMPLETED	Effect of Early L-Carnitine Supplementation on Neurodevelopmental Outcomes in Very Preterm Infants
NCT05767385	PHASE2/PHASE3	RECRUITING	Fetal Cerebrovascular Autoregulation in Congenital Heart Disease and Association With Neonatal Neurobehavior
NCT05675098	EARLY_PHASE1	NOT_YET_RECRUITING	Central Nervous System Stimulants and Physical Function in Children With Cerebral Palsy
NCT00783783	Not specified	COMPLETED	CYP2D6 Pharmacogenetics in Risperidone-Treated Children
NCT01778504	Not specified	RECRUITING	Studying Childhood-onset Behavioral, Psychiatric, and Developmental Disorders
NCT01850784	Not specified	UNKNOWN	High Energy Formula Feeding in Infants With Congenital Heart Disease
NCT01922791	Not specified	COMPLETED	Nutrition and Pregnancy Intervention Study
NCT01942525	Not specified	UNKNOWN	Influence of Intrauterine Growth Restriction on Amplitude-integrated EEG in Preterm Infants
NCT02003170	Not specified	COMPLETED	Etiology and Early Diagnosis of Neurodevelopmental Disorders
NCT02118649	Not specified	ACTIVE_NOT_RECRUITING	Enhancing Behavior and Brain Response to Visual Targets Using a Computer Game
NCT02557191	Not specified	TERMINATED	Biomarkers, Neurodevelopment and Preterm Infants
NCT02690675	Not specified	COMPLETED	Iron Supplement Effect on Child Development
NCT02694003	Not specified	COMPLETED	Better Nights, Better Days for Children With Neurodevelopment Disorders