CDKN2A Gene Complete Identifier and Functional Mapping Reference
Provide a comprehensive cross-database identifier and functional mapping reference for human CDKN2A — a definitive lookup resource covering: ### Section 1: Gene identifiers For human gene CDKN2A, list ALL gene-level database identifiers. Required: - HGNC ID and approved symbol - Ensembl gene ID (ENSG...) - NCBI Entrez Gene ID - OMIM gene/locus ID - Genomic location: chromosome, start position, end position, strand (GRCh38) ### Section 2: Transcript identifiers For human gene CDKN2A, list ALL transcript-level identifiers. Required: - Ensembl transcripts: ALL ENST IDs with biotype. Total count. - RefSeq transcripts: ALL NM_ mRNA accessions. Mark which is MANE Select. - CCDS IDs. - For the CANONICAL/MANE SELECT transcript: ALL exon IDs (ENSE) with genomic coordinates and total exon count. ### Section 3: Protein identifiers For human gene CDKN2A protein product(s), list ALL protein-level identifiers. Required: - UniProt accessions: ALL entries (reviewed and unreviewed). Mark the canonical reviewed entry. - RefSeq protein: ALL NP_ accessions. - Protein domains and families: list ALL annotated domains/families with identifiers, including name, type (domain/family/superfamily), and ID. - Antibody availability: known antibody resources for the protein. ### Section 4: Structure For human gene CDKN2A protein, list ALL structural data. Required: - Experimental structures: ALL PDB IDs. For each: experimental method (X-ray/NMR/Cryo-EM) and resolution. Total count. - Predicted structures: AlphaFold model ID and confidence metrics (pLDDT). ### Section 5: Cross-species orthologs For human gene CDKN2A, list orthologous genes in key model organisms. Organisms: - Mouse (Mus musculus): gene ID, symbol - Rat (Rattus norvegicus): gene ID, symbol - Zebrafish (Danio rerio): gene ID, symbol - Fruit fly (Drosophila melanogaster): gene ID, symbol - Worm (C. elegans): gene ID, symbol - Yeast (S. cerevisiae): gene ID, symbol ### Section 6: Clinical variants & AI predictions For human gene CDKN2A, summarize clinical variants and AI predictions. Clinical variant annotations (ClinVar): - Total variant count (approximate is fine) - Breakdown by classification: Pathogenic, Likely Pathogenic, VUS, Likely Benign, Benign - TOP 30 pathogenic/likely pathogenic variants with: variant ID, HGVS notation, associated condition AI-based variant effect predictions: - Splice effect predictions: total count + TOP 30 with delta scores if known - Missense pathogenicity from AlphaMissense — total count + TOP 30 likely-pathogenic with am_pathogenicity scores. ### Section 7: Pathways & Gene Ontology For human gene CDKN2A, list biological pathways and Gene Ontology annotations. Pathway membership: - ALL biological pathways this gene participates in, with pathway IDs and names - Total pathway count Gene Ontology: - Biological Process: count and TOP 20 terms with GO IDs - Molecular Function: count and TOP 20 terms with GO IDs - Cellular Component: count and TOP 20 terms with GO IDs ### Section 8: Protein interactions & networks For human gene CDKN2A protein, summarize protein interactions and networks. Protein-protein interactions (STRING, IntAct, BioGRID, etc.): - Total interaction count (approximate) - TOP 30 highest-confidence interacting proteins with scores/evidence Protein similarity: - Structural/embedding similarity (e.g. Foldseek, ESM): TOP 20 similar proteins with scores - Sequence homology: TOP 20 homologous proteins with identity/similarity ### Section 9: Transcription factor regulatory data For human gene CDKN2A, summarize transcription factor regulatory data. If CDKN2A is a transcription factor: - Downstream targets: total count + TOP 30 with regulation type (activates/represses) and evidence - DNA binding motifs from JASPAR — all known motif IDs and motif family classification. Regardless: - Upstream regulators: TFs that regulate CDKN2A — names with evidence type (ChIP-seq / predicted / experimentally validated) If CDKN2A is not a transcription factor, say so briefly and skip the downstream/motif sections. ### Section 10: Drug & pharmacology data For human gene CDKN2A protein as a drug target, summarize pharmacology data. If CDKN2A is a known drug target: - Targeting molecules: total count in ChEMBL/DrugBank + TOP 30 by development phase (molecule ID, name, mechanism, highest phase) - Clinical trials: TOP 20 involving drugs targeting this gene — trial ID, phase, status, intervention - Pharmacogenomics: known drug-gene interactions affecting drug response + dosing guidelines if any If CDKN2A is not currently a drug target, say so briefly. ### Section 11: Expression profiles For human gene CDKN2A, summarize expression profiles. Tissue expression (GTEx, HPA, Bgee, etc.): - TOP 30 tissues with expression scores/levels (direction, units if known) - Note tissue-specific or tissue-enriched patterns Cell type expression (Tabula Sapiens, HCA, etc.): - TOP 30 cell types with expression scores - Note cell-type-specific patterns Single-cell expression: notable datasets or cell populations of interest for this gene. ### Section 12: Disease associations For human gene CDKN2A, summarize disease associations. Mendelian / monogenic disease: - Diseases caused by mutations in CDKN2A: disease name, disease ID (OMIM/Orphanet/Mondo), inheritance pattern, evidence level - Include all directly linked conditions Phenotype associations: - Clinical phenotypes associated with the gene (HPO terms where known) - TOP 30 phenotype terms with HPO IDs Complex-disease / GWAS: - Traits and diseases significantly associated via GWAS: trait name, variant, effect size, study where known - TOP 30 GWAS associations
Executive summary
CDKN2A (cyclin-dependent kinase inhibitor 2A, chromosome 9p21) is one of the most important tumor suppressor genes in human cancer, encoding two functionally distinct proteins from the same locus: p16-INK4a and p14ARF. p16-INK4a directly inhibits CDK4 and CDK6, blocking G1/S cell cycle progression and preventing RB phosphorylation, while p14ARF stabilizes TP53 by inhibiting MDM2. Germline loss-of-function mutations cause melanoma-pancreatic cancer syndrome (autosomal dominant), and somatic inactivation of CDKN2A is among the most frequent events across human cancers. The locus harbors ~1,594 ClinVar variants (roughly 80 pathogenic or likely pathogenic) and over 1,200 AlphaMissense-predicted damaging missense variants, with particularly high-risk changes clustering in the ankyrin-repeat CDK-binding domain. GWAS links the 9p21 region to type 2 diabetes, coronary artery disease, glioma, and B-cell acute lymphoblastic leukemia. Although CDKN2A itself is not directly druggable, loss of p16 sensitizes tumors to CDK4/6 inhibitors (palbociclib, ribociclib, abemaciclib), making CDKN2A status a clinically relevant predictive biomarker.
CDKN2A — Reference
Cross-database identifier and functional mapping reference for CDKN2A.
Gene identifiers
- HGNC ID: HGNC:1787
- Approved symbol: CDKN2A
- Ensembl gene ID: ENSG00000147889
- NCBI Entrez Gene ID: 1029
- OMIM gene/locus ID: 600160
- Genomic location (GRCh38):
- Chromosome: 9
- Start: 21,967,752 bp
- End: 21,995,301 bp
- Strand: −
Transcript identifiers
Ensembl transcripts: 14 total
| Ensembl ID | Biotype |
|---|---|
| ENST00000304494 | protein_coding |
| ENST00000380150 | protein_coding_CDS_not_defined |
| ENST00000380151 | nonsense_mediated_decay |
| ENST00000470819 | protein_coding_CDS_not_defined |
| ENST00000479692 | protein_coding |
| ENST00000494262 | protein_coding |
| ENST00000497750 | protein_coding |
| ENST00000498124 | protein_coding |
| ENST00000498628 | protein_coding |
| ENST00000530628 | protein_coding |
| ENST00000577854 | protein_coding_CDS_not_defined |
| ENST00000578845 | protein_coding |
| ENST00000579122 | protein_coding |
| ENST00000579755 | protein_coding |
RefSeq mRNA (Human, Chromosome 9): 5 total
| NM Accession | MANE Select |
|---|---|
| NM_000077 | ✓ |
| NM_001195132 | |
| NM_001363763 | |
| NM_058195 | |
| NM_058197 |
CCDS IDs: 4 total
- CCDS56565
- CCDS6510
- CCDS6511
- CCDS87644
MANE Select Transcript Exons (ENST00000304494 / NM_000077): 3 exons
| Exon ID | Start | End | Strand | Chr |
|---|---|---|---|---|
| ENSE00001833804 | 21974678 | 21974857 | − | 9 |
| ENSE00003496053 | 21970902 | 21971208 | − | 9 |
| ENSE00003529527 | 21967752 | 21968242 | − | 9 |
Protein identifiers
UniProt Accessions
| Accession | Protein | Status |
|---|---|---|
| P42771 | Cyclin-dependent kinase inhibitor 2A (p16-INK4a) | Reviewed (Canonical) |
| Q8N726 | Tumor suppressor ARF (p14ARF) | Reviewed |
| J3QRG6 | CDKN2A | Unreviewed |
| K7ENC6 | CDKN2A | Unreviewed |
| K7ES20 | CDKN2A | Unreviewed |
| K7PML8 | CDKN2A | Unreviewed |
RefSeq Protein Accessions (NP_)
| Accession | Gene/Protein | Status | Notes |
|---|---|---|---|
| NP_000068 | CDKN2A | REVIEWED | MANE Select (primary) |
| NP_001182061 | CDKN2A | REVIEWED | |
| NP_001341006 | ARF | VALIDATED | Alternative reading frame |
| NP_001350692 | CDKN2A | REVIEWED | |
| NP_478102 | CDKN2A | REVIEWED | |
| NP_478104 | CDKN2A | REVIEWED |
Protein Domains and Families
p16-INK4a (P42771)
| ID | Domain/Family Name | Type | Database |
|---|---|---|---|
| IPR050776 | Ankyrin Repeat and Cyclin-Dependent Kinase Inhibitor | Family | InterPro |
| IPR036770 | Ankyrin repeat-containing domain superfamily | Homologous Superfamily | InterPro |
| PTHR24201 | Cyclin-dependent kinase inhibitor | Family | PANTHER |
| PTHR24201:SF4 | Cyclin-dependent kinase inhibitor subfamily 4 | Subfamily | PANTHER |
p14ARF (Q8N726)
| ID | Domain/Family Name | Type | Database |
|---|---|---|---|
| IPR010868 | Tumor suppressor ARF | Family | InterPro |
| PF07392 | ARF-family | Domain | Pfam |
Antibody Availability
Antibodies targeting CDKN2A/p16 and ARF/p14ARF are widely available from commercial vendors (Abcam, Santa Cruz Biotechnology, Cell Signaling, Millipore, etc.), but specific antibody products are not indexed in the biobtree antibody database. Human Protein Atlas (HPA) is referenced in the protein database and maintains antibody resources for these targets.
Structure
Experimental Structures (PDB)
| PDB ID | Method | Resolution |
|---|---|---|
| 1A5E | Solution NMR | — |
| 1BI7 | X-ray diffraction | 3.4 Å |
| 1DC2 | Solution NMR | — |
| 2A5E | Solution NMR | — |
| 7OZT | X-ray diffraction | 1.74 Å |
Total: 5 experimental structures (3 NMR, 2 X-ray)
Predicted Structures (AlphaFold)
| Model ID | Global pLDDT | High Confidence (pLDDT ≥ 70) |
|---|---|---|
| P42771 | 77.02 | 1% |
Total: 1 AlphaFold model
Cross-species orthologs
| Organism | Gene ID | Symbol |
|---|---|---|
| Mouse (Mus musculus) | ENSMUSG00000044303 | Cdkn2a |
| Rat (Rattus norvegicus) | ENSRNOG00000059837 | Cdkn2a |
| Zebrafish (Danio rerio) | none | — |
| Fruit fly (Drosophila melanogaster) | none | — |
| Worm (C. elegans) | none | — |
| Yeast (S. cerevisiae) | none | — |
Clinical variants & AI predictions
ClinVar Overview
| Classification | Count |
|---|---|
| Pathogenic | ~50 |
| Likely Pathogenic | ~30 |
| Uncertain Significance | ~650 |
| Conflicting Classifications | ~150 |
| Likely Benign | ~150 |
| Benign | ~100 |
| Total | ~1,594 |
TOP 30 Pathogenic/Likely Pathogenic ClinVar Variants
| Variant ID | HGVS Notation | Classification | Condition/Note |
|---|---|---|---|
| 1068946 | NM_000077.5:c.34del | Pathogenic | Frameshift; p.Ser12fs |
| 1069074 | NM_000077.5:c.126dup | Pathogenic | Premature stop; p.Ser43Ter |
| 1070481 | NC_000009.11:g.(?21968228)(22160087_?)del | Pathogenic | Large deletion |
| 1072356 | NM_058195.4:c.126_127insCA | Pathogenic | Frameshift; p.Val43fs |
| 1075589 | NM_000077.5:c.204_205delinsTT | Pathogenic | Premature stop; p.Glu69Ter |
| 1076895 | NC_000009.11:g.(?21994128)(21994330_?)del | Pathogenic | Large deletion |
| 1171238 | NM_000077.5:c.106del | Pathogenic | Frameshift; p.Ala36fs |
| 142061 | NM_000077.5:c.47_50del | Pathogenic | Frameshift; p.Leu16fs |
| 1409909 | NM_000077.5:c.95_112del | Pathogenic | Frameshift; p.Leu32_Leu37del |
| 135827 | NM_000077.5:c.-16GGCGGCGGGGAGCAGCATGGAGCC[3] | Pathogenic/LP | Microsatellite; p.Ala4_Pro11dup |
| 142882 | NM_000077.5:c.251A>C | Pathogenic/LP | p.Asp84Ala |
| 141882 | NM_058195.4:c.193+5G>A | Pathogenic/LP | Splice site |
| 1059393 | NM_058195.4:c.172C>T | Likely Pathogenic | Nonsense; p.Gln58Ter |
| 1215320 | NM_000077.5:c.281T>C | Likely Pathogenic | p.Leu94Pro |
| 1345910 | NC_000009.11:g.(?21990646)(21994323_?)del | Likely Pathogenic | Large deletion |
| 1347045 | NM_058195.4:c.87_99del | Likely Pathogenic | Frameshift; p.Leu30fs |
AlphaMissense: Missense Pathogenicity Predictions
Total likely_pathogenic predictions: ~1,200+ variants
TOP 30 Likely-Pathogenic Missense Variants (by AM-Pathogenicity Score)
| Position | Variant | Protein Change | AM-Pathogenicity | Score Interpretation |
|---|---|---|---|---|
| 9:21971036 | T>G | D108A | 0.985 | Very high risk |
| 9:21971037 | C>G | D108H | 0.992 | Very high risk |
| 9:21971018 | G>T | P114H | 0.989 | Very high risk |
| 9:21971045 | T>A | D105V | 0.670 | Moderate-high |
| 9:21970974 | A>T | Y129N | 0.956 | Very high risk |
| 9:21970982 | A>T | V126D | 0.936 | Very high risk |
| 9:21971024 | C>G | R112P | 0.967 | Very high risk |
| 9:21971069 | A>G | L97P | 0.958 | Very high risk |
| 9:21971078 | A>G | L94P | 0.969 | Very high risk |
| 9:21971006 | G>T | A118D | 0.980 | Very high risk |
| 9:21971048 | A>C | L104R | 0.581 | Moderate |
| 9:21970973 | T>G | Y129S | 0.942 | Very high risk |
| 9:21971099 | C>G | R87P | 0.981 | Very high risk |
| 9:21971102 | G>T | A86D | 0.996 | Highest |
| 9:21971103 | C>G | A86P | 0.979 | Very high risk |
| 9:21970970 | A>G | L130P | 0.954 | Very high risk |
| 9:21971055 | C>G | A102P | 0.935 | Very high risk |
| 9:21971147 | T>A | N71I | 0.935 | Very high risk |
| 9:21971105 | G>T | A85D | 0.989 | Very high risk |
| 9:21971061 | C>G | A100P | 0.967 | Very high risk |
| 9:21971009 | A>G | L117P | 0.939 | Very high risk |
| 9:21971063 | C>G | R99P | 0.915 | Very high risk |
| 9:21971138 | T>C | D74G | 0.950 | Very high risk |
| 9:21971080 | C>G | A127P | 0.729 | Moderate-high |
| 9:21971057 | C>T | G101E | 0.759 | Moderate-high |
| 9:21971018 | G>C | P114R | 0.973 | Very high risk |
| 9:21971168 | A>G | L64P | 0.971 | Very high risk |
| 9:21971117 | G>C | P81R | 0.975 | Very high risk |
| 9:21971171 | A>G | L63P | 0.978 | Very high risk |
| 9:21971121 | G>T | S78P | 0.981 | Very high risk |
SpliceAI: Splice Effect Predictions
Total predictions: ~100 variants with splice effects
TOP 30 Splice-Altering Variants (by Score)
| Position | Variant | Effect | Score | Impact |
|---|---|---|---|---|
| 9:21968346 | A>AC | Donor gain | 0.98 | Critical |
| 9:21968243 | C>CC | Acceptor gain | 0.99 | Critical |
| 9:21968240 | TGT>T | Acceptor loss | 0.95 | Critical |
| 9:21968241 | GTC>G | Acceptor loss | 0.95 | Critical |
| 9:21968244 | T>A | Acceptor loss | 0.95 | Critical |
| 9:21968239 | ATGTC>A | Acceptor loss | 0.95 | Critical |
| 9:21968347 | T>C | Donor gain | 0.97 | Critical |
| 9:21968238 | GATGT>G | Acceptor gain | 0.93 | High |
| 9:21968239 | ATGT>A | Acceptor gain | 0.87 | High |
| 9:21968253 | C>CT | Acceptor gain | 0.88 | High |
| 9:21968246 | C>CT | Acceptor gain | 0.86 | High |
| 9:21968247 | A>T | Acceptor gain | 0.86 | High |
| 9:21968254 | A>T | Acceptor gain | 0.83 | High |
| 9:21968245 | G>C | Acceptor loss | 0.89 | High |
| 9:21968342 | A>AC | Donor gain | 0.87 | High |
| 9:21968343 | C>CC | Donor gain | 0.87 | High |
| 9:21968330 | C>CT | Donor gain | 0.54 | Moderate |
| 9:21968370 | TC>T | Donor gain | 0.64 | Moderate |
| 9:21968324 | C>A | Donor gain | 0.53 | Moderate |
| 9:21968326 | C>T | Donor gain | 0.46 | Moderate |
| 9:21968331 | G>T | Donor gain | 0.47 | Moderate |
| 9:21968374 | G>C | Donor gain | 0.54 | Moderate |
| 9:21968376 | G>A | Donor gain | 0.52 | Moderate |
| 9:21968379 | T>C | Donor gain | 0.54 | Moderate |
| 9:21968345 | T>TG | Donor gain | 0.53 | Moderate |
| 9:21968268 | CGT>C | Acceptor loss | 0.46 | Moderate |
| 9:21968270 | T>TC | Acceptor loss | 0.59 | Moderate |
| 9:21968201 | G>T | Acceptor loss | 0.20 | Low |
| 9:21967787 | G>GC | Acceptor gain | 0.36 | Moderate |
| 9:21968385 | C>T | Donor gain | 0.46 | Moderate |
Let me compile and organize the comprehensive pathway and Gene Ontology data for CDKN2A:
Pathways & Gene Ontology
Reactome Pathways
Total: 22 pathways
| Pathway ID | Pathway Name | Disease |
|---|---|---|
| R-HSA-2559580 | Oxidative Stress Induced Senescence | No |
| R-HSA-2559582 | Senescence-Associated Secretory Phenotype (SASP) | No |
| R-HSA-2559585 | Oncogene Induced Senescence | No |
| R-HSA-69231 | Cyclin D associated events in G1 | No |
| R-HSA-8853884 | Transcriptional Regulation by VENTX | No |
| R-HSA-9630791 | Evasion of Oncogene Induced Senescence Due to Defective p16INK4A binding to CDK4 | Yes |
| R-HSA-9630794 | Evasion of Oncogene Induced Senescence Due to Defective p16INK4A binding to CDK4 and CDK6 | Yes |
| R-HSA-9632697 | Evasion of Oxidative Stress Induced Senescence Due to Defective p16INK4A binding to CDK4 | Yes |
| R-HSA-9632700 | Evasion of Oxidative Stress Induced Senescence Due to Defective p16INK4A binding to CDK4 and CDK6 | Yes |
| R-HSA-9825892 | Regulation of MITF-M-dependent genes involved in cell cycle and proliferation | No |
| R-HSA-111471 | Apoptotic factor-mediated response | No |
| R-HSA-3108214 | SUMOylation of DNA damage response and repair proteins | No |
| R-HSA-3232118 | SUMOylation of transcription factors | No |
| R-HSA-6804757 | Regulation of TP53 Degradation | No |
| R-HSA-69541 | Stabilization of p53 | No |
| R-HSA-8941858 | Regulation of RUNX3 expression and activity | No |
| R-HSA-9645722 | Defective Intrinsic Pathway for Apoptosis Due to p14ARF Loss of Function | Yes |
| R-HSA-9646303 | Evasion of Oncogene Induced Senescence Due to p14ARF Defects | Yes |
| R-HSA-9646304 | Evasion of Oxidative Stress Induced Senescence Due to p14ARF Defects | Yes |
| R-HSA-9759194 | Nuclear events mediated by NFE2L2 | No |
MSigDB Gene Sets
Total: 804 gene sets (includes GO, pathway, disease, and TF target gene sets)
Key categories represented:
- Gene Ontology annotations (GO:BP, GO:MF, GO:CC)
- Reactome pathways (C2:CP)
- BioCarta pathways (C2:CP)
- KEGG pathways (C2:CP)
- Disease/phenotype associations (C5:HP)
- Transcription factor targets (C3:TFT)
- Hallmark signatures
- Oncogenic and immunologic signatures
Gene Ontology Annotations
Biological Process (BP)
Total: 55 unique BP terms
| GO ID | Term |
|---|---|
| GO:0000122 | Negative regulation of transcription by RNA polymerase II |
| GO:0000209 | Protein polyubiquitination |
| GO:0000422 | Autophagy of mitochondrion |
| GO:0001953 | Negative regulation of cell-matrix adhesion |
| GO:0007265 | Ras protein signal transduction |
| GO:0008285 | Negative regulation of cell population proliferation |
| GO:0009303 | rRNA transcription |
| GO:0016925 | Protein sumoylation |
| GO:0030216 | Keratinocyte differentiation |
| GO:0030308 | Negative regulation of cell growth |
| GO:0030575 | Nuclear body organization |
| GO:0030889 | Negative regulation of B cell proliferation |
| GO:0031647 | Regulation of protein stability |
| GO:0031648 | Protein destabilization |
| GO:0033088 | Negative regulation of immature T cell proliferation in thymus |
| GO:0033235 | Positive regulation of protein sumoylation |
| GO:0033598 | Mammary gland epithelial cell proliferation |
| GO:0033600 | Negative regulation of mammary gland epithelial cell proliferation |
| GO:0034393 | Positive regulation of smooth muscle cell apoptotic process |
| GO:0034504 | Protein localization to nucleus |
| GO:0035019 | Somatic stem cell population maintenance |
| GO:0042593 | Glucose homeostasis |
| GO:0043065 | Positive regulation of apoptotic process |
| GO:0043517 | Positive regulation of DNA damage response, signal transduction by p53 class mediator |
| GO:0043616 | Keratinocyte proliferation |
| GO:0045736 | Negative regulation of cyclin-dependent protein serine/threonine kinase activity |
| GO:0045892 | Negative regulation of DNA-templated transcription |
| GO:0045893 | Positive regulation of DNA-templated transcription |
| GO:0045944 | Positive regulation of transcription by RNA polymerase II |
| GO:0046822 | Regulation of nucleocytoplasmic transport |
| GO:0046825 | Regulation of protein export from nucleus |
| GO:0048103 | Somatic stem cell division |
| GO:0050821 | Protein stabilization |
| GO:0051726 | Regulation of cell cycle |
| GO:0051882 | Mitochondrial depolarization |
| GO:0060057 | Apoptotic process involved in mammary gland involution |
| GO:0060058 | Positive regulation of apoptotic process involved in mammary gland involution |
| GO:0070301 | Cellular response to hydrogen peroxide |
| GO:0070534 | Protein K63-linked ubiquitination |
| GO:0090398 | Cellular senescence |
| GO:0090399 | Replicative senescence |
| GO:0090402 | Oncogene-induced cell senescence |
| GO:0097190 | Apoptotic signaling pathway |
| GO:1900182 | Positive regulation of protein localization to nucleus |
| GO:1901798 | Positive regulation of signal transduction by p53 class mediator |
| GO:1902570 | Protein localization to nucleolus |
| GO:1990000 | Amyloid fibril formation |
| GO:2000045 | Regulation of G1/S transition of mitotic cell cycle |
| GO:2000059 | Negative regulation of ubiquitin-dependent protein catabolic process |
| GO:2000111 | Positive regulation of macrophage apoptotic process |
Molecular Function (MF)
Total: 17 unique MF terms
| GO ID | Term |
|---|---|
| GO:0002039 | p53 binding |
| GO:0003677 | DNA binding |
| GO:0003723 | RNA binding |
| GO:0004861 | Cyclin-dependent protein serine/threonine kinase inhibitor activity |
| GO:0019789 | SUMO transferase activity |
| GO:0019901 | Protein kinase binding |
| GO:0051059 | NF-kappaB binding |
| GO:0055104 | Ligase inhibitor activity |
| GO:0055105 | Ubiquitin-protein transferase inhibitor activity |
| GO:0061629 | RNA polymerase II-specific DNA-binding transcription factor binding |
| GO:0097371 | MDM2/MDM4 family protein binding |
| GO:0097718 | Disordered domain specific binding |
| GO:1990948 | Ubiquitin ligase inhibitor activity |
Cellular Component (CC)
Total: 10 unique CC terms
| GO ID | Term |
|---|---|
| GO:0005634 | Nucleus |
| GO:0005654 | Nucleoplasm |
| GO:0005730 | Nucleolus |
| GO:0005737 | Cytoplasm |
| GO:0005739 | Mitochondrion |
| GO:0005759 | Mitochondrial matrix |
| GO:0005829 | Cytosol |
| GO:0032991 | Protein-containing complex |
| GO:0035985 | Senescence-associated heterochromatin focus |
Protein interactions & networks
Protein-Protein Interactions (PPIs)
Total Interaction Count (Approximate):
- STRING: ~8,510 interactions
- IntAct: ~146 interactions (curated experimental evidence)
- BioGRID: ~652 interactions
- Combined databases: ~10,000+ unique interactions
TOP 30 Highest-Confidence Interacting Proteins
| Rank | Protein | Gene Symbol | Database | Score/Confidence | Interaction Type |
|---|---|---|---|---|---|
| 1 | P11802 | CDK6 | STRING | 999 | Physical association |
| 2 | Q00534 | CDK4 | STRING | 999 | Physical association |
| 3 | Q00987 | CDK4 (variant) | STRING | 999 | Physical association |
| 4 | P06748 | GTP-binding protein | STRING | 995 | Physical association |
| 5 | P24941 | CDK2 | STRING | 993 | Physical association |
| 6 | Q15438 | RB1 | STRING | 976 | Physical association |
| 7 | P04637 | TP53 | STRING | 970 | Physical association |
| 8 | Q96S94 | HDAC1 | STRING | 962 | Physical association |
| 9 | P24385 | CCND1 | STRING | 947 | Physical association |
| 10 | P10947 | TUBA1A | STRING | 936 | Physical association |
| 11 | P38936 | CCNE1 | STRING | 934 | Physical association |
| 12 | P01106 | HRAS | STRING | 929 | Physical association |
| 13 | Q16665 | MAPK3 | STRING | 928 | Physical association |
| 14 | Q01094 | NRAS | STRING | 921 | Physical association |
| 15 | P01116 | KRAS | STRING | 918 | Physical association |
| 16 | Q13126 | CRK | STRING | 918 | Physical association |
| 17 | P60484 | ACTB | STRING | 908 | Physical association |
| 18 | P00533 | EGFR | STRING | 907 | Physical association |
| 19 | Q9NXV6 | CDKN2A-interacting protein | STRING | 889 | Physical association |
| 20 | P01112 | KRAS (variant) | STRING | 893 | Physical association |
| 21 | P15056 | BRAF | STRING | 886 | Physical association |
| 22 | Q9NS23 | MAP2K2 | STRING | 878 | Physical association |
| 23 | P16455 | PTEN | STRING | 876 | Physical association |
| 24 | P46527 | CCNK | STRING | 866 | Physical association |
| 25 | P35222 | CCNC | STRING | 862 | Physical association |
| 26 | P40692 | TP53BP1 | STRING | 856 | Physical association |
| 27 | Q13485 | CCNA1 | STRING | 851 | Physical association |
| 28 | Q13315 | CCNB1 | STRING | 846 | Physical association |
| 29 | P06400 | RPS3 | STRING | 842 | Physical association |
| 30 | P01111 | KRAS (variant 2) | STRING | 838 | Physical association |
High-Confidence Direct Interactions (IntAct):
- CDK4 (P06749) - 0.960 confidence - Direct binding and physical association
- CDK6 (P11802) - 0.950 confidence - Direct binding and physical association
- PCNA (P12004) - 0.610 confidence - Direct interaction, physical association, colocalization
- GMNN (O75496) - 0.590 confidence - Direct interaction
- MCM6 (Q7ZLE7) - 0.500 confidence - Physical association
- CDC6 - 0.440 confidence - Direct interaction (DNA replication initiation)
- CDC45 - 0.440 confidence - Direct interaction
- MCM5, MCM2, MCM10 - 0.440 confidence - Direct interactions (MCM complex)
- ORC4, ORC5 - 0.440 confidence - Direct interactions (origin recognition complex)
- CDC7 - 0.440 confidence - Direct interaction (S-phase kinase)
Protein Similarity Data
TOP 20 Structural/Embedding Similarity (ESM2 - Language Model Embeddings):
| Rank | UniProt ID | Gene/Protein | Top Similarity Score | Avg Similarity Score |
|---|---|---|---|---|
| 1 | P9WK29 | CDKN2A ortholog | 0.9996 | 0.9599 |
| 2 | P9WK28 | CDKN2A ortholog | 0.9996 | 0.9576 |
| 3 | P55271 | CDKN2A-like | 0.9987 | 0.9780 |
| 4 | P55272 | CDKN2A-like | 0.9987 | 0.9784 |
| 5 | P55273 | CDKN2A-like | 0.9980 | 0.9802 |
| 6 | Q29RV0 | CDKN2A ortholog | 0.9980 | 0.9801 |
| 7 | Q45218 | CDKN2A ortholog | 0.9977 | 0.9638 |
| 8 | P55542 | CDKN2A ortholog | 0.9977 | 0.9643 |
| 9 | Q2KJD8 | CDKN2A ortholog | 0.9974 | 0.9767 |
| 10 | P42772 | CDKN2A isoform | 0.9974 | 0.9768 |
| 11 | P51480 | CDK inhibitor | 0.9962 | 0.9809 |
| 12 | Q6AYD1 | CDK inhibitor | 0.9961 | 0.9736 |
| 13 | Q9R0Z3 | CDK inhibitor | 0.9962 | 0.9816 |
| 14 | Q60773 | CDKN2A ortholog (mouse) | 0.9951 | 0.9808 |
| 15 | P42771 | CDKN2A (self) | 0.9950 | 0.9787 |
| 16 | P33651 | CDK inhibitor | 0.9903 | 0.9789 |
| 17 | O77617 | CDKN2A ortholog | 0.9894 | 0.9792 |
| 18 | P54741 | CDK inhibitor | 0.9881 | 0.9765 |
| 19 | P54742 | CDK inhibitor | 0.9881 | 0.9694 |
| 20 | Q06929 | CDK inhibitor | 0.9862 | 0.9786 |
TOP 20 Sequence Homology (DIAMOND - Sequence Identity/Similarity):
| Rank | UniProt ID | Gene/Protein | Sequence Identity (%) | E-value/BitScore |
|---|---|---|---|---|
| 1 | P55271 | CDKN2A-like protein | 96.90 | 254 |
| 2 | P55272 | CDKN2A-like protein | 96.90 | 255 |
| 3 | Q29RV0 | CDKN2A ortholog | 89.20 | 238 |
| 4 | Q60773 | CDKN2A ortholog (rodent) | 89.20 | 236 |
| 5 | P42771 | CDKN2A (human/self) | 89.20 | 209 |
| 6 | P42772 | CDKN2A isoform | 88.30 | 228 |
| 7 | Q2KJD8 | CDKN2A ortholog | 87.50 | 225 |
| 8 | P42773 | CDKN2A variant | 85.70 | 246 |
| 9 | Q60772 | CDKN2A variant | 85.70 | 246 |
| 10 | P51480 | CDK inhibitor family | 76.20 | 235 |
| 11 | Q9R0Z3 | CDK inhibitor | 78.00 | 238 |
| 12 | O77617 | CDKN2A ortholog | 70.40 | 175 |
| 13 | Q28FJ2 | CDKN2A ortholog | 66.10 | 171 |
| 14 | Q18297 | CDK inhibitor | 46.70 | 116 |
| 15 | P73425 | CDKN2B (p15) | ~70 | ~200 |
Interaction Network Summary
Key Functional Modules:
- Cell Cycle Regulation: CDK4/6, CCND1, CCNE1, CCNA1, CCNB1, RB1
- Tumor Suppression: TP53, TP53BP1, PTEN, RB1
- DNA Replication: PCNA, MCM complex (MCM2/5/6/10), CDC6, CDC45, CDC7, ORC4/5
- RAS Pathway: HRAS, KRAS, NRAS, BRAF, EGFR, MEK2
- Chromatin Remodeling: HDAC1
- Signal Transduction: MAPK3, CRK, ERK2
Primary Interaction Mechanism: CDKN2A functions as a CDK4/6 inhibitor through direct binding, blocking cell cycle progression in G1/S transition. It also interacts with DNA replication machinery to suppress S-phase entry.
Based on my analysis of the biobtree data, let me provide the regulatory summary:
Transcription factor regulatory data
CDKN2A is NOT a transcription factor. CDKN2A (cyclin-dependent kinase inhibitor 2A, p16-INK4a) is a cell cycle regulator that inhibits cyclin-dependent kinases (CDK4/6) and lacks DNA-binding transcription factor activity. It has no known JASPAR DNA-binding motifs.
Upstream regulators of CDKN2A
CDKN2A is regulated by ~100 transcription factors. Key upstream regulators include:
| Transcription Factor | Regulation Type | Confidence | Evidence |
|---|---|---|---|
| E2F1 | Activation | High | collectri |
| E2F3 | Activation | High | collectri |
| E2F2 | Activation | Low | collectri |
| MYC | Activation | High | collectri |
| NFKB | Activation | High | collectri |
| JUN | Activation | High | collectri |
| ID1, ID2, ID3 | Activation | High | collectri |
| HBP1 | Activation | High | collectri |
| ATF2 | Activation | High | collectri |
| FOXA1 | Unknown | High | collectri |
| PAX3 | Repression | High | collectri |
| MITF | Repression | High | collectri |
| DNMT1 | Repression | High | collectri |
| MTF2 | Repression | High | collectri |
| CTCF | Repression | High | collectri |
| FOXM1 | Repression | Low | collectri |
| EZH2 | Repression | Low | collectri |
Additional regulators with High confidence include: CDX2, CREB1/3, DBP, EGR2, ELF4, ERG, ETS1/2, GATA3, GRHL3, LEF1, MAFB, MEOX1/2, MYBL2, NFYA, POU2F1, and >40 others documented in collectri/TFactS.
Minimal downstream activity: CDKN2A represses FANCD2 (DNA repair gene) with High confidence per TFactS.
Drug & pharmacology data
CDKN2A is not a direct drug target. However, it is a VIP pharmacogene (Very Important Pharmacogene) in PharmGKB with variant annotations affecting drug response.
CDKN2A encodes p16/INK4a, a cyclin-dependent kinase inhibitor that regulates CDK4/CDK6 activity. Drugs targeting downstream CDK4/CDK6 proteins interact with the CDKN2A pathway:
Targeting molecules: CDK4/6 inhibitors (Phase 4 approved)
| Molecule ID | Name | Trade Name | Development Phase | Mechanism |
|---|---|---|---|---|
| CHEMBL189963 | Palbociclib | Ibrance | 4 (Approved) | CDK4/6 inhibitor |
| CHEMBL3545110 | Ribociclib | Kisqali | 4 (Approved) | CDK4/6 inhibitor |
| CHEMBL3301610 | Abemaciclib | Verzenio | 4 (Approved) | CDK4/6 inhibitor |
Total ChEMBL molecules: 3 major approved CDK4/6 inhibitors (represents majority of CDKN2A pathway-relevant drugs)
Pharmacogenomics: CDKN2A drug-gene interactions
Palbociclib (PA166153469 in PharmGKB):
- Evidence type: VariantAnnotation (6 variant annotations)
- Related genes: CDKN2A associated via VariantAnnotation evidence
- Label status: Testing Required (FDA/EMA/HCSC labels)
- Additional associations: ERBB2, ESR1, ESR2, PGR (predictive markers for breast cancer response)
Mechanism context: CDKN2A variants may affect p16 expression/function, influencing:
- CDK4/6 inhibitor sensitivity
- RB pathway activation status
- Cell cycle checkpoint control in cancer cells
Dosing: No CDKN2A-specific dosing guidelines documented. Standard CDK4/6 inhibitor dosing applies (palbociclib 125 mg daily 3 weeks on/1 week off).
Note: CDKN2A is primarily a tumor suppressor and pathway biomarker rather than a direct drug target. Clinical relevance relates to loss-of-function mutations in melanoma and pancreatic cancer, not pharmacological targeting of the intact protein.
Expression profiles
Tissue Expression
| Rank | Tissue | Expression Score | Quality |
|---|---|---|---|
| 1 | Parotid gland | 93.57 | Silver |
| 2 | Cervix squamous epithelium | 92.83 | Silver |
| 3 | Pituitary gland | 92.49 | Gold |
| 4 | Adenohypophysis | 91.60 | Gold |
| 5 | Subthalamic nucleus | 88.38 | Silver |
| 6 | Tongue | 88.36 | Silver |
| 7 | Ventral tegmental area | 88.11 | Silver |
| 8 | Pharyngeal mucosa | 87.98 | Gold |
| 9 | Superior surface of tongue | 87.97 | Gold |
| 10 | Lateral globus pallidus | 87.93 | Silver |
| 11 | Dorsal plus ventral thalamus | 87.71 | Silver |
| 12 | Pericardium | 87.62 | Gold |
| 13 | Inferior vagus X ganglion | 87.61 | Silver |
| 14 | Nipple | 87.43 | Silver |
| 15 | Lower esophagus mucosa | 87.34 | Gold |
| 16 | Trigeminal ganglion | 86.57 | Gold |
| 17 | Dorsal root ganglion | 86.51 | Gold |
| 18 | Nasal cavity epithelium | 85.99 | Silver |
| 19 | Trachea | 85.88 | Silver |
| 20 | Left testis | 85.70* | - |
| 21 | Right testis | 85.70* | - |
| 22 | Testis | 85.70* | - |
| 23 | Adrenal cortex | 85.52* | - |
| 24 | Left adrenal gland | 85.50* | - |
| 25 | Choroid plexus epithelium | 85.45* | - |
| 26 | Left adrenal gland cortex | 85.40* | - |
| 27 | Right adrenal gland | 85.38* | - |
| 28 | Olfactory segment nasal mucosa | 85.28* | - |
| 29 | Right adrenal gland cortex | 85.25* | - |
| 30 | Synovial joint | 85.20* | - |
Expression Breadth: Ubiquitous (220/276 present conditions)
Data Source: Bgee (Expression Atlas)
Cell Type Expression
| Cell Type | Bgee Association |
|---|---|
| Male germ line stem cell (sensu Vertebrata) | testis |
| Stromal cell of endometrium | endometrium |
| Pancreatic ductal cell | pancreas |
| Buccal mucosa cell | oral cavity |
| Granulocyte | blood/tissues |
| Male germ cell | testis |
| Sperm | testis |
| Bone marrow cell | bone marrow |
| Leukocyte | blood |
| Mononuclear leukocyte | blood |
| Monocyte | blood |
| Bronchial epithelial cell | lung |
Single-cell Expression Datasets
Notable CDKN2A Expression in Single-cell Studies:
Tumor-infiltrating lymphocytes in metastatic uveal melanoma (E-CURD-84)
- 40,656 cells analyzed
- CDKN2A shows elevated expression in cluster 2 (score: 24.96, log2FC: 1.59)
- Cell type: Lymphocytes
- Tissue: Uvea
Human melanoma cell lines (E-GEOD-81383)
- 226 cells; 3 melanoma lines (Ma-Mel-123, -108, -93)
Glioblastoma infiltrating cells (E-GEOD-84465)
- 3,588 cells; diffuse neoplastic infiltrating cells at tumor migrating front
Lung tumor endothelial cells (E-MTAB-6308)
- 113,132 cells; heterogeneous lung endothelial populations across species/models
Induced Neural Plate Border Stem Cells (E-MTAB-6911)
- 336 cells; neural differentiation potential
Ovarian cancer ex vivo models (E-MTAB-8559)
- 20,982 cells; reveals mitotic heterogeneity in living biobank
Key Patterns:
- CDKN2A is expressed across 5 marker datasets in SCXA (5/5 experiments have CDKN2A as marker gene)
- Expression spans 529 cell clusters across tumor and developmental contexts
- Notably elevated in immune infiltrates and proliferative tumor cells
- Mean expression 34.26 across datasets; maximum 655.14 in specific clusters
Disease associations
Mendelian / Monogenic Diseases
| Disease | Disease IDs | Inheritance Pattern | Evidence Level | Databases |
|---|---|---|---|---|
| Melanoma-pancreatic cancer syndrome | OMIM:606719, MONDO:0011713, ORPHANET:1333 | Autosomal dominant | Definitive / Strong | Ambry Genetics, Genomics England, Labcorp, G2P |
| Melanoma and neural system tumor syndrome | OMIM:155755, MONDO:0007967, ORPHANET:252206 | Autosomal dominant | Limited | Ambry Genetics |
| Familial atypical multiple mole melanoma syndrome | ORPHANET:404560, MONDO:0018961 | Autosomal dominant | Supportive | Orphanet |
| Melanoma, cutaneous malignant, susceptibility to, 2 | OMIM:155601, MONDO:0007964 | Autosomal dominant | Definitive | G2P |
| Familial melanoma | ORPHANET:618 | Autosomal dominant | — | Curated |
| Li-Fraumeni syndrome | MONDO:0018875, ORPHANET:524 | Autosomal dominant | — | Curated |
| Familial pancreatic carcinoma | MONDO:0015278, ORPHANET:1333 | Autosomal dominant | — | Curated |
| Familial multiple meningioma | MONDO:0011789, ORPHANET:263662 | Autosomal dominant | — | Curated |
| Acute lymphoblastic leukemia (hereditary predisposition) | MONDO:0004967, ORPHANET:513 | Autosomal dominant | — | Curated |
| Retinoblastoma (hereditary predisposition) | MONDO:0008380, ORPHANET:790 | Autosomal dominant | — | Curated |
Phenotype Associations (HPO Terms)
Top 30 associated phenotypes:
- HP:0000006 – Autosomal dominant inheritance
- HP:0002861 – Melanoma
- HP:0002894 – Neoplasm of the pancreas
- HP:0003002 – Breast carcinoma
- HP:0003003 – Colon cancer
- HP:0012056 – Cutaneous melanoma
- HP:0100013 – Neoplasm of the breast
- HP:0100526 – Neoplasm of the lung
- HP:0002864 – Lymphosarcoma
- HP:0001909 – Leukemia
- HP:0006721 – Acute lymphoblastic leukemia
- HP:0004808 – Acute myeloid leukemia
- HP:0006725 – Pancreatic adenocarcinoma
- HP:0002665 – Lymphoma
- HP:0012189 – Hodgkin lymphoma
- HP:0012539 – Non-Hodgkin lymphoma
- HP:0009726 – Renal neoplasm
- HP:0010788 – Testicular neoplasm
- HP:0025318 – Ovarian carcinoma
- HP:0002890 – Thyroid carcinoma
- HP:0100743 – Neoplasm of the rectum
- HP:0006753 – Neoplasm of the stomach
- HP:0012126 – Stomach cancer
- HP:0012125 – Prostate cancer
- HP:0002896 – Neoplasm of the liver
- HP:0007378 – Neoplasm of the gastrointestinal tract
- HP:0009592 – Astrocytoma
- HP:0012174 – Glioblastoma multiforme
- HP:0100006 – Neoplasm of the central nervous system
- HP:0100242 – Sarcoma
Complex Disease / GWAS Associations
Top 30 GWAS associations (by p-value):
| Trait | Associated Gene | Chromosome | P-value | Study ID |
|---|---|---|---|---|
| Type 2 diabetes | CDKN2B-AS1 | 9 | 1.0e-115 | GCST009379_256 |
| Type 2 diabetes | CDKN2B-AS1 | 9 | 1.0e-87 | GCST007847_110 |
| Type 2 diabetes | CDKN2B-AS1 | 9 | 4.0e-164 | GCST010118_115 |
| B-cell acute lymphoblastic leukaemia | CDKN2A | 9 | 8.0e-35 | GCST009638_3 |
| Acute lymphoblastic leukemia (childhood, B cell precursor) | CDKN2A | 9 | 1.0e-27 | GCST005832_4 |
| Type 2 diabetes | CDKN2B-AS1 | 9 | 5.0e-33 | GCST003400_44 |
| Myocardial infarction (early onset) | CDKN2B-AS1 | 9 | 3.0e-44 | GCST000340_1 |
| Plateletcrit | CDKN2A | 9 | 4.0e-89 | GCST90002400_4 |
| Platelet count | CDKN2A | 9 | 5.0e-24 | GCST004603_137 |
| Platelet count | CDKN2A | 9 | 9.0e-65 | GCST90002402_175 |
| Lymphocyte count | CDKN2A | 9 | 1.0e-71 | GCST90002388_504 |
| Myocardial infarction | CDKN2B-AS1 | 9 | 1.0e-20 | GCST000030_1 |
| Myocardial infarction | CDKN2B-AS1 | 9 | 7.0e-13 | GCST003471_7 |
| Coronary heart disease | CDKN2B-AS1 | 9 | 1.0e-22 | GCST000998_24 |
| Coronary heart disease | CDKN2B-AS1 | 9 | 6.0e-16 | GCST001260_2 |
| Coronary artery disease | CDKN2B-AS1 | 9 | 5.0e-14 | GCST000945_3 |
| Coronary artery disease | CDKN2B-AS1 | 9 | 2.0e-13 | GCST003470_7 |
| Glioma | CDKN2B-AS1 | 9 | 1.0e-45 | GCST004347_7 |
| Glioblastoma | CDKN2B-AS1 | 9 | 7.0e-45 | GCST004349_7 |
| Glioma | CDKN2B-AS1 | 9 | 5.0e-16 | GCST001058_3 |
| Intracranial aneurysm | CDKN2B-AS1 | 9 | 2.0e-22 | GCST000646_5 |
| Intracranial aneurysm | CDKN2B-AS1 | 9 | 1.0e-10 | GCST000262_3 |
| Breast cancer | CDKN2B-AS1 | 9 | 1.0e-15 | GCST004988_267 |
| Breast cancer | CDKN2B-AS1 | 9 | 6.0e-08 | GCST001937_28 |
| Melanoma | MTAP | 9 | 4.0e-07 | GCST000437_2 |
| Multiple myeloma | CDKN2A | 9 | 2.0e-13 | GCST004483_5 |
| Monocyte count | CDKN2A | 9 | 2.0e-29 | GCST90002393_240 |
| White blood cell count | CDKN2A | 9 | 2.0e-32 | GCST90002407_34 |
| Nasopharyngeal carcinoma | CDKN2A | 9 | 1.0e-06 | GCST005113_5 |
| Basal cell carcinoma | CDKN2B-AS1 | 9 | 3.0e-10 | GCST002331_7 |