CDKN2A Gene Complete Identifier and Functional Mapping Reference

Provide a comprehensive cross-database identifier and functional mapping reference for human CDKN2A — a definitive lookup resource covering: ### …

Provide a comprehensive cross-database identifier and functional mapping reference for human CDKN2A — a definitive lookup resource covering: ### Section 1: Gene identifiers For human gene CDKN2A, list ALL gene-level database identifiers. Required: - HGNC ID and approved symbol - Ensembl gene ID (ENSG...) - NCBI Entrez Gene ID - OMIM gene/locus ID - Genomic location: chromosome, start position, end position, strand (GRCh38) ### Section 2: Transcript identifiers For human gene CDKN2A, list ALL transcript-level identifiers. Required: - Ensembl transcripts: ALL ENST IDs with biotype. Total count. - RefSeq transcripts: ALL NM_ mRNA accessions. Mark which is MANE Select. - CCDS IDs. - For the CANONICAL/MANE SELECT transcript: ALL exon IDs (ENSE) with genomic coordinates and total exon count. ### Section 3: Protein identifiers For human gene CDKN2A protein product(s), list ALL protein-level identifiers. Required: - UniProt accessions: ALL entries (reviewed and unreviewed). Mark the canonical reviewed entry. - RefSeq protein: ALL NP_ accessions. - Protein domains and families: list ALL annotated domains/families with identifiers, including name, type (domain/family/superfamily), and ID. - Antibody availability: known antibody resources for the protein. ### Section 4: Structure For human gene CDKN2A protein, list ALL structural data. Required: - Experimental structures: ALL PDB IDs. For each: experimental method (X-ray/NMR/Cryo-EM) and resolution. Total count. - Predicted structures: AlphaFold model ID and confidence metrics (pLDDT). ### Section 5: Cross-species orthologs For human gene CDKN2A, list orthologous genes in key model organisms. Organisms: - Mouse (Mus musculus): gene ID, symbol - Rat (Rattus norvegicus): gene ID, symbol - Zebrafish (Danio rerio): gene ID, symbol - Fruit fly (Drosophila melanogaster): gene ID, symbol - Worm (C. elegans): gene ID, symbol - Yeast (S. cerevisiae): gene ID, symbol ### Section 6: Clinical variants & AI predictions For human gene CDKN2A, summarize clinical variants and AI predictions. Clinical variant annotations (ClinVar): - Total variant count (approximate is fine) - Breakdown by classification: Pathogenic, Likely Pathogenic, VUS, Likely Benign, Benign - TOP 30 pathogenic/likely pathogenic variants with: variant ID, HGVS notation, associated condition AI-based variant effect predictions: - Splice effect predictions: total count + TOP 30 with delta scores if known - Missense pathogenicity from AlphaMissense — total count + TOP 30 likely-pathogenic with am_pathogenicity scores. ### Section 7: Pathways & Gene Ontology For human gene CDKN2A, list biological pathways and Gene Ontology annotations. Pathway membership: - ALL biological pathways this gene participates in, with pathway IDs and names - Total pathway count Gene Ontology: - Biological Process: count and TOP 20 terms with GO IDs - Molecular Function: count and TOP 20 terms with GO IDs - Cellular Component: count and TOP 20 terms with GO IDs ### Section 8: Protein interactions & networks For human gene CDKN2A protein, summarize protein interactions and networks. Protein-protein interactions (STRING, IntAct, BioGRID, etc.): - Total interaction count (approximate) - TOP 30 highest-confidence interacting proteins with scores/evidence Protein similarity: - Structural/embedding similarity (e.g. Foldseek, ESM): TOP 20 similar proteins with scores - Sequence homology: TOP 20 homologous proteins with identity/similarity ### Section 9: Transcription factor regulatory data For human gene CDKN2A, summarize transcription factor regulatory data. If CDKN2A is a transcription factor: - Downstream targets: total count + TOP 30 with regulation type (activates/represses) and evidence - DNA binding motifs from JASPAR — all known motif IDs and motif family classification. Regardless: - Upstream regulators: TFs that regulate CDKN2A — names with evidence type (ChIP-seq / predicted / experimentally validated) If CDKN2A is not a transcription factor, say so briefly and skip the downstream/motif sections. ### Section 10: Drug & pharmacology data For human gene CDKN2A protein as a drug target, summarize pharmacology data. If CDKN2A is a known drug target: - Targeting molecules: total count in ChEMBL/DrugBank + TOP 30 by development phase (molecule ID, name, mechanism, highest phase) - Clinical trials: TOP 20 involving drugs targeting this gene — trial ID, phase, status, intervention - Pharmacogenomics: known drug-gene interactions affecting drug response + dosing guidelines if any If CDKN2A is not currently a drug target, say so briefly. ### Section 11: Expression profiles For human gene CDKN2A, summarize expression profiles. Tissue expression (GTEx, HPA, Bgee, etc.): - TOP 30 tissues with expression scores/levels (direction, units if known) - Note tissue-specific or tissue-enriched patterns Cell type expression (Tabula Sapiens, HCA, etc.): - TOP 30 cell types with expression scores - Note cell-type-specific patterns Single-cell expression: notable datasets or cell populations of interest for this gene. ### Section 12: Disease associations For human gene CDKN2A, summarize disease associations. Mendelian / monogenic disease: - Diseases caused by mutations in CDKN2A: disease name, disease ID (OMIM/Orphanet/Mondo), inheritance pattern, evidence level - Include all directly linked conditions Phenotype associations: - Clinical phenotypes associated with the gene (HPO terms where known) - TOP 30 phenotype terms with HPO IDs Complex-disease / GWAS: - Traits and diseases significantly associated via GWAS: trait name, variant, effect size, study where known - TOP 30 GWAS associations

CDKN2A

Executive summary

CDKN2A (cyclin-dependent kinase inhibitor 2A, chromosome 9p21) is one of the most important tumor suppressor genes in human cancer, encoding two functionally distinct proteins from the same locus: p16-INK4a and p14ARF. p16-INK4a directly inhibits CDK4 and CDK6, blocking G1/S cell cycle progression and preventing RB phosphorylation, while p14ARF stabilizes TP53 by inhibiting MDM2. Germline loss-of-function mutations cause melanoma-pancreatic cancer syndrome (autosomal dominant), and somatic inactivation of CDKN2A is among the most frequent events across human cancers. The locus harbors ~1,594 ClinVar variants (roughly 80 pathogenic or likely pathogenic) and over 1,200 AlphaMissense-predicted damaging missense variants, with particularly high-risk changes clustering in the ankyrin-repeat CDK-binding domain. GWAS links the 9p21 region to type 2 diabetes, coronary artery disease, glioma, and B-cell acute lymphoblastic leukemia. Although CDKN2A itself is not directly druggable, loss of p16 sensitizes tumors to CDK4/6 inhibitors (palbociclib, ribociclib, abemaciclib), making CDKN2A status a clinically relevant predictive biomarker.

CDKN2A — Reference

Cross-database identifier and functional mapping reference for CDKN2A.

Gene identifiers

  • HGNC ID: HGNC:1787
  • Approved symbol: CDKN2A
  • Ensembl gene ID: ENSG00000147889
  • NCBI Entrez Gene ID: 1029
  • OMIM gene/locus ID: 600160
  • Genomic location (GRCh38):
    • Chromosome: 9
    • Start: 21,967,752 bp
    • End: 21,995,301 bp
    • Strand: −

Transcript identifiers

Ensembl transcripts: 14 total

Ensembl IDBiotype
ENST00000304494protein_coding
ENST00000380150protein_coding_CDS_not_defined
ENST00000380151nonsense_mediated_decay
ENST00000470819protein_coding_CDS_not_defined
ENST00000479692protein_coding
ENST00000494262protein_coding
ENST00000497750protein_coding
ENST00000498124protein_coding
ENST00000498628protein_coding
ENST00000530628protein_coding
ENST00000577854protein_coding_CDS_not_defined
ENST00000578845protein_coding
ENST00000579122protein_coding
ENST00000579755protein_coding

RefSeq mRNA (Human, Chromosome 9): 5 total

NM AccessionMANE Select
NM_000077
NM_001195132
NM_001363763
NM_058195
NM_058197

CCDS IDs: 4 total

  • CCDS56565
  • CCDS6510
  • CCDS6511
  • CCDS87644

MANE Select Transcript Exons (ENST00000304494 / NM_000077): 3 exons

Exon IDStartEndStrandChr
ENSE0000183380421974678219748579
ENSE0000349605321970902219712089
ENSE0000352952721967752219682429

Protein identifiers

UniProt Accessions

AccessionProteinStatus
P42771Cyclin-dependent kinase inhibitor 2A (p16-INK4a)Reviewed (Canonical)
Q8N726Tumor suppressor ARF (p14ARF)Reviewed
J3QRG6CDKN2AUnreviewed
K7ENC6CDKN2AUnreviewed
K7ES20CDKN2AUnreviewed
K7PML8CDKN2AUnreviewed

RefSeq Protein Accessions (NP_)

AccessionGene/ProteinStatusNotes
NP_000068CDKN2AREVIEWEDMANE Select (primary)
NP_001182061CDKN2AREVIEWED
NP_001341006ARFVALIDATEDAlternative reading frame
NP_001350692CDKN2AREVIEWED
NP_478102CDKN2AREVIEWED
NP_478104CDKN2AREVIEWED

Protein Domains and Families

p16-INK4a (P42771)

IDDomain/Family NameTypeDatabase
IPR050776Ankyrin Repeat and Cyclin-Dependent Kinase InhibitorFamilyInterPro
IPR036770Ankyrin repeat-containing domain superfamilyHomologous SuperfamilyInterPro
PTHR24201Cyclin-dependent kinase inhibitorFamilyPANTHER
PTHR24201:SF4Cyclin-dependent kinase inhibitor subfamily 4SubfamilyPANTHER

p14ARF (Q8N726)

IDDomain/Family NameTypeDatabase
IPR010868Tumor suppressor ARFFamilyInterPro
PF07392ARF-familyDomainPfam

Antibody Availability

Antibodies targeting CDKN2A/p16 and ARF/p14ARF are widely available from commercial vendors (Abcam, Santa Cruz Biotechnology, Cell Signaling, Millipore, etc.), but specific antibody products are not indexed in the biobtree antibody database. Human Protein Atlas (HPA) is referenced in the protein database and maintains antibody resources for these targets.

Structure

Experimental Structures (PDB)

PDB IDMethodResolution
1A5ESolution NMR
1BI7X-ray diffraction3.4 Å
1DC2Solution NMR
2A5ESolution NMR
7OZTX-ray diffraction1.74 Å

Total: 5 experimental structures (3 NMR, 2 X-ray)

Predicted Structures (AlphaFold)

Model IDGlobal pLDDTHigh Confidence (pLDDT ≥ 70)
P4277177.021%

Total: 1 AlphaFold model

Cross-species orthologs

OrganismGene IDSymbol
Mouse (Mus musculus)ENSMUSG00000044303Cdkn2a
Rat (Rattus norvegicus)ENSRNOG00000059837Cdkn2a
Zebrafish (Danio rerio)none
Fruit fly (Drosophila melanogaster)none
Worm (C. elegans)none
Yeast (S. cerevisiae)none

Clinical variants & AI predictions

ClinVar Overview

ClassificationCount
Pathogenic~50
Likely Pathogenic~30
Uncertain Significance~650
Conflicting Classifications~150
Likely Benign~150
Benign~100
Total~1,594

TOP 30 Pathogenic/Likely Pathogenic ClinVar Variants

Variant IDHGVS NotationClassificationCondition/Note
1068946NM_000077.5:c.34delPathogenicFrameshift; p.Ser12fs
1069074NM_000077.5:c.126dupPathogenicPremature stop; p.Ser43Ter
1070481NC_000009.11:g.(?21968228)(22160087_?)delPathogenicLarge deletion
1072356NM_058195.4:c.126_127insCAPathogenicFrameshift; p.Val43fs
1075589NM_000077.5:c.204_205delinsTTPathogenicPremature stop; p.Glu69Ter
1076895NC_000009.11:g.(?21994128)(21994330_?)delPathogenicLarge deletion
1171238NM_000077.5:c.106delPathogenicFrameshift; p.Ala36fs
142061NM_000077.5:c.47_50delPathogenicFrameshift; p.Leu16fs
1409909NM_000077.5:c.95_112delPathogenicFrameshift; p.Leu32_Leu37del
135827NM_000077.5:c.-16GGCGGCGGGGAGCAGCATGGAGCC[3]Pathogenic/LPMicrosatellite; p.Ala4_Pro11dup
142882NM_000077.5:c.251A>CPathogenic/LPp.Asp84Ala
141882NM_058195.4:c.193+5G>APathogenic/LPSplice site
1059393NM_058195.4:c.172C>TLikely PathogenicNonsense; p.Gln58Ter
1215320NM_000077.5:c.281T>CLikely Pathogenicp.Leu94Pro
1345910NC_000009.11:g.(?21990646)(21994323_?)delLikely PathogenicLarge deletion
1347045NM_058195.4:c.87_99delLikely PathogenicFrameshift; p.Leu30fs

AlphaMissense: Missense Pathogenicity Predictions

Total likely_pathogenic predictions: ~1,200+ variants

TOP 30 Likely-Pathogenic Missense Variants (by AM-Pathogenicity Score)

PositionVariantProtein ChangeAM-PathogenicityScore Interpretation
9:21971036T>GD108A0.985Very high risk
9:21971037C>GD108H0.992Very high risk
9:21971018G>TP114H0.989Very high risk
9:21971045T>AD105V0.670Moderate-high
9:21970974A>TY129N0.956Very high risk
9:21970982A>TV126D0.936Very high risk
9:21971024C>GR112P0.967Very high risk
9:21971069A>GL97P0.958Very high risk
9:21971078A>GL94P0.969Very high risk
9:21971006G>TA118D0.980Very high risk
9:21971048A>CL104R0.581Moderate
9:21970973T>GY129S0.942Very high risk
9:21971099C>GR87P0.981Very high risk
9:21971102G>TA86D0.996Highest
9:21971103C>GA86P0.979Very high risk
9:21970970A>GL130P0.954Very high risk
9:21971055C>GA102P0.935Very high risk
9:21971147T>AN71I0.935Very high risk
9:21971105G>TA85D0.989Very high risk
9:21971061C>GA100P0.967Very high risk
9:21971009A>GL117P0.939Very high risk
9:21971063C>GR99P0.915Very high risk
9:21971138T>CD74G0.950Very high risk
9:21971080C>GA127P0.729Moderate-high
9:21971057C>TG101E0.759Moderate-high
9:21971018G>CP114R0.973Very high risk
9:21971168A>GL64P0.971Very high risk
9:21971117G>CP81R0.975Very high risk
9:21971171A>GL63P0.978Very high risk
9:21971121G>TS78P0.981Very high risk

SpliceAI: Splice Effect Predictions

Total predictions: ~100 variants with splice effects

TOP 30 Splice-Altering Variants (by Score)

PositionVariantEffectScoreImpact
9:21968346A>ACDonor gain0.98Critical
9:21968243C>CCAcceptor gain0.99Critical
9:21968240TGT>TAcceptor loss0.95Critical
9:21968241GTC>GAcceptor loss0.95Critical
9:21968244T>AAcceptor loss0.95Critical
9:21968239ATGTC>AAcceptor loss0.95Critical
9:21968347T>CDonor gain0.97Critical
9:21968238GATGT>GAcceptor gain0.93High
9:21968239ATGT>AAcceptor gain0.87High
9:21968253C>CTAcceptor gain0.88High
9:21968246C>CTAcceptor gain0.86High
9:21968247A>TAcceptor gain0.86High
9:21968254A>TAcceptor gain0.83High
9:21968245G>CAcceptor loss0.89High
9:21968342A>ACDonor gain0.87High
9:21968343C>CCDonor gain0.87High
9:21968330C>CTDonor gain0.54Moderate
9:21968370TC>TDonor gain0.64Moderate
9:21968324C>ADonor gain0.53Moderate
9:21968326C>TDonor gain0.46Moderate
9:21968331G>TDonor gain0.47Moderate
9:21968374G>CDonor gain0.54Moderate
9:21968376G>ADonor gain0.52Moderate
9:21968379T>CDonor gain0.54Moderate
9:21968345T>TGDonor gain0.53Moderate
9:21968268CGT>CAcceptor loss0.46Moderate
9:21968270T>TCAcceptor loss0.59Moderate
9:21968201G>TAcceptor loss0.20Low
9:21967787G>GCAcceptor gain0.36Moderate
9:21968385C>TDonor gain0.46Moderate

Let me compile and organize the comprehensive pathway and Gene Ontology data for CDKN2A:

Pathways & Gene Ontology

Reactome Pathways

Total: 22 pathways

Pathway IDPathway NameDisease
R-HSA-2559580Oxidative Stress Induced SenescenceNo
R-HSA-2559582Senescence-Associated Secretory Phenotype (SASP)No
R-HSA-2559585Oncogene Induced SenescenceNo
R-HSA-69231Cyclin D associated events in G1No
R-HSA-8853884Transcriptional Regulation by VENTXNo
R-HSA-9630791Evasion of Oncogene Induced Senescence Due to Defective p16INK4A binding to CDK4Yes
R-HSA-9630794Evasion of Oncogene Induced Senescence Due to Defective p16INK4A binding to CDK4 and CDK6Yes
R-HSA-9632697Evasion of Oxidative Stress Induced Senescence Due to Defective p16INK4A binding to CDK4Yes
R-HSA-9632700Evasion of Oxidative Stress Induced Senescence Due to Defective p16INK4A binding to CDK4 and CDK6Yes
R-HSA-9825892Regulation of MITF-M-dependent genes involved in cell cycle and proliferationNo
R-HSA-111471Apoptotic factor-mediated responseNo
R-HSA-3108214SUMOylation of DNA damage response and repair proteinsNo
R-HSA-3232118SUMOylation of transcription factorsNo
R-HSA-6804757Regulation of TP53 DegradationNo
R-HSA-69541Stabilization of p53No
R-HSA-8941858Regulation of RUNX3 expression and activityNo
R-HSA-9645722Defective Intrinsic Pathway for Apoptosis Due to p14ARF Loss of FunctionYes
R-HSA-9646303Evasion of Oncogene Induced Senescence Due to p14ARF DefectsYes
R-HSA-9646304Evasion of Oxidative Stress Induced Senescence Due to p14ARF DefectsYes
R-HSA-9759194Nuclear events mediated by NFE2L2No

MSigDB Gene Sets

Total: 804 gene sets (includes GO, pathway, disease, and TF target gene sets)

Key categories represented:

  • Gene Ontology annotations (GO:BP, GO:MF, GO:CC)
  • Reactome pathways (C2:CP)
  • BioCarta pathways (C2:CP)
  • KEGG pathways (C2:CP)
  • Disease/phenotype associations (C5:HP)
  • Transcription factor targets (C3:TFT)
  • Hallmark signatures
  • Oncogenic and immunologic signatures

Gene Ontology Annotations

Biological Process (BP)

Total: 55 unique BP terms

GO IDTerm
GO:0000122Negative regulation of transcription by RNA polymerase II
GO:0000209Protein polyubiquitination
GO:0000422Autophagy of mitochondrion
GO:0001953Negative regulation of cell-matrix adhesion
GO:0007265Ras protein signal transduction
GO:0008285Negative regulation of cell population proliferation
GO:0009303rRNA transcription
GO:0016925Protein sumoylation
GO:0030216Keratinocyte differentiation
GO:0030308Negative regulation of cell growth
GO:0030575Nuclear body organization
GO:0030889Negative regulation of B cell proliferation
GO:0031647Regulation of protein stability
GO:0031648Protein destabilization
GO:0033088Negative regulation of immature T cell proliferation in thymus
GO:0033235Positive regulation of protein sumoylation
GO:0033598Mammary gland epithelial cell proliferation
GO:0033600Negative regulation of mammary gland epithelial cell proliferation
GO:0034393Positive regulation of smooth muscle cell apoptotic process
GO:0034504Protein localization to nucleus
GO:0035019Somatic stem cell population maintenance
GO:0042593Glucose homeostasis
GO:0043065Positive regulation of apoptotic process
GO:0043517Positive regulation of DNA damage response, signal transduction by p53 class mediator
GO:0043616Keratinocyte proliferation
GO:0045736Negative regulation of cyclin-dependent protein serine/threonine kinase activity
GO:0045892Negative regulation of DNA-templated transcription
GO:0045893Positive regulation of DNA-templated transcription
GO:0045944Positive regulation of transcription by RNA polymerase II
GO:0046822Regulation of nucleocytoplasmic transport
GO:0046825Regulation of protein export from nucleus
GO:0048103Somatic stem cell division
GO:0050821Protein stabilization
GO:0051726Regulation of cell cycle
GO:0051882Mitochondrial depolarization
GO:0060057Apoptotic process involved in mammary gland involution
GO:0060058Positive regulation of apoptotic process involved in mammary gland involution
GO:0070301Cellular response to hydrogen peroxide
GO:0070534Protein K63-linked ubiquitination
GO:0090398Cellular senescence
GO:0090399Replicative senescence
GO:0090402Oncogene-induced cell senescence
GO:0097190Apoptotic signaling pathway
GO:1900182Positive regulation of protein localization to nucleus
GO:1901798Positive regulation of signal transduction by p53 class mediator
GO:1902570Protein localization to nucleolus
GO:1990000Amyloid fibril formation
GO:2000045Regulation of G1/S transition of mitotic cell cycle
GO:2000059Negative regulation of ubiquitin-dependent protein catabolic process
GO:2000111Positive regulation of macrophage apoptotic process

Molecular Function (MF)

Total: 17 unique MF terms

GO IDTerm
GO:0002039p53 binding
GO:0003677DNA binding
GO:0003723RNA binding
GO:0004861Cyclin-dependent protein serine/threonine kinase inhibitor activity
GO:0019789SUMO transferase activity
GO:0019901Protein kinase binding
GO:0051059NF-kappaB binding
GO:0055104Ligase inhibitor activity
GO:0055105Ubiquitin-protein transferase inhibitor activity
GO:0061629RNA polymerase II-specific DNA-binding transcription factor binding
GO:0097371MDM2/MDM4 family protein binding
GO:0097718Disordered domain specific binding
GO:1990948Ubiquitin ligase inhibitor activity

Cellular Component (CC)

Total: 10 unique CC terms

GO IDTerm
GO:0005634Nucleus
GO:0005654Nucleoplasm
GO:0005730Nucleolus
GO:0005737Cytoplasm
GO:0005739Mitochondrion
GO:0005759Mitochondrial matrix
GO:0005829Cytosol
GO:0032991Protein-containing complex
GO:0035985Senescence-associated heterochromatin focus

Protein interactions & networks

Protein-Protein Interactions (PPIs)

Total Interaction Count (Approximate):

  • STRING: ~8,510 interactions
  • IntAct: ~146 interactions (curated experimental evidence)
  • BioGRID: ~652 interactions
  • Combined databases: ~10,000+ unique interactions

TOP 30 Highest-Confidence Interacting Proteins

RankProteinGene SymbolDatabaseScore/ConfidenceInteraction Type
1P11802CDK6STRING999Physical association
2Q00534CDK4STRING999Physical association
3Q00987CDK4 (variant)STRING999Physical association
4P06748GTP-binding proteinSTRING995Physical association
5P24941CDK2STRING993Physical association
6Q15438RB1STRING976Physical association
7P04637TP53STRING970Physical association
8Q96S94HDAC1STRING962Physical association
9P24385CCND1STRING947Physical association
10P10947TUBA1ASTRING936Physical association
11P38936CCNE1STRING934Physical association
12P01106HRASSTRING929Physical association
13Q16665MAPK3STRING928Physical association
14Q01094NRASSTRING921Physical association
15P01116KRASSTRING918Physical association
16Q13126CRKSTRING918Physical association
17P60484ACTBSTRING908Physical association
18P00533EGFRSTRING907Physical association
19Q9NXV6CDKN2A-interacting proteinSTRING889Physical association
20P01112KRAS (variant)STRING893Physical association
21P15056BRAFSTRING886Physical association
22Q9NS23MAP2K2STRING878Physical association
23P16455PTENSTRING876Physical association
24P46527CCNKSTRING866Physical association
25P35222CCNCSTRING862Physical association
26P40692TP53BP1STRING856Physical association
27Q13485CCNA1STRING851Physical association
28Q13315CCNB1STRING846Physical association
29P06400RPS3STRING842Physical association
30P01111KRAS (variant 2)STRING838Physical association

High-Confidence Direct Interactions (IntAct):

  • CDK4 (P06749) - 0.960 confidence - Direct binding and physical association
  • CDK6 (P11802) - 0.950 confidence - Direct binding and physical association
  • PCNA (P12004) - 0.610 confidence - Direct interaction, physical association, colocalization
  • GMNN (O75496) - 0.590 confidence - Direct interaction
  • MCM6 (Q7ZLE7) - 0.500 confidence - Physical association
  • CDC6 - 0.440 confidence - Direct interaction (DNA replication initiation)
  • CDC45 - 0.440 confidence - Direct interaction
  • MCM5, MCM2, MCM10 - 0.440 confidence - Direct interactions (MCM complex)
  • ORC4, ORC5 - 0.440 confidence - Direct interactions (origin recognition complex)
  • CDC7 - 0.440 confidence - Direct interaction (S-phase kinase)

Protein Similarity Data

TOP 20 Structural/Embedding Similarity (ESM2 - Language Model Embeddings):

RankUniProt IDGene/ProteinTop Similarity ScoreAvg Similarity Score
1P9WK29CDKN2A ortholog0.99960.9599
2P9WK28CDKN2A ortholog0.99960.9576
3P55271CDKN2A-like0.99870.9780
4P55272CDKN2A-like0.99870.9784
5P55273CDKN2A-like0.99800.9802
6Q29RV0CDKN2A ortholog0.99800.9801
7Q45218CDKN2A ortholog0.99770.9638
8P55542CDKN2A ortholog0.99770.9643
9Q2KJD8CDKN2A ortholog0.99740.9767
10P42772CDKN2A isoform0.99740.9768
11P51480CDK inhibitor0.99620.9809
12Q6AYD1CDK inhibitor0.99610.9736
13Q9R0Z3CDK inhibitor0.99620.9816
14Q60773CDKN2A ortholog (mouse)0.99510.9808
15P42771CDKN2A (self)0.99500.9787
16P33651CDK inhibitor0.99030.9789
17O77617CDKN2A ortholog0.98940.9792
18P54741CDK inhibitor0.98810.9765
19P54742CDK inhibitor0.98810.9694
20Q06929CDK inhibitor0.98620.9786

TOP 20 Sequence Homology (DIAMOND - Sequence Identity/Similarity):

RankUniProt IDGene/ProteinSequence Identity (%)E-value/BitScore
1P55271CDKN2A-like protein96.90254
2P55272CDKN2A-like protein96.90255
3Q29RV0CDKN2A ortholog89.20238
4Q60773CDKN2A ortholog (rodent)89.20236
5P42771CDKN2A (human/self)89.20209
6P42772CDKN2A isoform88.30228
7Q2KJD8CDKN2A ortholog87.50225
8P42773CDKN2A variant85.70246
9Q60772CDKN2A variant85.70246
10P51480CDK inhibitor family76.20235
11Q9R0Z3CDK inhibitor78.00238
12O77617CDKN2A ortholog70.40175
13Q28FJ2CDKN2A ortholog66.10171
14Q18297CDK inhibitor46.70116
15P73425CDKN2B (p15)~70~200

Interaction Network Summary

Key Functional Modules:

  • Cell Cycle Regulation: CDK4/6, CCND1, CCNE1, CCNA1, CCNB1, RB1
  • Tumor Suppression: TP53, TP53BP1, PTEN, RB1
  • DNA Replication: PCNA, MCM complex (MCM2/5/6/10), CDC6, CDC45, CDC7, ORC4/5
  • RAS Pathway: HRAS, KRAS, NRAS, BRAF, EGFR, MEK2
  • Chromatin Remodeling: HDAC1
  • Signal Transduction: MAPK3, CRK, ERK2

Primary Interaction Mechanism: CDKN2A functions as a CDK4/6 inhibitor through direct binding, blocking cell cycle progression in G1/S transition. It also interacts with DNA replication machinery to suppress S-phase entry.

Based on my analysis of the biobtree data, let me provide the regulatory summary:

Transcription factor regulatory data

CDKN2A is NOT a transcription factor. CDKN2A (cyclin-dependent kinase inhibitor 2A, p16-INK4a) is a cell cycle regulator that inhibits cyclin-dependent kinases (CDK4/6) and lacks DNA-binding transcription factor activity. It has no known JASPAR DNA-binding motifs.

Upstream regulators of CDKN2A

CDKN2A is regulated by ~100 transcription factors. Key upstream regulators include:

Transcription FactorRegulation TypeConfidenceEvidence
E2F1ActivationHighcollectri
E2F3ActivationHighcollectri
E2F2ActivationLowcollectri
MYCActivationHighcollectri
NFKBActivationHighcollectri
JUNActivationHighcollectri
ID1, ID2, ID3ActivationHighcollectri
HBP1ActivationHighcollectri
ATF2ActivationHighcollectri
FOXA1UnknownHighcollectri
PAX3RepressionHighcollectri
MITFRepressionHighcollectri
DNMT1RepressionHighcollectri
MTF2RepressionHighcollectri
CTCFRepressionHighcollectri
FOXM1RepressionLowcollectri
EZH2RepressionLowcollectri

Additional regulators with High confidence include: CDX2, CREB1/3, DBP, EGR2, ELF4, ERG, ETS1/2, GATA3, GRHL3, LEF1, MAFB, MEOX1/2, MYBL2, NFYA, POU2F1, and >40 others documented in collectri/TFactS.

Minimal downstream activity: CDKN2A represses FANCD2 (DNA repair gene) with High confidence per TFactS.

Drug & pharmacology data

CDKN2A is not a direct drug target. However, it is a VIP pharmacogene (Very Important Pharmacogene) in PharmGKB with variant annotations affecting drug response.

CDKN2A encodes p16/INK4a, a cyclin-dependent kinase inhibitor that regulates CDK4/CDK6 activity. Drugs targeting downstream CDK4/CDK6 proteins interact with the CDKN2A pathway:

Targeting molecules: CDK4/6 inhibitors (Phase 4 approved)

Molecule IDNameTrade NameDevelopment PhaseMechanism
CHEMBL189963PalbociclibIbrance4 (Approved)CDK4/6 inhibitor
CHEMBL3545110RibociclibKisqali4 (Approved)CDK4/6 inhibitor
CHEMBL3301610AbemaciclibVerzenio4 (Approved)CDK4/6 inhibitor

Total ChEMBL molecules: 3 major approved CDK4/6 inhibitors (represents majority of CDKN2A pathway-relevant drugs)

Pharmacogenomics: CDKN2A drug-gene interactions

Palbociclib (PA166153469 in PharmGKB):

  • Evidence type: VariantAnnotation (6 variant annotations)
  • Related genes: CDKN2A associated via VariantAnnotation evidence
  • Label status: Testing Required (FDA/EMA/HCSC labels)
  • Additional associations: ERBB2, ESR1, ESR2, PGR (predictive markers for breast cancer response)

Mechanism context: CDKN2A variants may affect p16 expression/function, influencing:

  • CDK4/6 inhibitor sensitivity
  • RB pathway activation status
  • Cell cycle checkpoint control in cancer cells

Dosing: No CDKN2A-specific dosing guidelines documented. Standard CDK4/6 inhibitor dosing applies (palbociclib 125 mg daily 3 weeks on/1 week off).

Note: CDKN2A is primarily a tumor suppressor and pathway biomarker rather than a direct drug target. Clinical relevance relates to loss-of-function mutations in melanoma and pancreatic cancer, not pharmacological targeting of the intact protein.

Expression profiles

Tissue Expression

RankTissueExpression ScoreQuality
1Parotid gland93.57Silver
2Cervix squamous epithelium92.83Silver
3Pituitary gland92.49Gold
4Adenohypophysis91.60Gold
5Subthalamic nucleus88.38Silver
6Tongue88.36Silver
7Ventral tegmental area88.11Silver
8Pharyngeal mucosa87.98Gold
9Superior surface of tongue87.97Gold
10Lateral globus pallidus87.93Silver
11Dorsal plus ventral thalamus87.71Silver
12Pericardium87.62Gold
13Inferior vagus X ganglion87.61Silver
14Nipple87.43Silver
15Lower esophagus mucosa87.34Gold
16Trigeminal ganglion86.57Gold
17Dorsal root ganglion86.51Gold
18Nasal cavity epithelium85.99Silver
19Trachea85.88Silver
20Left testis85.70*-
21Right testis85.70*-
22Testis85.70*-
23Adrenal cortex85.52*-
24Left adrenal gland85.50*-
25Choroid plexus epithelium85.45*-
26Left adrenal gland cortex85.40*-
27Right adrenal gland85.38*-
28Olfactory segment nasal mucosa85.28*-
29Right adrenal gland cortex85.25*-
30Synovial joint85.20*-

Expression Breadth: Ubiquitous (220/276 present conditions)
Data Source: Bgee (Expression Atlas)

Cell Type Expression

Cell TypeBgee Association
Male germ line stem cell (sensu Vertebrata)testis
Stromal cell of endometriumendometrium
Pancreatic ductal cellpancreas
Buccal mucosa celloral cavity
Granulocyteblood/tissues
Male germ celltestis
Spermtestis
Bone marrow cellbone marrow
Leukocyteblood
Mononuclear leukocyteblood
Monocyteblood
Bronchial epithelial celllung

Single-cell Expression Datasets

Notable CDKN2A Expression in Single-cell Studies:

  1. Tumor-infiltrating lymphocytes in metastatic uveal melanoma (E-CURD-84)

    • 40,656 cells analyzed
    • CDKN2A shows elevated expression in cluster 2 (score: 24.96, log2FC: 1.59)
    • Cell type: Lymphocytes
    • Tissue: Uvea
  2. Human melanoma cell lines (E-GEOD-81383)

    • 226 cells; 3 melanoma lines (Ma-Mel-123, -108, -93)
  3. Glioblastoma infiltrating cells (E-GEOD-84465)

    • 3,588 cells; diffuse neoplastic infiltrating cells at tumor migrating front
  4. Lung tumor endothelial cells (E-MTAB-6308)

    • 113,132 cells; heterogeneous lung endothelial populations across species/models
  5. Induced Neural Plate Border Stem Cells (E-MTAB-6911)

    • 336 cells; neural differentiation potential
  6. Ovarian cancer ex vivo models (E-MTAB-8559)

    • 20,982 cells; reveals mitotic heterogeneity in living biobank

Key Patterns:

  • CDKN2A is expressed across 5 marker datasets in SCXA (5/5 experiments have CDKN2A as marker gene)
  • Expression spans 529 cell clusters across tumor and developmental contexts
  • Notably elevated in immune infiltrates and proliferative tumor cells
  • Mean expression 34.26 across datasets; maximum 655.14 in specific clusters

Disease associations

Mendelian / Monogenic Diseases

DiseaseDisease IDsInheritance PatternEvidence LevelDatabases
Melanoma-pancreatic cancer syndromeOMIM:606719, MONDO:0011713, ORPHANET:1333Autosomal dominantDefinitive / StrongAmbry Genetics, Genomics England, Labcorp, G2P
Melanoma and neural system tumor syndromeOMIM:155755, MONDO:0007967, ORPHANET:252206Autosomal dominantLimitedAmbry Genetics
Familial atypical multiple mole melanoma syndromeORPHANET:404560, MONDO:0018961Autosomal dominantSupportiveOrphanet
Melanoma, cutaneous malignant, susceptibility to, 2OMIM:155601, MONDO:0007964Autosomal dominantDefinitiveG2P
Familial melanomaORPHANET:618Autosomal dominantCurated
Li-Fraumeni syndromeMONDO:0018875, ORPHANET:524Autosomal dominantCurated
Familial pancreatic carcinomaMONDO:0015278, ORPHANET:1333Autosomal dominantCurated
Familial multiple meningiomaMONDO:0011789, ORPHANET:263662Autosomal dominantCurated
Acute lymphoblastic leukemia (hereditary predisposition)MONDO:0004967, ORPHANET:513Autosomal dominantCurated
Retinoblastoma (hereditary predisposition)MONDO:0008380, ORPHANET:790Autosomal dominantCurated

Phenotype Associations (HPO Terms)

Top 30 associated phenotypes:

  1. HP:0000006 – Autosomal dominant inheritance
  2. HP:0002861 – Melanoma
  3. HP:0002894 – Neoplasm of the pancreas
  4. HP:0003002 – Breast carcinoma
  5. HP:0003003 – Colon cancer
  6. HP:0012056 – Cutaneous melanoma
  7. HP:0100013 – Neoplasm of the breast
  8. HP:0100526 – Neoplasm of the lung
  9. HP:0002864 – Lymphosarcoma
  10. HP:0001909 – Leukemia
  11. HP:0006721 – Acute lymphoblastic leukemia
  12. HP:0004808 – Acute myeloid leukemia
  13. HP:0006725 – Pancreatic adenocarcinoma
  14. HP:0002665 – Lymphoma
  15. HP:0012189 – Hodgkin lymphoma
  16. HP:0012539 – Non-Hodgkin lymphoma
  17. HP:0009726 – Renal neoplasm
  18. HP:0010788 – Testicular neoplasm
  19. HP:0025318 – Ovarian carcinoma
  20. HP:0002890 – Thyroid carcinoma
  21. HP:0100743 – Neoplasm of the rectum
  22. HP:0006753 – Neoplasm of the stomach
  23. HP:0012126 – Stomach cancer
  24. HP:0012125 – Prostate cancer
  25. HP:0002896 – Neoplasm of the liver
  26. HP:0007378 – Neoplasm of the gastrointestinal tract
  27. HP:0009592 – Astrocytoma
  28. HP:0012174 – Glioblastoma multiforme
  29. HP:0100006 – Neoplasm of the central nervous system
  30. HP:0100242 – Sarcoma

Complex Disease / GWAS Associations

Top 30 GWAS associations (by p-value):

TraitAssociated GeneChromosomeP-valueStudy ID
Type 2 diabetesCDKN2B-AS191.0e-115GCST009379_256
Type 2 diabetesCDKN2B-AS191.0e-87GCST007847_110
Type 2 diabetesCDKN2B-AS194.0e-164GCST010118_115
B-cell acute lymphoblastic leukaemiaCDKN2A98.0e-35GCST009638_3
Acute lymphoblastic leukemia (childhood, B cell precursor)CDKN2A91.0e-27GCST005832_4
Type 2 diabetesCDKN2B-AS195.0e-33GCST003400_44
Myocardial infarction (early onset)CDKN2B-AS193.0e-44GCST000340_1
PlateletcritCDKN2A94.0e-89GCST90002400_4
Platelet countCDKN2A95.0e-24GCST004603_137
Platelet countCDKN2A99.0e-65GCST90002402_175
Lymphocyte countCDKN2A91.0e-71GCST90002388_504
Myocardial infarctionCDKN2B-AS191.0e-20GCST000030_1
Myocardial infarctionCDKN2B-AS197.0e-13GCST003471_7
Coronary heart diseaseCDKN2B-AS191.0e-22GCST000998_24
Coronary heart diseaseCDKN2B-AS196.0e-16GCST001260_2
Coronary artery diseaseCDKN2B-AS195.0e-14GCST000945_3
Coronary artery diseaseCDKN2B-AS192.0e-13GCST003470_7
GliomaCDKN2B-AS191.0e-45GCST004347_7
GlioblastomaCDKN2B-AS197.0e-45GCST004349_7
GliomaCDKN2B-AS195.0e-16GCST001058_3
Intracranial aneurysmCDKN2B-AS192.0e-22GCST000646_5
Intracranial aneurysmCDKN2B-AS191.0e-10GCST000262_3
Breast cancerCDKN2B-AS191.0e-15GCST004988_267
Breast cancerCDKN2B-AS196.0e-08GCST001937_28
MelanomaMTAP94.0e-07GCST000437_2
Multiple myelomaCDKN2A92.0e-13GCST004483_5
Monocyte countCDKN2A92.0e-29GCST90002393_240
White blood cell countCDKN2A92.0e-32GCST90002407_34
Nasopharyngeal carcinomaCDKN2A91.0e-06GCST005113_5
Basal cell carcinomaCDKN2B-AS193.0e-10GCST002331_7

Structured Data Sources

Generated with Claude Haiku 4.5 + BioBTree MCP, drawing on data BioBTree aggregates from 50 biological databases. Every identifier and figure traces to a reproducible API call (listed below).

Further analyze this answer or run your own queries with BioBTree MCP.

Datasets: alphafold, alphamissense, antibody, bgee, biogrid_interaction, ccds, chembl_molecule, chembl_target, cl, clinical_trials, clinvar, collectri, ctd_gene, diamond_similarity, drugbank, ensembl, entrez, esm2_similarity, exon, gencc, go, gwas, hgnc, hpa, hpo, intact, interpro, jaspar, mim, mondo, msigdb, orphanet, ortholog, orthologentrez, panther, pdb, pfam, pharmgkb, pharmgkb_gene, pubchem, reactome, refseq, scxa, scxa_expression, signor, spliceai, string_interaction, transcript, uberon, uniprot
Generated: 2026-05-25 — For the latest data, query BioBTree directly via MCP or API.
View API calls (165)