# NM_016579.4(CD320):c.551dup (p.Val185fs)

https://sugi.bio/variant/cd320-p-val185fs

## Summary

**CD320 p.Val185fs (c.551dup)** is classified **Uncertain significance** in CD320 (ClinVar, Single submitter, 1 submitter; last evaluated 2025-11-05). Very rare (popmax 0.00619%, nfe); Associated with methylmalonic acidemia due to transcobalamin receptor defect.

**At a glance:** Uncertain significance · review: Single submitter · 1 submitter · 1 linked condition · very rare (popmax 0.00619%, nfe)

## For patients & families {#patients}

This is a change in the CD320 gene that is currently of uncertain significance — a definitive interpretation has not yet been established, submitted by 1 submitter, and is linked to methylmalonic acidemia due to transcobalamin receptor defect.

*Reference information, not medical advice, and not a prediction for any individual. A genetic counselor or clinician can interpret what it means for you and your family.*

**Support & next steps:** [Condition overview & support (NIH GARD)](https://rarediseases.info.nih.gov/diseases/0016481/index) · [Find a genetic counselor (NSGC)](https://findageneticcounselor.nsgc.org/).

## Identity {#identity}

| Field | Value |
| --- | --- |
| Gene | [CD320](https://sugi.bio/atlas/gene/CD320/) |
| Protein change (HGVS p.) | p.Val185fs |
| Coding change (HGVS c.) | c.551dup |
| MANE Select transcript | [NM_016579](https://www.ncbi.nlm.nih.gov/nuccore/NM_016579) |
| Variant type | Duplication |
| Location | chr19:8302931-8302932 (GRCh38) |
| ClinVar | [VCV4740047](https://www.ncbi.nlm.nih.gov/clinvar/variation/4740047/) |

**All HGVS expressions:** `NC_000019.10:g.8302936dup`, `NC_000019.9:g.8367820dup`, `NG_028124.1:g.10425dup`, `NG_028124.2:g.10426dup`, `NM_001165895.2:c.425dup`, `NM_016579.4:c.551dup`

## Computational & population evidence {#evidence}

**Concordance:** Mixed / partial computational evidence (see below).

- **Missense predictors (AlphaMissense/REVEL/SaProt) do not apply** to this variant type — they score amino-acid substitutions only. For non-missense variants the computational signal comes from conservation (below), not from a missing predictor score.
- Conservation: phyloP -0.54, GERP 0.08 — not a conserved position (phyloP < 0.1, ACGS BP7 cut)
- Molecular consequence: **frameshift** — a predicted loss-of-function variant. Gene population constraint: LOEUF 1.488, pLI 3.2364e-06. *Descriptive; not an applied PVS1 code.*
- Nonsense-mediated decay: the premature termination codon is **in exon 4 of 5**, so the transcript is predicted to undergo NMD.
- CADD: **PHRED 24.8**. No single ClinGen-calibrated threshold exists and the expert panels that use CADD disagree — GUCY2D/AIPL1 require ≥ 20.0 for an untranslated-region variant, ABCA4 ≥ 28.1 for a synonymous or indel variant, the Pulmonary Hypertension panel imports Pejaver 2022's missense-calibrated numbers, and the Antibody Deficiencies panel declines CADD entirely for PIK3CD. CADD v1.7 also incorporates Zoonomia phyloP, so it partly re-expresses the conservation above. *Descriptive; no threshold applied.*
- SpliceAI: **not assessed** — the release is built from a substitutions-only source, so it holds no duplication variants. That is a property of the dataset, not of the variant, and is not evidence against a splicing effect.
- Repeat context: **simple_repeat** (TGTGGCATTCCCGACAGAGGGGACACTCTCCAGGGTCACAGGGGGCCCCATGGT). The alignment of this duplication is ambiguous inside a repeating unit, so the same change can be written several ways and a frequency lookup keyed on one representation can miss another. *A qualifier on how reliably this variant can be called and counted — not a pathogenicity signal.*
- Population frequency (gnomAD v4.1): grpmax **0.00619%** (nfe) · FAF95 0.00503% · FAF99 0.00462% · 73/1,180,022 in the highest group · 77/1,614,008 alleles overall — very rare (popmax 0.00619%, nfe).

| Ancestry group | Allele frequency | 1 in |
| --- | --- | --- |
| European (non-Finnish) (grpmax) | 0.00619% | 16,165 |
| African / African-American | 0.004% | 24,972 |
| Remaining individuals (not grpmax-eligible) | 0.0016% | 62,486 |

*Computational predictors are not independent (ClinGen Variant Classification guidance): AlphaMissense (Cheng et al. 2023) carries the ACMG weight for missense and conservation (phyloP/GERP/phastCons) for non-missense; REVEL (Pejaver-2022 calibrated strength bands) and SaProt (Su et al. 2023, structure-aware, ClinVar-independent protein language model, raw LLR) are shown as orthogonal agreement signals, not additive. For frequency, the gnomAD v4.1 grpmax filtering allele frequency (FAF95) is ClinGen's designated BA1/BS1 input (gnomAD v4 guidance v3.0, June 2025); BA1/BS1 thresholds are disease-specific, not a blanket 5%. Predictions, not a clinical determination.*

## Gene constraint & dosage {#gene-context}

**CD320** population constraint: LOEUF 1.488, pLI 3.2364e-06, missense-Z -1.0094. *Lower LOEUF and higher pLI indicate a gene that tolerates loss-of-function poorly; ClinGen dosage is the curated haploinsufficiency call.*

Curated gene–disease validity (ClinGen):

- **methylmalonic acidemia due to transcobalamin receptor defect** — Definitive (AR)

## Protein context {#protein}


AlphaFold model confidence (whole protein): pLDDT 64.61, 14% of residues very-high.

**6 experimental structure(s)** (PDB): [4ZRP](https://www.rcsb.org/structure/4ZRP), [4ZRQ](https://www.rcsb.org/structure/4ZRQ), [7QBD](https://www.rcsb.org/structure/7QBD), [7QBE](https://www.rcsb.org/structure/7QBE), [7QBF](https://www.rcsb.org/structure/7QBF), [7QBG](https://www.rcsb.org/structure/7QBG) — incl. mutant structure 4ZRQ.

## What this gene does {#gene-function}

*Describes the biological roles of CD320 (the gene this variant disrupts) — not effects measured for this specific variant. A damaging variant is expected to affect these functions and pathways; the degree depends on the variant.*

**How this variant is thought to act:** CD320's established molecular role includes calcium ion binding. In Reactome, CD320 is annotated in disease pathway(s) including **Defective CD320 causes MMATC**.

**Disease mechanism (Reactome):** CD320 loss or alteration is curated in [Defective CD320 causes MMATC](https://reactome.org/content/detail/R-HSA-3359485).

### Pathways affected {#pathways}

CD320 participates in **2 Reactome pathways** (⚕ = disease pathway):

| Pathway (Reactome) | Evidence |
| --- | --- |
| ⚕ [Defective CD320 causes MMATC](https://reactome.org/content/detail/R-HSA-3359485) | other |
| [Transport of RCbl within the body](https://reactome.org/content/detail/R-HSA-9758890) | other |

### Molecular function & processes (GO — experimentally supported) {#go}

**Molecular function:** calcium ion binding, cobalamin binding, cargo receptor activity.

**Biological process:** cobalamin transport, positive regulation of B cell proliferation, B cell costimulation.

## Clinical significance {#significance}

**Uncertain significance** — review status Single submitter *(criteria provided, single submitter)*, last evaluated 2025-11-05.

**Submitter consensus:** unanimous (1/1 Uncertain significance).

### Submitter classifications {#submitters}

| Submitter | Classification | Review | Method | Date |
| --- | --- | --- | --- | --- |
| Labcorp Genetics (formerly Invitae), Labcorp | Uncertain significance | criteria provided, single submitter | clinical testing | 2025-11-05 |

## Associated conditions {#conditions}

[methylmalonic acidemia due to transcobalamin receptor defect](https://sugi.bio/atlas/disease/methylmalonic-acidemia-due-to-transcobalamin-receptor-defect/).

**Reported phenotype names (ClinVar):** Methylmalonic acidemia due to transcobalamin receptor defect, METHYLMALONIC ACIDEMIA, TCblR TYPE, METHYLMALONIC ACIDURIA, TRANSIENT, DUE TO TRANSCOBALAMIN RECEPTOR DEFECT.

## Similar variants {#similar}

Related CD320 variant pages (same residue, condition, or type): [CD320 p.Val185=](/variant/cd320-p-val185), [CD320 p.Val208_Pro209insThrSerLeuArgAsnAlaThrThrMetGlyProProValThrLeuGluSerVal](/variant/cd320-p-val208-pro209insthrserleuargasnalathrthrmetglyproproval-2fe27e15), [CD320 p.Arg129Leu](/variant/cd320-p-arg129leu), [CD320 p.Arg138Ser](/variant/cd320-p-arg138ser), [CD320 p.Arg254Gln](/variant/cd320-p-arg254gln), [CD320 p.Arg258His](/variant/cd320-p-arg258his), [CD320 p.Asn170Ser](/variant/cd320-p-asn170ser), [CD320 p.Asp143Asn](/variant/cd320-p-asp143asn).

### Data sources & attribution {#sources}

ClinVar (NCBI — public domain, built 2026-10-14); gnomAD v4.1 (Broad Institute, built 2026-10-06); AlphaMissense (Cheng et al. 2023, © Google DeepMind — CC BY 4.0, built 2026-01-27); REVEL (Ioannidis et al. 2016 — ODbL, built 2026-07-13); SaProt (Su et al. 2023 — MIT, built 2026-10-14); SpliceAI (Illumina — free for non-commercial use, built 2026-10-13); CADD (Rentzsch et al. 2019, University of Washington — free for non-commercial use, built 2026-10-10); Conservation (phyloP/phastCons/GERP) (UCSC hg38 470-way mammal (Hiller Lab) + Ensembl Compara, built 2026-07-12); gnomAD Non-coding Constraint (Gnocchi) (Chen et al. 2024, Broad Institute — CC0, built 2026-10-11); gnomAD Regional Missense Constraint (Broad Institute — CC0, built 2026-10-13); Pangolin (Zeng & Li 2022 — CC BY 4.0, built 2026-10-11); Repeat regions (UCSC — RepeatMasker, TRF, segmental duplications, built 2026-10-11); ClinGen (ClinGen, built 2026-09-22); UniProt (CC BY 4.0); Reactome / GO (CC BY 4.0, built 2026-09-23); MaveDB (per-record license, built 2026-10-11); CIViC (CC0, built 2026-09-22); Orphanet (Orphanet, built 2026-06-12)

*Primary record: NCBI ClinVar (variation 4740047). Classifications reflect these databases as of the page's build date and may change. Free reference use — not medical advice; consult the primary submitters and a clinician.*