# NM_001122630.2(CDKN1C):c.602del (p.Pro201fs)

https://sugi.bio/variant/cdkn1c-p-pro201fs

## Summary

**CDKN1C p.Pro201fs (c.602del)** is classified **Pathogenic** in CDKN1C (ClinVar, No assertion criteria, 1 submitter). No allele count reported in gnomAD v4.1 (AN 1,080,464); Associated with Beckwith-Wiedemann syndrome.

**At a glance:** Pathogenic · review: No assertion criteria · rsID rs786205237 · 1 submitter · 1 linked condition · no allele count reported in gnomAD v4.1 (AN 1,080,464)

## For patients & families {#patients}

This is a change in the CDKN1C gene that is reported as disease-causing, but on limited review, submitted by 1 submitter, and is linked to Beckwith-Wiedemann syndrome.

*Reference information, not medical advice, and not a prediction for any individual. A genetic counselor or clinician can interpret what it means for you and your family.*

|  |  |
| --- | --- |
| Clinical trials | 6 registered for this condition — see ClinicalTrials.gov |

**Support & next steps:** [Condition overview & support (NIH GARD)](https://rarediseases.info.nih.gov/diseases/0003343/index) · [Find a genetic counselor (NSGC)](https://findageneticcounselor.nsgc.org/).

## Identity {#identity}

| Field | Value |
| --- | --- |
| Gene | [CDKN1C](https://sugi.bio/atlas/gene/CDKN1C/) |
| Protein change (HGVS p.) | p.Pro201fs |
| Coding change (HGVS c.) | c.602del |
| MANE Select transcript | [NM_001122630](https://www.ncbi.nlm.nih.gov/nuccore/NM_001122630) |
| dbSNP | [rs786205237](https://www.ncbi.nlm.nih.gov/snp/rs786205237/) |
| Variant type | Deletion |
| Location | chr11:2884855-2884855 (GRCh38) |
| ClinVar | [VCV192356](https://www.ncbi.nlm.nih.gov/clinvar/variation/192356/) |

**All HGVS expressions:** `LRG_533:g.5911del`, `LRG_533t1:c.635del`, `NC_000011.10:g.2884858del`, `NC_000011.9:g.2906088del`, `NG_008022.1:g.5911del`, `NM_000076.2:c.632delC`, `NM_000076.2:c.635del`, `NM_000076.2:c.635delC`, `NM_001122630.2:c.602del`, `NM_001122631.2:c.602del`, `NM_001362474.2:c.635del`, `NM_001362475.2:c.255+347del`

## Computational & population evidence {#evidence}

**Concordance:** Mixed / partial computational evidence (see below).

- **Missense predictors (AlphaMissense/REVEL/SaProt) do not apply** to this variant type — they score amino-acid substitutions only. For non-missense variants the computational signal comes from conservation (below), not from a missing predictor score.
- Conservation: phyloP -0.218, GERP -0.638 — not a conserved position (phyloP < 0.1, ACGS BP7 cut)
- Molecular consequence: **frameshift** — a predicted loss-of-function variant. ClinGen curates **sufficient evidence for haploinsufficiency** in this gene, supporting a loss-of-function disease mechanism. For a truncating variant the loss-of-function impact is position-dependent — C-terminal / last-exon truncations may escape nonsense-mediated decay. *Descriptive; not an applied PVS1 code.*
- SpliceAI: **not assessed** — the release is built from a substitutions-only source, so it holds no deletion variants. That is a property of the dataset, not of the variant, and is not evidence against a splicing effect.
- Repeat context: **low_complexity, simple_repeat** (G-rich, CCGGGG, GCCGGGACCGGGGCTGGAGCCGGA). The alignment of this deletion is ambiguous inside a repeating unit, so the same change can be written several ways and a frequency lookup keyed on one representation can miss another. *A qualifier on how reliably this variant can be called and counted — not a pathogenicity signal.*
- Population frequency: **no allele count reported in gnomAD v4.1 (AN 1,080,464)** — rarity (ACMG PM2) and BA1/BS1 cannot be assessed for this variant.

*Computational predictors are not independent (ClinGen Variant Classification guidance): AlphaMissense (Cheng et al. 2023) carries the ACMG weight for missense and conservation (phyloP/GERP/phastCons) for non-missense; REVEL (Pejaver-2022 calibrated strength bands) and SaProt (Su et al. 2023, structure-aware, ClinVar-independent protein language model, raw LLR) are shown as orthogonal agreement signals, not additive. For frequency, the gnomAD v4.1 grpmax filtering allele frequency (FAF95) is ClinGen's designated BA1/BS1 input (gnomAD v4 guidance v3.0, June 2025); BA1/BS1 thresholds are disease-specific, not a blanket 5%. Predictions, not a clinical determination.*

## Gene constraint & dosage {#gene-context}

**CDKN1C** population constraint: LOEUF 1.943, pLI 0.00043741, missense-Z -1.85; ClinGen dosage — haploinsufficiency 3, triplosensitivity 0 (0–3 scale). *Lower LOEUF and higher pLI indicate a gene that tolerates loss-of-function poorly; ClinGen dosage is the curated haploinsufficiency call.*

Curated gene–disease validity (ClinGen):

- **Beckwith-Wiedemann syndrome due to CDKN1C mutation** — Strong (AD)

## Protein context {#protein}

Residue **201** lies in the '9 x 4 aa repeats of p-a-p-a' region; the 'disordered' region; a UniProt-annotated variant site (in a bladder cancer).

AlphaFold model confidence (whole protein): pLDDT 63.93, 17% of residues very-high.

## What this gene does {#gene-function}

*Describes the biological roles of CDKN1C (the gene this variant disrupts) — not effects measured for this specific variant. A damaging variant is expected to affect these functions and pathways; the degree depends on the variant.*

**How this variant is thought to act:** CDKN1C's established molecular role includes cyclin-dependent protein serine/threonine kinase inhibitor activity. p.Pro201fs falls in the 9 x 4 aa repeats of p-a-p-a region. In Reactome, CDKN1C is annotated in disease pathway(s) including **Defective binding of RB1 mutants to E2F1,(E2F2, E2F3)**.

**Disease mechanism (Reactome):** CDKN1C loss or alteration is curated in [Defective binding of RB1 mutants to E2F1,(E2F2, E2F3)](https://reactome.org/content/detail/R-HSA-9661069).

### Pathways affected {#pathways}

CDKN1C participates in **2 Reactome pathways** (⚕ = disease pathway):

| Pathway (Reactome) | Evidence |
| --- | --- |
| ⚕ [Defective binding of RB1 mutants to E2F1,(E2F2, E2F3)](https://reactome.org/content/detail/R-HSA-9661069) | curated |
| [Cyclin D associated events in G1](https://reactome.org/content/detail/R-HSA-69231) | curated |

### Molecular function & processes (GO — experimentally supported) {#go}

**Molecular function:** cyclin-dependent protein serine/threonine kinase inhibitor activity, protein-containing complex binding, molecular function inhibitor activity.

**Biological process:** positive regulation of transforming growth factor beta receptor signaling pathway, negative regulation of epithelial cell proliferation.

## Clinical significance {#significance}

**Pathogenic** — review status No assertion criteria *(no assertion criteria provided)*.

**Submitter consensus:** unanimous (1/1 Pathogenic).

### Submitter classifications {#submitters}

| Submitter | Classification | Review | Method | Date |
| --- | --- | --- | --- | --- |
| Centre de Recherche Saint Antoine,  Université Pierre et Marie Curie | Pathogenic | no assertion criteria provided | not provided |  |

## Associated conditions {#conditions}

[Beckwith-Wiedemann syndrome](https://sugi.bio/atlas/disease/beckwith-wiedemann-syndrome/).

**Reported phenotype names (ClinVar):** Beckwith-Wiedemann syndrome, EMG SYNDROME, Exomphalos macroglossia gigantism syndrome.

## Similar variants {#similar}

Related CDKN1C variant pages (same residue, condition, or type): [CDKN1C p.Pro201Leu](/variant/cdkn1c-p-pro201leu), [CDKN1C p.Pro201Arg](/variant/cdkn1c-p-pro201arg), [CDKN1C p.Pro201Ser](/variant/cdkn1c-p-pro201ser), [CDKN1C p.Pro137fs](/variant/cdkn1c-p-pro137fs), [CDKN1C p.Ser73fs](/variant/cdkn1c-p-ser73fs), [CDKN1C p.Val130fs](/variant/cdkn1c-p-val130fs), [CDKN1C p.Ala246_Ala252del](/variant/cdkn1c-p-ala246-ala252del), [CDKN1C p.Gly242_Ala245del](/variant/cdkn1c-p-gly242-ala245del).

### Data sources & attribution {#sources}

ClinVar (NCBI — public domain, built 2026-10-14); gnomAD v4.1 (Broad Institute, built 2026-10-06); AlphaMissense (Cheng et al. 2023, © Google DeepMind — CC BY 4.0, built 2026-01-27); REVEL (Ioannidis et al. 2016 — ODbL, built 2026-07-13); SaProt (Su et al. 2023 — MIT, built 2026-07-14); SpliceAI (Illumina — free for non-commercial use, built 2026-10-13); CADD (Rentzsch et al. 2019, University of Washington — free for non-commercial use, built 2026-10-10); Conservation (phyloP/phastCons/GERP) (UCSC hg38 470-way mammal (Hiller Lab) + Ensembl Compara, built 2026-07-12); gnomAD Non-coding Constraint (Gnocchi) (Chen et al. 2024, Broad Institute — CC0, built 2026-10-11); gnomAD Regional Missense Constraint (Broad Institute — CC0, built 2026-10-13); Pangolin (Zeng & Li 2022 — CC BY 4.0, built 2026-10-11); Repeat regions (UCSC — RepeatMasker, TRF, segmental duplications, built 2026-10-11); ClinGen (ClinGen, built 2026-09-22); UniProt (CC BY 4.0); Reactome / GO (CC BY 4.0, built 2026-09-23); MaveDB (per-record license, built 2026-10-11); CIViC (CC0, built 2026-09-22); Orphanet (Orphanet, built 2026-06-12)

*Primary record: NCBI ClinVar (variation 192356). Classifications reflect these databases as of the page's build date and may change. Free reference use — not medical advice; consult the primary submitters and a clinician.*