# NM_001807.6(CEL):c.2073dup (p.Val692fs)

https://sugi.bio/variant/cel-p-val692fs

## Summary

**CEL p.Val692fs (c.2073dup)** is classified **Conflicting classifications of pathogenicity** in CEL (ClinVar, Conflicting submitters, 3 submitters; last evaluated 2025-02-16). Rare (popmax 0.101%, nfe); Associated with maturity-onset diabetes of the young type 8.

**At a glance:** Conflicting classifications of pathogenicity · review: Conflicting submitters · rsID rs756449511 · 3 submitters · 1 linked condition · rare (popmax 0.101%, nfe)

## For patients & families {#patients}

This is a change in the CEL gene that is of uncertain or conflicting significance (submitters disagree on it), submitted by 3 submitters, and is linked to maturity-onset diabetes of the young type 8.

*Reference information, not medical advice, and not a prediction for any individual. A genetic counselor or clinician can interpret what it means for you and your family.*

|  |  |
| --- | --- |
| Typical inheritance (of this condition) | Autosomal dominant, Not applicable |
| Age of onset (of this condition) | Adolescent, Adult, Childhood |
| Prevalence | 1-5 / 10 000 (Europe) |
| Diagnostic panels | CEL is a diagnostic-grade gene on 2 Genomics England panels |

**Commonly reported features of MODY** (across patients with this condition; presentation varies — frequencies from Orphanet):

- Glucose intolerance — Frequent (79-30%)
- Hyperglycemia — Frequent (79-30%)
- Glycosuria — Frequent (79-30%)
- Abnormal oral glucose tolerance — Frequent (79-30%)
- Abnormal C-peptide level — Frequent (79-30%)
- Abnormal circulating insulin concentration — Frequent (79-30%)
- Hypoinsulinemia — Frequent (79-30%)
- Elevated hemoglobin A1c — Frequent (79-30%)

**Support & next steps:** [Condition overview & support (NIH GARD)](https://rarediseases.info.nih.gov/diseases/0010662/index) · [Find a genetic counselor (NSGC)](https://findageneticcounselor.nsgc.org/).

## Identity {#identity}

| Field | Value |
| --- | --- |
| Gene | [CEL](https://sugi.bio/atlas/gene/CEL/) |
| Protein change (HGVS p.) | p.Val692fs |
| Coding change (HGVS c.) | c.2073dup |
| MANE Select transcript | [NM_001807](https://www.ncbi.nlm.nih.gov/nuccore/NM_001807) |
| dbSNP | [rs756449511](https://www.ncbi.nlm.nih.gov/snp/rs756449511/) |
| Variant type | Duplication |
| Location | chr9:133071567-133071568 (GRCh38) |
| ClinVar | [VCV3383333](https://www.ncbi.nlm.nih.gov/clinvar/variation/3383333/) |

**All HGVS expressions:** `NC_000009.11:g.135946962dup`, `NC_000009.12:g.133071575dup`, `NG_016394.1:g.14598dup`, `NM_001807.6:c.2073dup`

## Computational & population evidence {#evidence}

**Concordance:** Mixed / partial computational evidence (see below).

- **Missense predictors (AlphaMissense/REVEL/SaProt) do not apply** to this variant type — they score amino-acid substitutions only. For non-missense variants the computational signal comes from conservation (below), not from a missing predictor score.
- Conservation: phyloP -0.282, GERP -0.184 — not a conserved position (phyloP < 0.1, ACGS BP7 cut)
- Molecular consequence: **frameshift** — a predicted loss-of-function variant. Gene population constraint: LOEUF 0.972, pLI 3.4493e-10. *Descriptive; not an applied PVS1 code.*
- Nonsense-mediated decay: the premature termination codon is **in the last exon (11 of 11)** — predicted to **escape NMD**, so the truncated protein is likely expressed. An input to PVS1, not an applied code.
- CADD: **PHRED 22.7**. No single ClinGen-calibrated threshold exists and the expert panels that use CADD disagree — GUCY2D/AIPL1 require ≥ 20.0 for an untranslated-region variant, ABCA4 ≥ 28.1 for a synonymous or indel variant, the Pulmonary Hypertension panel imports Pejaver 2022's missense-calibrated numbers, and the Antibody Deficiencies panel declines CADD entirely for PIK3CD. CADD v1.7 also incorporates Zoonomia phyloP, so it partly re-expresses the conservation above. *Descriptive; no threshold applied.*
- SpliceAI: **not assessed** — the release is built from a substitutions-only source, so it holds no duplication variants. That is a property of the dataset, not of the variant, and is not evidence against a splicing effect.
- Repeat context: **segmental_duplication, simple_repeat** (chr9:133080625, GGCCCCCCCCGTGCCGCCCACGGGTGACTCCGG). The alignment of this duplication is ambiguous inside a repeating unit, so the same change can be written several ways and a frequency lookup keyed on one representation can miss another; short reads may not map uniquely here, so both the call and its population frequency are less reliable. *A qualifier on how reliably this variant can be called and counted — not a pathogenicity signal.*
- Population frequency (gnomAD v4.1): grpmax **0.101%** (nfe) · FAF95 0.0939% · FAF99 0.0909% · 477/470,250 in the highest group · 613/688,330 alleles overall — rare (popmax 0.101%, nfe).

| Ancestry group | Allele frequency | 1 in |
| --- | --- | --- |
| Finnish (not grpmax-eligible) | 0.359% | 279 |
| Remaining individuals (not grpmax-eligible) | 0.107% | 934 |
| European (non-Finnish) (grpmax) | 0.101% | 986 |
| Admixed American | 0.0745% | 1,342 |
| Middle Eastern | 0.0481% | 2,078 |
| African / African-American | 0.0141% | 7,111 |
| South Asian | 0.00958% | 10,441 |
| Ashkenazi Jewish (not grpmax-eligible) | 0.00757% | 13,210 |
| East Asian | 0.00423% | 23,644 |

Finnish shows a higher raw frequency than the grpmax group. gnomAD excludes bottlenecked groups — Finnish, Ashkenazi Jewish, Amish and "Remaining individuals" — from grpmax, because founder effects make their frequencies unrepresentative for filtering. The table is sorted by frequency, so an excluded group can sit above the grpmax row.

*Computational predictors are not independent (ClinGen Variant Classification guidance): AlphaMissense (Cheng et al. 2023) carries the ACMG weight for missense and conservation (phyloP/GERP/phastCons) for non-missense; REVEL (Pejaver-2022 calibrated strength bands) and SaProt (Su et al. 2023, structure-aware, ClinVar-independent protein language model, raw LLR) are shown as orthogonal agreement signals, not additive. For frequency, the gnomAD v4.1 grpmax filtering allele frequency (FAF95) is ClinGen's designated BA1/BS1 input (gnomAD v4 guidance v3.0, June 2025); BA1/BS1 thresholds are disease-specific, not a blanket 5%. Predictions, not a clinical determination.*

## Gene constraint & dosage {#gene-context}

**CEL** population constraint: LOEUF 0.972, pLI 3.4493e-10, missense-Z 1.4207. *Lower LOEUF and higher pLI indicate a gene that tolerates loss-of-function poorly; ClinGen dosage is the curated haploinsufficiency call.*

Curated gene–disease validity (ClinGen):

- **maturity-onset diabetes of the young type 8** — Moderate (AD)

## Protein context {#protein}

Residue **692** lies in the 'disordered' region; the '17 x 11 aa tandem repeats, glycodomain, o-linked (mucin type)' region.

AlphaFold model confidence (whole protein): pLDDT 84.10, 69% of residues very-high.

**7 experimental structure(s)** (PDB): [1F6W](https://www.rcsb.org/structure/1F6W), [1JMY](https://www.rcsb.org/structure/1JMY), [6H0T](https://www.rcsb.org/structure/6H0T), [6H0V](https://www.rcsb.org/structure/6H0V), [6H18](https://www.rcsb.org/structure/6H18), [6H19](https://www.rcsb.org/structure/6H19).

## What this gene does {#gene-function}

*Describes the biological roles of CEL (the gene this variant disrupts) — not effects measured for this specific variant. A damaging variant is expected to affect these functions and pathways; the degree depends on the variant.*


### Pathways affected {#pathways}

CEL participates in **2 Reactome pathways** (⚕ = disease pathway):

| Pathway (Reactome) | Evidence |
| --- | --- |
| [Developmental Lineage of Pancreatic Acinar Cells](https://reactome.org/content/detail/R-HSA-9925561) | curated |
| [Digestion of dietary lipid](https://reactome.org/content/detail/R-HSA-192456) | curated |

### Molecular function & processes (GO — experimentally supported) {#go}

**Biological process:** pancreatic juice secretion, intestinal cholesterol absorption.

## Clinical significance {#significance}

**Conflicting classifications of pathogenicity** — review status Conflicting submitters *(criteria provided, conflicting classifications)*, last evaluated 2025-02-16.

**Submitter consensus:** conflicting (2 Uncertain significance, 1 Likely benign).

**Submission history:** 3 submissions (2024–2025); classifications have differed over time.

### Submitter classifications {#submitters}

| Submitter | Classification | Review | Method | Date |
| --- | --- | --- | --- | --- |
| Genomics Laboratory, Virgen de la Arrixaca University Clinical Hospital | Uncertain significance | criteria provided, single submitter | clinical testing | 2024-11-14 |
| Laboratory of Genetics, Children's Clinical University Hospital Latvia | Likely benign | criteria provided, single submitter | clinical testing | 2025-02-16 |
| Blueprint Genetics | Uncertain significance | criteria provided, single submitter | clinical testing | 2024-10-24 |

## Associated conditions {#conditions}

[maturity-onset diabetes of the young type 8](https://sugi.bio/atlas/disease/maturity-onset-diabetes-of-the-young-type-8/).

**Reported phenotype names (ClinVar):** Maturity-onset diabetes of the young type 8, not specified, not provided, none provided, AllHighlyPenetrant, DIABETES AND PANCREATIC EXOCRINE DYSFUNCTION, DIABETES-PANCREATIC EXOCRINE DYSFUNCTION SYNDROME.

## Similar variants {#similar}

Related CEL variant pages (same residue, condition, or type): [CEL c.895+2dup](/variant/cel-c-895-plus-2dup), [CEL p.Val714fs](/variant/cel-p-val714fs), [CEL p.Asp204fs](/variant/cel-p-asp204fs), [CEL p.Gly688_Ala689insProProProValProProThrGlyAspSerGly](/variant/cel-p-gly688-ala689insproproprovalproprothrglyaspsergly), [CEL p.Thr695fs](/variant/cel-p-thr695fs), [CEL p.Val604fs](/variant/cel-p-val604fs), [CEL p.Val637fs](/variant/cel-p-val637fs), [CEL p.Val681fs](/variant/cel-p-val681fs).

### Data sources & attribution {#sources}

ClinVar (NCBI — public domain, built 2026-10-14); gnomAD v4.1 (Broad Institute, built 2026-10-14); AlphaMissense (Cheng et al. 2023, © Google DeepMind — CC BY 4.0, built 2026-01-27); REVEL (Ioannidis et al. 2016 — ODbL, built 2026-07-13); SaProt (Su et al. 2023 — MIT, built 2026-10-14); SpliceAI (Illumina — free for non-commercial use, built 2026-10-13); CADD (Rentzsch et al. 2019, University of Washington — free for non-commercial use, built 2026-10-10); Conservation (phyloP/phastCons/GERP) (UCSC hg38 470-way mammal (Hiller Lab) + Ensembl Compara, built 2026-07-12); gnomAD Non-coding Constraint (Gnocchi) (Chen et al. 2024, Broad Institute — CC0, built 2026-10-11); gnomAD Regional Missense Constraint (Broad Institute — CC0, built 2026-10-13); Pangolin (Zeng & Li 2022 — CC BY 4.0, built 2026-10-11); Repeat regions (UCSC — RepeatMasker, TRF, segmental duplications, built 2026-10-11); ClinGen (ClinGen, built 2026-09-22); UniProt (CC BY 4.0); Reactome / GO (CC BY 4.0, built 2026-09-23); MaveDB (per-record license, built 2026-10-11); CIViC (CC0, built 2026-09-22); Orphanet (Orphanet, built 2026-06-12)

*Primary record: NCBI ClinVar (variation 3383333). Classifications reflect these databases as of the page's build date and may change. Free reference use — not medical advice; consult the primary submitters and a clinician.*