# NM_000397.4(CYBB):c.54_79del (p.Trp18fs)

https://sugi.bio/variant/cybb-p-trp18fs

## Summary

**CYBB p.Trp18fs (c.54_79del)** is classified **Pathogenic** in CYBB (ClinVar, Single submitter, 1 submitter; last evaluated 2017-06-19). No gnomAD frequency available for this variant.

**At a glance:** Pathogenic · review: Single submitter · rsID rs1556464542 · 1 submitter · no gnomAD frequency available for this variant

## For patients & families {#patients}

This is a change in the CYBB gene that is reported as disease-causing, but on limited review, submitted by 1 submitter.

*Reference information, not medical advice, and not a prediction for any individual. A genetic counselor or clinician can interpret what it means for you and your family.*

**Support & next steps:** [Find a genetic counselor (NSGC)](https://findageneticcounselor.nsgc.org/).

## Identity {#identity}

| Field | Value |
| --- | --- |
| Gene | [CYBB](https://sugi.bio/atlas/gene/CYBB/) |
| Protein change (HGVS p.) | p.Trp18fs |
| Coding change (HGVS c.) | c.54_79del |
| MANE Select transcript | [NM_000397](https://www.ncbi.nlm.nih.gov/nuccore/NM_000397) |
| dbSNP | [rs1556464542](https://www.ncbi.nlm.nih.gov/snp/rs1556464542/) |
| Variant type | Deletion |
| Location | chrX:37782092-37782117 (GRCh38) |
| ClinVar | [VCV432965](https://www.ncbi.nlm.nih.gov/clinvar/variation/432965/) |

**All HGVS expressions:** `LRG_53:g.7080_7105del`, `NC_000023.10:g.37641349_37641374del`, `NC_000023.11:g.37782096_37782121del`, `NG_009065.1:g.7080_7105del`, `NM_000397.3:c.54_79del26`, `NM_000397.3:c.54_79delGCTGGGGTTGAACGTCTTCCTCTTTG`, `NM_000397.4:c.54_79del`

## Computational & population evidence {#evidence}

**Concordance:** Mixed / partial computational evidence (see below).

- **Missense predictors (AlphaMissense/REVEL/SaProt) do not apply** to this variant type — they score amino-acid substitutions only. For non-missense variants the computational signal comes from conservation (below), not from a missing predictor score.
- Conservation: phyloP 0.946, GERP 0.585, phastCons 0.999 — weakly conserved position
- Molecular consequence: **frameshift** — a predicted loss-of-function variant. ClinGen curates **sufficient evidence for haploinsufficiency** in this gene, supporting a loss-of-function disease mechanism. *Descriptive; not an applied PVS1 code.*
- Nonsense-mediated decay: the premature termination codon is **in exon 2 of 13**, so the transcript is predicted to undergo NMD.
- SpliceAI: **not assessed** — the release is built from a substitutions-only source, so it holds no deletion variants. That is a property of the dataset, not of the variant, and is not evidence against a splicing effect.
- Population frequency: **no gnomAD frequency available for this variant** — rarity (ACMG PM2) and BA1/BS1 cannot be assessed for this variant.

*Computational predictors are not independent (ClinGen Variant Classification guidance): AlphaMissense (Cheng et al. 2023) carries the ACMG weight for missense and conservation (phyloP/GERP/phastCons) for non-missense; REVEL (Pejaver-2022 calibrated strength bands) and SaProt (Su et al. 2023, structure-aware, ClinVar-independent protein language model, raw LLR) are shown as orthogonal agreement signals, not additive. For frequency, the gnomAD v4.1 grpmax filtering allele frequency (FAF95) is ClinGen's designated BA1/BS1 input (gnomAD v4 guidance v3.0, June 2025); BA1/BS1 thresholds are disease-specific, not a blanket 5%. Predictions, not a clinical determination.*

## Gene constraint & dosage {#gene-context}

**CYBB** population constraint: ClinGen dosage — haploinsufficiency 3, triplosensitivity 0 (0–3 scale). *Lower LOEUF and higher pLI indicate a gene that tolerates loss-of-function poorly; ClinGen dosage is the curated haploinsufficiency call.*

## Protein context {#protein}

Residue **18** lies in an α-helix; a UniProt-annotated variant site (in cgdx).

AlphaFold model confidence (whole protein): pLDDT 90.29, 70% of residues very-high.

**6 experimental structure(s)** (PDB): [3A1F](https://www.rcsb.org/structure/3A1F), [7U8G](https://www.rcsb.org/structure/7U8G), [8GZ3](https://www.rcsb.org/structure/8GZ3), [8KEI](https://www.rcsb.org/structure/8KEI), [8WEJ](https://www.rcsb.org/structure/8WEJ), [8X2L](https://www.rcsb.org/structure/8X2L).

## What this gene does {#gene-function}

*Describes the biological roles of CYBB (the gene this variant disrupts) — not effects measured for this specific variant. A damaging variant is expected to affect these functions and pathways; the degree depends on the variant.*

**How this variant is thought to act:** CYBB's established molecular role includes heme binding.


### Pathways affected {#pathways}

CYBB participates in **9 Reactome pathways** (⚕ = disease pathway):

| Pathway (Reactome) | Evidence |
| --- | --- |
| [Cross-presentation of particulate exogenous antigens (phagosomes)](https://reactome.org/content/detail/R-HSA-1236973) | curated |
| [Detoxification of Reactive Oxygen Species](https://reactome.org/content/detail/R-HSA-3299685) | curated |
| [Neutrophil degranulation](https://reactome.org/content/detail/R-HSA-6798695) | curated |
| [RAC1 GTPase cycle](https://reactome.org/content/detail/R-HSA-9013149) | curated |
| [RAC2 GTPase cycle](https://reactome.org/content/detail/R-HSA-9013404) | curated |
| [RAC3 GTPase cycle](https://reactome.org/content/detail/R-HSA-9013423) | curated |
| [RHO GTPases Activate NADPH Oxidases](https://reactome.org/content/detail/R-HSA-5668599) | curated |
| [ROS and RNS production in phagocytes](https://reactome.org/content/detail/R-HSA-1222556) | curated |
| [VEGFA-VEGFR2 Pathway](https://reactome.org/content/detail/R-HSA-4420097) | curated |

### Molecular function & processes (GO — experimentally supported) {#go}

**Molecular function:** heme binding, protein heterodimerization activity, flavin adenine dinucleotide binding, NADPH binding, FAD binding, superoxide-generating NADPH oxidase activity.

**Biological process:** superoxide metabolic process, superoxide anion generation, innate immune response, respiratory burst.

## Clinical significance {#significance}

**Pathogenic** — review status Single submitter *(criteria provided, single submitter)*, last evaluated 2017-06-19.

**Submitter consensus:** unanimous (1/1 Pathogenic).

### Submitter classifications {#submitters}

| Submitter | Classification | Review | Method | Date |
| --- | --- | --- | --- | --- |
| GeneDx | Pathogenic | criteria provided, single submitter | clinical testing | 2017-06-19 |

**Reported phenotype names (ClinVar):** not provided, none provided.

## Similar variants {#similar}

Related CYBB variant pages (same residue, condition, or type): [CYBB p.Glu347fs](/variant/cybb-p-glu347fs), [CYBB p.Glu540fs](/variant/cybb-p-glu540fs), [CYBB p.Ile241fs](/variant/cybb-p-ile241fs), [CYBB p.Val27fs](/variant/cybb-p-val27fs), [CYBB p.Val321fs](/variant/cybb-p-val321fs), [CYBB c.1150_1151+2del](/variant/cybb-c-1150-1151-plus-2del), [CYBB c.1314+1_1314+5del](/variant/cybb-c-1314-plus-1-1314-plus-5del), [CYBB c.141+1del](/variant/cybb-c-141-plus-1del).

### Data sources & attribution {#sources}

ClinVar (NCBI — public domain, built 2026-10-11); gnomAD v4.1 (Broad Institute, built 2026-10-06); AlphaMissense (Cheng et al. 2023, © Google DeepMind — CC BY 4.0, built 2026-01-27); REVEL (Ioannidis et al. 2016 — ODbL, built 2026-07-13); SaProt (Su et al. 2023 — MIT, built 2026-07-14); SpliceAI (Illumina — free for non-commercial use, built 2026-10-13); CADD (Rentzsch et al. 2019, University of Washington — free for non-commercial use, built 2026-10-10); Conservation (phyloP/phastCons/GERP) (UCSC hg38 470-way mammal (Hiller Lab) + Ensembl Compara, built 2026-07-12); gnomAD Non-coding Constraint (Gnocchi) (Chen et al. 2024, Broad Institute — CC0, built 2026-10-11); gnomAD Regional Missense Constraint (Broad Institute — CC0, built 2026-10-13); Pangolin (Zeng & Li 2022 — CC BY 4.0, built 2026-10-11); Repeat regions (UCSC — RepeatMasker, TRF, segmental duplications, built 2026-10-11); ClinGen (ClinGen, built 2026-09-22); UniProt (CC BY 4.0); Reactome / GO (CC BY 4.0, built 2026-09-23); MaveDB (per-record license, built 2026-10-11); CIViC (CC0, built 2026-09-22); Orphanet (Orphanet, built 2026-06-12)

*Primary record: NCBI ClinVar (variation 432965). Classifications reflect these databases as of the page's build date and may change. Free reference use — not medical advice; consult the primary submitters and a clinician.*