# NM_014208.3(DSPP):c.1805del (p.Ser602fs)

https://sugi.bio/variant/dspp-p-ser602fs

## Summary

**DSPP p.Ser602fs (c.1805del)** is classified **Likely pathogenic** in DSPP (ClinVar, Single submitter, 1 submitter; last evaluated 2023-03-21). No gnomAD frequency available for this variant; Associated with dentinogenesis imperfecta type 2.

**At a glance:** Likely pathogenic · review: Single submitter · rsID rs2475883633 · 1 submitter · 1 linked condition · no gnomAD frequency available for this variant

> **Built without this gene's context.** ClinVar files this variant under an overlapping gene, so its own gene's record set does not contain it and this page is assembled from the variant alone. Gene constraint and dosage, protein structure, pathways, panels and related-variant links were not looked up — absent from this page, not from the data.

## For patients & families {#patients}

This is a change in the DSPP gene that is considered likely disease-causing, submitted by 1 submitter, and is linked to dentinogenesis imperfecta type 2.

*Reference information, not medical advice, and not a prediction for any individual. A genetic counselor or clinician can interpret what it means for you and your family.*

|  |  |
| --- | --- |
| Typical inheritance (of this condition) | Autosomal dominant |
| Age of onset (of this condition) | Childhood |
| Prevalence | 1-5 / 10 000 (Europe) |

**Commonly reported features of Dentinogenesis imperfecta** (across patients with this condition; presentation varies — frequencies from Orphanet):

- Obliteration of the pulp chamber — Very frequent (99-80%)
- Abnormality of the dental root — Very frequent (99-80%)
- Grayish enamel — Frequent (79-30%)
- Odontodysplasia — Frequent (79-30%)
- Joint hypermobility — Frequent (79-30%)
- Generalized hypoplasia of dental enamel — Frequent (79-30%)
- Yellow-brown discoloration of the teeth — Frequent (79-30%)
- Abnormality of the dental pulp — Frequent (79-30%)

**Support & next steps:** [Condition overview & support (NIH GARD)](https://rarediseases.info.nih.gov/diseases/0012796/index) · [Find a genetic counselor (NSGC)](https://findageneticcounselor.nsgc.org/).

## Identity {#identity}

| Field | Value |
| --- | --- |
| Gene | [DSPP](https://sugi.bio/atlas/gene/DSPP/) |
| Protein change (HGVS p.) | p.Ser602fs |
| Coding change (HGVS c.) | c.1805del |
| MANE Select transcript | [NM_014208](https://www.ncbi.nlm.nih.gov/nuccore/NM_014208) |
| dbSNP | [rs2475883633](https://www.ncbi.nlm.nih.gov/snp/rs2475883633/) |
| Variant type | Deletion |
| Location | chr4:87614467-87614467 (GRCh38) |
| ClinVar | [VCV2627557](https://www.ncbi.nlm.nih.gov/clinvar/variation/2627557/) |

**All HGVS expressions:** `LRG_1242:g.10939del`, `LRG_1242t1:c.1805del`, `NC_000004.11:g.88535619del`, `NC_000004.12:g.87614467del`, `NG_011595.1:g.10939del`, `NM_014208.3:c.1805del`, `NM_014208.3:c.1805delG`

## Computational & population evidence {#evidence}

**Concordance:** Mixed / partial computational evidence (see below).

- **Missense predictors (AlphaMissense/REVEL/SaProt) do not apply** to this variant type — they score amino-acid substitutions only. For non-missense variants the computational signal comes from conservation (below), not from a missing predictor score.
- Conservation: phyloP 1.913, GERP 1.1, phastCons 0.005 — weakly conserved position
- Molecular consequence: **frameshift** — a predicted loss-of-function variant. For a truncating variant the loss-of-function impact is position-dependent — C-terminal / last-exon truncations may escape nonsense-mediated decay. *Descriptive; not an applied PVS1 code.*
- SpliceAI: **not looked up on this page** — it was served without the gene's SpliceAI index, so no lookup was made. This is a gap in this page, not in the data, and says nothing about whether a splicing effect is predicted.
- Repeat context: **simple_repeat** (GATAGCAGT, CAGTGACAGCAGTGACAGCAGCAACAG, AGCAGTGATAGCAGTGACAGCAGTGACAGCAGTGAC). The alignment of this deletion is ambiguous inside a repeating unit, so the same change can be written several ways and a frequency lookup keyed on one representation can miss another. *A qualifier on how reliably this variant can be called and counted — not a pathogenicity signal.*
- Population frequency: **no gnomAD frequency available for this variant** — rarity (ACMG PM2) and BA1/BS1 cannot be assessed for this variant.

*Computational predictors are not independent (ClinGen Variant Classification guidance): AlphaMissense (Cheng et al. 2023) carries the ACMG weight for missense and conservation (phyloP/GERP/phastCons) for non-missense; REVEL (Pejaver-2022 calibrated strength bands) and SaProt (Su et al. 2023, structure-aware, ClinVar-independent protein language model, raw LLR) are shown as orthogonal agreement signals, not additive. For frequency, the gnomAD v4.1 grpmax filtering allele frequency (FAF95) is ClinGen's designated BA1/BS1 input (gnomAD v4 guidance v3.0, June 2025); BA1/BS1 thresholds are disease-specific, not a blanket 5%. Predictions, not a clinical determination.*

## Clinical significance {#significance}

**Likely pathogenic** — review status Single submitter *(criteria provided, single submitter)*, last evaluated 2023-03-21.

**Submitter consensus:** unanimous (1/1 Likely pathogenic).

### Submitter classifications {#submitters}

| Submitter | Classification | Review | Method | Date |
| --- | --- | --- | --- | --- |
| Center of Genomic medicine, Geneva, University Hospital of Geneva | Likely pathogenic | criteria provided, single submitter | clinical testing | 2023-03-21 |

## Associated conditions {#conditions}

[dentinogenesis imperfecta type 2](https://sugi.bio/atlas/disease/dentinogenesis-imperfecta-type-2/).

**Reported phenotype names (ClinVar):** Dentinogenesis imperfecta type 2, OPALESCENT DENTIN, OPALESCENT TEETH WITHOUT OSTEOGENESIS IMPERFECTA, Dentinogenesis imperfecta without osteogenesis imperfecta, CAPDEPONT TEETH, Hereditary Opalescent Dentin, Dentinogenesis imperfecta - Shield's type II.

### Data sources & attribution {#sources}

ClinVar (NCBI — public domain, built 2026-10-14); gnomAD v4.1 (Broad Institute, built 2026-10-14); AlphaMissense (Cheng et al. 2023, © Google DeepMind — CC BY 4.0, built 2026-01-27); REVEL (Ioannidis et al. 2016 — ODbL, built 2026-07-13); SaProt (Su et al. 2023 — MIT, built 2026-10-14); SpliceAI (Illumina — free for non-commercial use, built 2026-10-13); CADD (Rentzsch et al. 2019, University of Washington — free for non-commercial use, built 2026-10-10); Conservation (phyloP/phastCons/GERP) (UCSC hg38 470-way mammal (Hiller Lab) + Ensembl Compara, built 2026-07-12); gnomAD Non-coding Constraint (Gnocchi) (Chen et al. 2024, Broad Institute — CC0, built 2026-10-11); gnomAD Regional Missense Constraint (Broad Institute — CC0, built 2026-10-13); Pangolin (Zeng & Li 2022 — CC BY 4.0, built 2026-10-11); Repeat regions (UCSC — RepeatMasker, TRF, segmental duplications, built 2026-10-11); ClinGen (ClinGen, built 2026-09-22); UniProt (CC BY 4.0); Reactome / GO (CC BY 4.0, built 2026-09-23); MaveDB (per-record license, built 2026-10-11); CIViC (CC0, built 2026-09-22); Orphanet (Orphanet, built 2026-06-12)

*Primary record: NCBI ClinVar (variation 2627557). Classifications reflect these databases as of the page's build date and may change. Free reference use — not medical advice; consult the primary submitters and a clinician.*