# NM_014208.3(DSPP):c.2317del (p.Ser773fs)

https://sugi.bio/variant/dspp-p-ser773fs

## Summary

**DSPP p.Ser773fs (c.2317del)** is classified **Pathogenic** in DSPP (ClinVar, Single submitter, 1 submitter). No gnomAD frequency available for this variant; Associated with dentinogenesis imperfecta type 2.

**At a glance:** Pathogenic · review: Single submitter · rsID rs2475884550 · 1 submitter · 1 linked condition · no gnomAD frequency available for this variant

## For patients & families {#patients}

This is a change in the DSPP gene that is reported as disease-causing, but on limited review, submitted by 1 submitter, and is linked to dentinogenesis imperfecta type 2.

*Reference information, not medical advice, and not a prediction for any individual. A genetic counselor or clinician can interpret what it means for you and your family.*

|  |  |
| --- | --- |
| Typical inheritance (of this condition) | Autosomal dominant |
| Age of onset (of this condition) | Childhood |
| Prevalence | 1-5 / 10 000 (Europe) |

**Commonly reported features of Dentinogenesis imperfecta** (across patients with this condition; presentation varies — frequencies from Orphanet):

- Obliteration of the pulp chamber — Very frequent (99-80%)
- Abnormality of the dental root — Very frequent (99-80%)
- Grayish enamel — Frequent (79-30%)
- Odontodysplasia — Frequent (79-30%)
- Joint hypermobility — Frequent (79-30%)
- Generalized hypoplasia of dental enamel — Frequent (79-30%)
- Yellow-brown discoloration of the teeth — Frequent (79-30%)
- Abnormality of the dental pulp — Frequent (79-30%)

**Support & next steps:** [Condition overview & support (NIH GARD)](https://rarediseases.info.nih.gov/diseases/0012796/index) · [Find a genetic counselor (NSGC)](https://findageneticcounselor.nsgc.org/).

## Identity {#identity}

| Field | Value |
| --- | --- |
| Gene | [DSPP](https://sugi.bio/atlas/gene/DSPP/) |
| Protein change (HGVS p.) | p.Ser773fs |
| Coding change (HGVS c.) | c.2317del |
| dbSNP | [rs2475884550](https://www.ncbi.nlm.nih.gov/snp/rs2475884550/) |
| Variant type | Deletion |
| Location | chr4:87614979-87614979 (GRCh38) |
| ClinVar | [VCV2579753](https://www.ncbi.nlm.nih.gov/clinvar/variation/2579753/) |

**All HGVS expressions:** `LRG_1242:g.11451del`, `LRG_1242t1:c.2317del`, `NC_000004.11:g.88536131del`, `NC_000004.12:g.87614979del`, `NG_011595.1:g.11451del`, `NM_014208.3:c.2317del`, `NM_014208.3:c.2317delA`

## Computational & population evidence {#evidence}

**Concordance:** Mixed / partial computational evidence (see below).

- **Missense predictors (AlphaMissense/REVEL/SaProt) do not apply** to this variant type — they score amino-acid substitutions only. For non-missense variants the computational signal comes from conservation (below), not from a missing predictor score.
- Conservation: phyloP -8.323, GERP -1.43 — fast-evolving / accelerated position
- Molecular consequence: **frameshift** — a predicted loss-of-function variant. For a truncating variant the loss-of-function impact is position-dependent — C-terminal / last-exon truncations may escape nonsense-mediated decay. *Descriptive; not an applied PVS1 code.*
- SpliceAI: **not looked up on this page** — it was served without the gene's SpliceAI index, so no lookup was made. This is a gap in this page, not in the data, and says nothing about whether a splicing effect is predicted.
- Repeat context: **simple_repeat** ((CAGTGA)n, GATAGCAGT, CAGTGACAGCAGTGACAGCAGCAACAG). The alignment of this deletion is ambiguous inside a repeating unit, so the same change can be written several ways and a frequency lookup keyed on one representation can miss another. *A qualifier on how reliably this variant can be called and counted — not a pathogenicity signal.*
- Population frequency: **no gnomAD frequency available for this variant** — rarity (ACMG PM2) and BA1/BS1 cannot be assessed for this variant.

*Computational predictors are not independent (ClinGen Variant Classification guidance): AlphaMissense (Cheng et al. 2023) carries the ACMG weight for missense and conservation (phyloP/GERP/phastCons) for non-missense; REVEL (Pejaver-2022 calibrated strength bands) and SaProt (Su et al. 2023, structure-aware, ClinVar-independent protein language model, raw LLR) are shown as orthogonal agreement signals, not additive. For frequency, the gnomAD v4.1 grpmax filtering allele frequency (FAF95) is ClinGen's designated BA1/BS1 input (gnomAD v4 guidance v3.0, June 2025); BA1/BS1 thresholds are disease-specific, not a blanket 5%. Predictions, not a clinical determination.*

## Clinical significance {#significance}

**Pathogenic** — review status Single submitter *(criteria provided, single submitter)*.

**Submitter consensus:** unanimous (1/1 Pathogenic).

### Submitter classifications {#submitters}

| Submitter | Classification | Review | Method | Date |
| --- | --- | --- | --- | --- |
| Center of Excellence in Precision Medicine and Digital Health (CEPMDH), Faculty of Dentistry, Chulalongkorn University | Pathogenic | criteria provided, single submitter | clinical testing |  |

## Associated conditions {#conditions}

[dentinogenesis imperfecta type 2](https://sugi.bio/atlas/disease/dentinogenesis-imperfecta-type-2/).

**Reported phenotype names (ClinVar):** Dentinogenesis imperfecta type 2, CAPDEPONT TEETH, OPALESCENT DENTIN, OPALESCENT TEETH WITHOUT OSTEOGENESIS IMPERFECTA, Dentinogenesis imperfecta without osteogenesis imperfecta, Hereditary Opalescent Dentin, Dentinogenesis imperfecta - Shield's type II.

### Data sources & attribution {#sources}

ClinVar (NCBI — public domain, built 2026-10-11); gnomAD v4.1 (Broad Institute, built 2026-10-06); AlphaMissense (Cheng et al. 2023, © Google DeepMind — CC BY 4.0, built 2026-01-27); REVEL (Ioannidis et al. 2016 — ODbL, built 2026-07-13); SaProt (Su et al. 2023 — MIT, built 2026-07-14); SpliceAI (Illumina — free for non-commercial use, built 2026-10-13); CADD (Rentzsch et al. 2019, University of Washington — free for non-commercial use, built 2026-10-10); Conservation (phyloP/phastCons/GERP) (UCSC hg38 470-way mammal (Hiller Lab) + Ensembl Compara, built 2026-07-12); gnomAD Non-coding Constraint (Gnocchi) (Chen et al. 2024, Broad Institute — CC0, built 2026-10-11); gnomAD Regional Missense Constraint (Broad Institute — CC0, built 2026-10-13); Pangolin (Zeng & Li 2022 — CC BY 4.0, built 2026-10-11); Repeat regions (UCSC — RepeatMasker, TRF, segmental duplications, built 2026-10-11); ClinGen (ClinGen, built 2026-09-22); UniProt (CC BY 4.0); Reactome / GO (CC BY 4.0, built 2026-09-23); MaveDB (per-record license, built 2026-10-11); CIViC (CC0, built 2026-09-22); Orphanet (Orphanet, built 2026-06-12)

*Primary record: NCBI ClinVar (variation 2579753). Classifications reflect these databases as of the page's build date and may change. Free reference use — not medical advice; consult the primary submitters and a clinician.*