# NM_014208.3(DSPP):c.2857AGT[1] (p.Ser954del)

https://sugi.bio/variant/dspp-p-ser954del

## Summary

**DSPP p.Ser954del (c.2857AGT[1])** is classified **Conflicting classifications of pathogenicity** in DSPP (ClinVar, Conflicting submitters, 2 submitters; last evaluated 2026-06-29). Ultra-rare (popmax 0.0261%, afr).

**At a glance:** Conflicting classifications of pathogenicity · review: Conflicting submitters · rsID rs754434430 · 2 submitters · ultra-rare (popmax 0.0261%, afr)

## For patients & families {#patients}

This is a change in the DSPP gene that is of uncertain or conflicting significance (submitters disagree on it), submitted by 2 submitters.

*Reference information, not medical advice, and not a prediction for any individual. A genetic counselor or clinician can interpret what it means for you and your family.*

**Support & next steps:** [Find a genetic counselor (NSGC)](https://findageneticcounselor.nsgc.org/).

## Identity {#identity}

| Field | Value |
| --- | --- |
| Gene | [DSPP](https://sugi.bio/atlas/gene/DSPP/) |
| Protein change (HGVS p.) | p.Ser954del |
| Coding change (HGVS c.) | c.2857AGT[1] |
| dbSNP | [rs754434430](https://www.ncbi.nlm.nih.gov/snp/rs754434430/) |
| Variant type | Microsatellite |
| Location | chr4:87615518-87615520 (GRCh38) |
| ClinVar | [VCV2571208](https://www.ncbi.nlm.nih.gov/clinvar/variation/2571208/) |

**All HGVS expressions:** `LRG_1242:g.11991AGT[1]`, `LRG_1242t1:c.2857AGT[1]`, `NC_000004.11:g.88536671AGT[1]`, `NC_000004.12:g.87615519AGT[1]`, `NG_011595.1:g.11991AGT[1]`, `NM_014208.3:c.2857AGT[1]`, `NM_014208.3:c.2860_2862delAGT`

## Computational & population evidence {#evidence}

**Concordance:** Mixed / partial computational evidence (see below).

- **Missense predictors (AlphaMissense/REVEL/SaProt) do not apply** to this variant type — they score amino-acid substitutions only. For non-missense variants the computational signal comes from conservation (below), not from a missing predictor score.
- Conservation: phyloP 0.121, GERP -1.47 — weakly conserved position
- Molecular consequence: **in-frame indel**.
- CADD: **PHRED 3.147**. No single ClinGen-calibrated threshold exists and the expert panels that use CADD disagree — GUCY2D/AIPL1 require ≥ 20.0 for an untranslated-region variant, ABCA4 ≥ 28.1 for a synonymous or indel variant, the Pulmonary Hypertension panel imports Pejaver 2022's missense-calibrated numbers, and the Antibody Deficiencies panel declines CADD entirely for PIK3CD. CADD v1.7 also incorporates Zoonomia phyloP, so it partly re-expresses the conservation above. *Descriptive; no threshold applied.*
- SpliceAI: **not looked up on this page** — it was served without the gene's SpliceAI index, so no lookup was made. This is a gap in this page, not in the data, and says nothing about whether a splicing effect is predicted.
- Repeat context: **ltr, simple_repeat** (MLT1N2, GATAGCAGT, CAGTGACAGCAGTGACAGCAGCAACAG). The alignment of this microsatellite is ambiguous inside a repeating unit, so the same change can be written several ways and a frequency lookup keyed on one representation can miss another. *A qualifier on how reliably this variant can be called and counted — not a pathogenicity signal.*
- Population frequency (gnomAD v4.1): grpmax **0.0261%** (afr) · FAF95 0.0225% · FAF99 0.0216% · 19/72,728 in the highest group · 334/1,543,238 alleles overall — ultra-rare (popmax 0.0261%, afr).

| Ancestry group | Allele frequency | 1 in |
| --- | --- | --- |
| African / African-American (grpmax) | 0.0261% | 3,828 |
| European (non-Finnish) | 0.025% | 4,004 |
| Admixed American | 0.0217% | 4,602 |
| Remaining individuals (not grpmax-eligible) | 0.0134% | 7,473 |
| East Asian | 0.00737% | 13,562 |
| South Asian | 0.00718% | 13,922 |
| Finnish (not grpmax-eligible) | 0.00337% | 29,698 |

*Computational predictors are not independent (ClinGen Variant Classification guidance): AlphaMissense (Cheng et al. 2023) carries the ACMG weight for missense and conservation (phyloP/GERP/phastCons) for non-missense; REVEL (Pejaver-2022 calibrated strength bands) and SaProt (Su et al. 2023, structure-aware, ClinVar-independent protein language model, raw LLR) are shown as orthogonal agreement signals, not additive. For frequency, the gnomAD v4.1 grpmax filtering allele frequency (FAF95) is ClinGen's designated BA1/BS1 input (gnomAD v4 guidance v3.0, June 2025); BA1/BS1 thresholds are disease-specific, not a blanket 5%. Predictions, not a clinical determination.*

## Clinical significance {#significance}

**Conflicting classifications of pathogenicity** — review status Conflicting submitters *(criteria provided, conflicting classifications)*, last evaluated 2026-06-29.

**Submitter consensus:** conflicting (1 Likely benign, 1 Uncertain significance).

**Submission history:** 2 submissions (2025–2026); classifications have differed over time.

### Submitter classifications {#submitters}

| Submitter | Classification | Review | Method | Date |
| --- | --- | --- | --- | --- |
| CeGaT Center for Human Genetics Tuebingen | Likely benign | criteria provided, single submitter | clinical testing | 2025-07-01 |
| Women's Health and Genetics/Laboratory Corporation of America, LabCorp | Uncertain significance | criteria provided, single submitter | clinical testing | 2026-06-29 |

**Reported phenotype names (ClinVar):** not provided, not specified, none provided, AllHighlyPenetrant.

### Data sources & attribution {#sources}

ClinVar (NCBI — public domain, built 2026-10-11); gnomAD v4.1 (Broad Institute, built 2026-10-06); AlphaMissense (Cheng et al. 2023, © Google DeepMind — CC BY 4.0, built 2026-01-27); REVEL (Ioannidis et al. 2016 — ODbL, built 2026-07-13); SaProt (Su et al. 2023 — MIT, built 2026-07-14); SpliceAI (Illumina — free for non-commercial use, built 2026-10-13); CADD (Rentzsch et al. 2019, University of Washington — free for non-commercial use, built 2026-10-10); Conservation (phyloP/phastCons/GERP) (UCSC hg38 470-way mammal (Hiller Lab) + Ensembl Compara, built 2026-07-12); gnomAD Non-coding Constraint (Gnocchi) (Chen et al. 2024, Broad Institute — CC0, built 2026-10-11); gnomAD Regional Missense Constraint (Broad Institute — CC0, built 2026-10-13); Pangolin (Zeng & Li 2022 — CC BY 4.0, built 2026-10-11); Repeat regions (UCSC — RepeatMasker, TRF, segmental duplications, built 2026-10-11); ClinGen (ClinGen, built 2026-09-22); UniProt (CC BY 4.0); Reactome / GO (CC BY 4.0, built 2026-09-23); MaveDB (per-record license, built 2026-10-11); CIViC (CC0, built 2026-09-22); Orphanet (Orphanet, built 2026-06-12)

*Primary record: NCBI ClinVar (variation 2571208). Classifications reflect these databases as of the page's build date and may change. Free reference use — not medical advice; consult the primary submitters and a clinician.*