# NM_152281.3(GORAB):c.87_207delinsGGAGGTCTCTGGAACCTCATTACTTCCAGAGCAGCTGCTTTCAGCACC (p.Pro30fs)

https://sugi.bio/variant/gorab-p-pro30fs

## Summary

**GORAB p.Pro30fs (c.87_207delinsGGAGGTCTCT…[48 bp])** is classified **Likely pathogenic** in GORAB (ClinVar, Single submitter, 1 submitter; last evaluated 2022-09-27). No gnomAD frequency available for this variant.

**At a glance:** Likely pathogenic · review: Single submitter · rsID rs2101820716 · 1 submitter · no gnomAD frequency available for this variant

## For patients & families {#patients}

This is a change in the GORAB gene that is considered likely disease-causing, submitted by 1 submitter.

*Reference information, not medical advice, and not a prediction for any individual. A genetic counselor or clinician can interpret what it means for you and your family.*

**Support & next steps:** [Find a genetic counselor (NSGC)](https://findageneticcounselor.nsgc.org/).

## Identity {#identity}

| Field | Value |
| --- | --- |
| Gene | [GORAB](https://sugi.bio/atlas/gene/GORAB/) |
| Protein change (HGVS p.) | p.Pro30fs |
| Coding change (HGVS c.) | c.87_207delinsGGAGGTCTCTGGAACCTCATTACTTCCAGAGCAGCTGCTTTCAGCACC |
| MANE Select transcript | [NM_152281](https://www.ncbi.nlm.nih.gov/nuccore/NM_152281) |
| dbSNP | [rs2101820716](https://www.ncbi.nlm.nih.gov/snp/rs2101820716/) |
| Variant type | Indel |
| Location | chr1:170539235-170539355 (GRCh38) |
| ClinVar | [VCV1183320](https://www.ncbi.nlm.nih.gov/clinvar/variation/1183320/) |

**All HGVS expressions:** `NC_000001.10:g.170508376_170508496delinsGGAGGTCTCTGGAACCTCATTACTTCCAGAGCAGCTGCTTTCAGCACC`, `NC_000001.11:g.170539235_170539355delinsGGAGGTCTCTGGAACCTCATTACTTCCAGAGCAGCTGCTTTCAGCACC`, `NG_012237.1:g.12114_12234delinsGGAGGTCTCTGGAACCTCATTACTTCCAGAGCAGCTGCTTTCAGCACC`, `NM_001146039.2:c.87_207delinsGGAGGTCTCTGGAACCTCATTACTTCCAGAGCAGCTGCTTTCAGCACC`, `NM_001320252.2:c.-379_-259delinsGGAGGTCTCTGGAACCTCATTACTTCCAGAGCAGCTGCTTTCAGCACC`, `NM_152281.2:c.162_285delCCCCGCGAAGAAAAGTCGACAACAACTTCAGCGAGAAAAAGCCCTTGTAGAGCAAAGCCAAAAACTTGGGCTTCAAGATGGATCAACCTCATTACTTCCAGAGCAGCTGCTTTCAGCACCAAAAinsGGAGGTCTCTGGAACCTCATTACTTCCAGAGCAGCTGCTTTCAGCACCAAA`, `NM_152281.3:c.87_207delinsGGAGGTCTCTGGAACCTCATTACTTCCAGAGCAGCTGCTTTCAGCACC`, `NR_027397.2:n.145_265delinsGGAGGTCTCTGGAACCTCATTACTTCCAGAGCAGCTGCTTTCAGCACC`

## Computational & population evidence {#evidence}

**Concordance:** Mixed / partial computational evidence (see below).

- **Missense predictors (AlphaMissense/REVEL/SaProt) do not apply** to this variant type — they score amino-acid substitutions only. For non-missense variants the computational signal comes from conservation (below), not from a missing predictor score.
- Conservation: phyloP -1.19, GERP -0.284 — not a conserved position (phyloP < 0.1, ACGS BP7 cut)
- Molecular consequence: **frameshift** — a predicted loss-of-function variant. Gene population constraint: LOEUF 0.802, pLI 0.0054121. *Descriptive; not an applied PVS1 code.*
- Nonsense-mediated decay: the premature termination codon is **in exon 2 of 5**, so the transcript is predicted to undergo NMD.
- SpliceAI: **not assessed** — the release is built from a substitutions-only source, so it holds no indel variants. That is a property of the dataset, not of the variant, and is not evidence against a splicing effect.
- Population frequency: **no gnomAD frequency available for this variant** — rarity (ACMG PM2) and BA1/BS1 cannot be assessed for this variant.

*Computational predictors are not independent (ClinGen Variant Classification guidance): AlphaMissense (Cheng et al. 2023) carries the ACMG weight for missense and conservation (phyloP/GERP/phastCons) for non-missense; REVEL (Pejaver-2022 calibrated strength bands) and SaProt (Su et al. 2023, structure-aware, ClinVar-independent protein language model, raw LLR) are shown as orthogonal agreement signals, not additive. For frequency, the gnomAD v4.1 grpmax filtering allele frequency (FAF95) is ClinGen's designated BA1/BS1 input (gnomAD v4 guidance v3.0, June 2025); BA1/BS1 thresholds are disease-specific, not a blanket 5%. Predictions, not a clinical determination.*

## Gene constraint & dosage {#gene-context}

**GORAB** population constraint: LOEUF 0.802, pLI 0.0054121, missense-Z 0.29956; ClinGen dosage — haploinsufficiency gene assoc. with recessive phenotype, triplosensitivity 0/3. *Lower LOEUF and higher pLI indicate a gene that tolerates loss-of-function poorly; ClinGen dosage is the curated haploinsufficiency call.*

Curated gene–disease validity (ClinGen):

- **geroderma osteodysplastica** — Definitive (AR)

## Protein context {#protein}

Residue **30** lies in the 'disordered' region.

AlphaFold model confidence (whole protein): pLDDT 71.86, 38% of residues very-high.

## Clinical significance {#significance}

**Likely pathogenic** — review status Single submitter *(criteria provided, single submitter)*, last evaluated 2022-09-27.

**Submitter consensus:** unanimous (1/1 Likely pathogenic).

### Submitter classifications {#submitters}

| Submitter | Classification | Review | Method | Date |
| --- | --- | --- | --- | --- |
| GeneDx | Likely pathogenic | criteria provided, single submitter | clinical testing | 2022-09-27 |

**Reported phenotype names (ClinVar):** not provided, RECLASSIFIED - ADRA2C POLYMORPHISM, RECLASSIFIED - ADRB1 POLYMORPHISM, none provided.

## Similar variants {#similar}

Related GORAB variant pages (same residue, condition, or type): [GORAB p.Pro30_Ser57delinsGluValSerGly](/variant/gorab-p-pro30-ser57delinsgluvalsergly), [GORAB p.Pro30Ala](/variant/gorab-p-pro30ala), [GORAB p.Pro30His](/variant/gorab-p-pro30his), [GORAB p.Pro30=](/variant/gorab-p-pro30), [GORAB p.Pro30Thr](/variant/gorab-p-pro30thr), [GORAB p.Lys266Gln](/variant/gorab-p-lys266gln), [GORAB p.Pro86_Ser87delinsArgGly](/variant/gorab-p-pro86-ser87delinsarggly), [GORAB p.Met(?_1](/variant/gorab-p-met-1).

### Data sources & attribution {#sources}

ClinVar (NCBI — public domain, built 2026-10-14); gnomAD v4.1 (Broad Institute, built 2026-10-15); AlphaMissense (Cheng et al. 2023, © Google DeepMind — CC BY 4.0, built 2026-01-27); REVEL (Ioannidis et al. 2016 — ODbL, built 2026-07-13); SaProt (Su et al. 2023 — MIT, built 2026-10-14); SpliceAI (Illumina — free for non-commercial use, built 2026-10-13); CADD (Rentzsch et al. 2019, University of Washington — free for non-commercial use, built 2026-10-10); Conservation (phyloP/phastCons/GERP) (UCSC hg38 470-way mammal (Hiller Lab) + Ensembl Compara, built 2026-07-12); gnomAD Non-coding Constraint (Gnocchi) (Chen et al. 2024, Broad Institute — CC0, built 2026-10-11); gnomAD Regional Missense Constraint (Broad Institute — CC0, built 2026-10-13); Pangolin (Zeng & Li 2022 — CC BY 4.0, built 2026-10-11); Repeat regions (UCSC — RepeatMasker, TRF, segmental duplications, built 2026-10-11); ClinGen (ClinGen, built 2026-09-22); UniProt (CC BY 4.0); Reactome / GO (CC BY 4.0, built 2026-09-23); MaveDB (per-record license, built 2026-10-11); CIViC (CC0, built 2026-09-22); Orphanet (Orphanet, built 2026-06-12)

*Primary record: NCBI ClinVar (variation 1183320). Classifications reflect these databases as of the page's build date and may change. Free reference use — not medical advice; consult the primary submitters and a clinician.*