# NM_001318852.2(MAPK8IP3):c.592=

https://sugi.bio/variant/mapk8ip3-c-592

## Summary

**MAPK8IP3 c.592=** is classified **Likely benign** in MAPK8IP3 (ClinVar, Single submitter, 1 submitter; last evaluated 2021-06-15).

**At a glance:** Likely benign · review: Single submitter · 1 submitter

## For patients & families {#patients}

This is a change in the MAPK8IP3 gene that is classified as likely benign — not considered disease-causing, submitted by 1 submitter.

*Reference information, not medical advice, and not a prediction for any individual. A genetic counselor or clinician can interpret what it means for you and your family.*

**Support & next steps:** [Find a genetic counselor (NSGC)](https://findageneticcounselor.nsgc.org/).

## Identity {#identity}

| Field | Value |
| --- | --- |
| Gene | [MAPK8IP3](https://sugi.bio/atlas/gene/MAPK8IP3/) |
| Coding change (HGVS c.) | c.592= |
| MANE Select transcript | [NM_001318852](https://www.ncbi.nlm.nih.gov/nuccore/NM_001318852) |
| Variant type | Variation |
| Location | chr16:1729568-1729593 (GRCh38) |
| ClinVar | [VCV4927319](https://www.ncbi.nlm.nih.gov/clinvar/variation/4927319/) |

**All HGVS expressions:** `NC_000016.10:g.1729568_1729593=`, `NC_000016.9:g.1779569_1779594=`, `NM_001040439.2:c.592=`, `NM_001318852.2:c.592=`, `NM_015133.5:c.592=`

## Computational & population evidence {#evidence}

**Concordance:** Mixed / partial computational evidence (see below).

- **Missense predictors (AlphaMissense/REVEL/SaProt) do not apply** to this variant type — they score amino-acid substitutions only. For non-missense variants the computational signal comes from conservation (below), not from a missing predictor score.
- Conservation: phyloP 7.642, GERP 2.52, phastCons 1 — highly conserved position (PP3-type support)
- Non-coding constraint (Gnocchi): **Z 2.18**, o/e 0.87 (1 kb window 1,729,000–1,730,000). A higher Z means the window carries less variation than expected. Describes the 1 kb window, not this allele. No ClinGen expert panel references Gnocchi and no ACMG-calibrated threshold exists for it. *Descriptive; no cut-point applied.*
- SpliceAI: **not assessed** — the release is built from a substitutions-only source, so it holds no variation variants. That is a property of the dataset, not of the variant, and is not evidence against a splicing effect.
- Repeat context: **low_complexity, simple_repeat** (G-rich, CGGGGCGGAGGTACGCGGGGCGCGG). The alignment of this variation is ambiguous inside a repeating unit, so the same change can be written several ways and a frequency lookup keyed on one representation can miss another. *A qualifier on how reliably this variant can be called and counted — not a pathogenicity signal.*

*Computational predictors are not independent (ClinGen Variant Classification guidance): AlphaMissense (Cheng et al. 2023) carries the ACMG weight for missense and conservation (phyloP/GERP/phastCons) for non-missense; REVEL (Pejaver-2022 calibrated strength bands) and SaProt (Su et al. 2023, structure-aware, ClinVar-independent protein language model, raw LLR) are shown as orthogonal agreement signals, not additive. For frequency, the gnomAD v4.1 grpmax filtering allele frequency (FAF95) is ClinGen's designated BA1/BS1 input (gnomAD v4 guidance v3.0, June 2025); BA1/BS1 thresholds are disease-specific, not a blanket 5%. Predictions, not a clinical determination.*

## Gene constraint & dosage {#gene-context}

**MAPK8IP3** population constraint: LOEUF 0.407, pLI 1, missense-Z 3.4325. *Lower LOEUF and higher pLI indicate a gene that tolerates loss-of-function poorly; ClinGen dosage is the curated haploinsufficiency call.*

Curated gene–disease validity (ClinGen):

- **neurodevelopmental disorder with or without variable brain abnormalities; NEDBA** — Definitive (AD)

## Protein context {#protein}


AlphaFold model confidence (whole protein): pLDDT 63.19, 23% of residues very-high.

**5 experimental structure(s)** (PDB): [4PXJ](https://www.rcsb.org/structure/4PXJ), [8PR2](https://www.rcsb.org/structure/8PR2), [8PR3](https://www.rcsb.org/structure/8PR3), [8PR4](https://www.rcsb.org/structure/8PR4), [8PTK](https://www.rcsb.org/structure/8PTK).

## Clinical significance {#significance}

**Likely benign** — review status Single submitter *(criteria provided, single submitter)*, last evaluated 2021-06-15.

**Submitter consensus:** unanimous (1/1 Likely benign).

### Submitter classifications {#submitters}

| Submitter | Classification | Review | Method | Date |
| --- | --- | --- | --- | --- |
| Blueprint Genetics | Likely benign | criteria provided, single submitter | clinical testing | 2021-06-15 |

**Reported phenotype names (ClinVar):** not specified, AllHighlyPenetrant.

### Data sources & attribution {#sources}

ClinVar (NCBI — public domain, built 2026-10-14); gnomAD v4.1 (Broad Institute, built 2026-10-15); AlphaMissense (Cheng et al. 2023, © Google DeepMind — CC BY 4.0, built 2026-01-27); REVEL (Ioannidis et al. 2016 — ODbL, built 2026-07-13); SaProt (Su et al. 2023 — MIT, built 2026-10-14); SpliceAI (Illumina — free for non-commercial use, built 2026-10-13); CADD (Rentzsch et al. 2019, University of Washington — free for non-commercial use, built 2026-10-10); Conservation (phyloP/phastCons/GERP) (UCSC hg38 470-way mammal (Hiller Lab) + Ensembl Compara, built 2026-07-12); gnomAD Non-coding Constraint (Gnocchi) (Chen et al. 2024, Broad Institute — CC0, built 2026-10-11); gnomAD Regional Missense Constraint (Broad Institute — CC0, built 2026-10-13); Pangolin (Zeng & Li 2022 — CC BY 4.0, built 2026-10-11); Repeat regions (UCSC — RepeatMasker, TRF, segmental duplications, built 2026-10-11); ClinGen (ClinGen, built 2026-09-22); UniProt (CC BY 4.0); Reactome / GO (CC BY 4.0, built 2026-09-23); MaveDB (per-record license, built 2026-10-11); CIViC (CC0, built 2026-09-22); Orphanet (Orphanet, built 2026-06-12)

*Primary record: NCBI ClinVar (variation 4927319). Classifications reflect these databases as of the page's build date and may change. Free reference use — not medical advice; consult the primary submitters and a clinician.*