# NM_181882.3(PRX):c.1761del (p.Pro588fs)

https://sugi.bio/variant/prx-p-pro588fs

## Summary

**PRX p.Pro588fs (c.1761del)** is classified **Likely pathogenic** in PRX (ClinVar, Single submitter, 1 submitter; last evaluated 2021-05-07). Associated with Charcot-Marie-Tooth disease type 4.

**At a glance:** Likely pathogenic · review: Single submitter · 1 submitter · 1 linked condition

## For patients & families {#patients}

This is a change in the PRX gene that is considered likely disease-causing, submitted by 1 submitter, and is linked to Charcot-Marie-Tooth disease type 4.

*Reference information, not medical advice, and not a prediction for any individual. A genetic counselor or clinician can interpret what it means for you and your family.*

**Support & next steps:** [Condition overview & support (NIH GARD)](https://rarediseases.info.nih.gov/diseases/0012440/index) · [Find a genetic counselor (NSGC)](https://findageneticcounselor.nsgc.org/).

## Identity {#identity}

| Field | Value |
| --- | --- |
| Gene | [PRX](https://sugi.bio/atlas/gene/PRX/) |
| Protein change (HGVS p.) | p.Pro588fs |
| Coding change (HGVS c.) | c.1761del |
| MANE Select transcript | [NM_181882](https://www.ncbi.nlm.nih.gov/nuccore/NM_181882) |
| Variant type | Deletion |
| Location | chr19:40396591-40396591 (GRCh38) |
| ClinVar | [VCV3780494](https://www.ncbi.nlm.nih.gov/clinvar/variation/3780494/) |

**All HGVS expressions:** `LRG_265:g.21774del`, `LRG_265t1:c.*1966del`, `LRG_265t2:c.1760del`, `NC_000019.10:g.40396592del`, `NC_000019.9:g.40902499del`, `NG_007979.1:g.21774del`, `NM_001411127.1:c.2046del`, `NM_020956.2:c.*1966del`, `NM_181882.3:c.1761del`, `NM_181882.3:c.1761delT`

## Computational & population evidence {#evidence}

**Concordance:** Mixed / partial computational evidence (see below).

- **Missense predictors (AlphaMissense/REVEL/SaProt) do not apply** to this variant type — they score amino-acid substitutions only. For non-missense variants the computational signal comes from conservation (below), not from a missing predictor score.
- Conservation: phyloP 1.371, GERP 0.175, phastCons 0.419 — weakly conserved position
- Molecular consequence: **frameshift** — a predicted loss-of-function variant. Gene population constraint: LOEUF 1.321, pLI 2.7562e-10. *Descriptive; not an applied PVS1 code.*
- Nonsense-mediated decay: the premature termination codon is **in the last exon (7 of 7)** — predicted to **escape NMD**, so the truncated protein is likely expressed. An input to PVS1, not an applied code.
- SpliceAI: **not assessed** — the release is built from a substitutions-only source, so it holds no deletion variants. That is a property of the dataset, not of the variant, and is not evidence against a splicing effect.
- Repeat context: **simple_repeat** (AGGGAGTTTCATCTCTGGGACTTTTGGAAGCTGCACTTCCGGGAGGTGCACATCGGGCACAGCCATCTCGGGCACCTTCGGGAGTTGCACCTCAGGGAGTTTCATCTC, CATCTCGGGCACCTTCGGAAGTTGCACTTCAGGGAGTTTCATCTCAGGAAGTT). The alignment of this deletion is ambiguous inside a repeating unit, so the same change can be written several ways and a frequency lookup keyed on one representation can miss another. *A qualifier on how reliably this variant can be called and counted — not a pathogenicity signal.*

*Computational predictors are not independent (ClinGen Variant Classification guidance): AlphaMissense (Cheng et al. 2023) carries the ACMG weight for missense and conservation (phyloP/GERP/phastCons) for non-missense; REVEL (Pejaver-2022 calibrated strength bands) and SaProt (Su et al. 2023, structure-aware, ClinVar-independent protein language model, raw LLR) are shown as orthogonal agreement signals, not additive. For frequency, the gnomAD v4.1 grpmax filtering allele frequency (FAF95) is ClinGen's designated BA1/BS1 input (gnomAD v4 guidance v3.0, June 2025); BA1/BS1 thresholds are disease-specific, not a blanket 5%. Predictions, not a clinical determination.*

## Gene constraint & dosage {#gene-context}

**PRX** population constraint: LOEUF 1.321, pLI 2.7562e-10, missense-Z 0.59052. *Lower LOEUF and higher pLI indicate a gene that tolerates loss-of-function poorly; ClinGen dosage is the curated haploinsufficiency call.*

Curated gene–disease validity (ClinGen):

- **Charcot-Marie-Tooth disease type 4** — Definitive (AR)

## Protein context {#protein}

Residue **588** lies in the '55 x 5 aa approximate tandem repeats of [lvmag]-[psreqc]-[edkl]-[livmap]-[aqkhrpe]; that may have a tripeptide spacer of [lv]-p-[ker]' region.

AlphaFold model confidence (whole protein): pLDDT 35.74, 0% of residues very-high.

**1 experimental structure(s)** (PDB): [4CMZ](https://www.rcsb.org/structure/4CMZ).

## What this gene does {#gene-function}

*Describes the biological roles of PRX (the gene this variant disrupts) — not effects measured for this specific variant. A damaging variant is expected to affect these functions and pathways; the degree depends on the variant.*


### Pathways affected {#pathways}

PRX participates in **1 Reactome pathway** (⚕ = disease pathway):

| Pathway (Reactome) | Evidence |
| --- | --- |
| [EGR2 and SOX10-mediated initiation of Schwann cell myelination](https://reactome.org/content/detail/R-HSA-9619665) | curated |

## Clinical significance {#significance}

**Likely pathogenic** — review status Single submitter *(criteria provided, single submitter)*, last evaluated 2021-05-07.

**Submitter consensus:** unanimous (1/1 Likely pathogenic).

### Submitter classifications {#submitters}

| Submitter | Classification | Review | Method | Date |
| --- | --- | --- | --- | --- |
| Department of Pathology and Laboratory Medicine, Sinai Health System | Likely pathogenic | criteria provided, single submitter | research | 2021-05-07 |

## Associated conditions {#conditions}

[Charcot-Marie-Tooth disease type 4](https://sugi.bio/atlas/disease/charcot-marie-tooth-disease-type-4/).

**Reported phenotype names (ClinVar):** Charcot-Marie-Tooth disease type 4, Charcot-Marie-Tooth, Type 4, Charcot-Marie-Tooth disease, type IV.

## Similar variants {#similar}

Related PRX variant pages (same residue, condition, or type): [PRX p.Ala210fs](/variant/prx-p-ala210fs), [PRX p.Asp765fs](/variant/prx-p-asp765fs), [PRX p.Ile1096fs](/variant/prx-p-ile1096fs), [PRX p.Lys930fs](/variant/prx-p-lys930fs), [PRX p.Thr1033fs](/variant/prx-p-thr1033fs), [PRX p.Val525fs](/variant/prx-p-val525fs), [PRX p.629MKLPE[1]](/variant/prx-p-629mklpe-1), [PRX p.Ala1447fs](/variant/prx-p-ala1447fs).

### Data sources & attribution {#sources}

ClinVar (NCBI — public domain, built 2026-10-14); gnomAD v4.1 (Broad Institute, built 2026-10-14); AlphaMissense (Cheng et al. 2023, © Google DeepMind — CC BY 4.0, built 2026-01-27); REVEL (Ioannidis et al. 2016 — ODbL, built 2026-07-13); SaProt (Su et al. 2023 — MIT, built 2026-10-14); SpliceAI (Illumina — free for non-commercial use, built 2026-10-13); CADD (Rentzsch et al. 2019, University of Washington — free for non-commercial use, built 2026-10-10); Conservation (phyloP/phastCons/GERP) (UCSC hg38 470-way mammal (Hiller Lab) + Ensembl Compara, built 2026-07-12); gnomAD Non-coding Constraint (Gnocchi) (Chen et al. 2024, Broad Institute — CC0, built 2026-10-11); gnomAD Regional Missense Constraint (Broad Institute — CC0, built 2026-10-13); Pangolin (Zeng & Li 2022 — CC BY 4.0, built 2026-10-11); Repeat regions (UCSC — RepeatMasker, TRF, segmental duplications, built 2026-10-11); ClinGen (ClinGen, built 2026-09-22); UniProt (CC BY 4.0); Reactome / GO (CC BY 4.0, built 2026-09-23); MaveDB (per-record license, built 2026-10-11); CIViC (CC0, built 2026-09-22); Orphanet (Orphanet, built 2026-06-12)

*Primary record: NCBI ClinVar (variation 3780494). Classifications reflect these databases as of the page's build date and may change. Free reference use — not medical advice; consult the primary submitters and a clinician.*