# NM_001283009.2(RTEL1):c.897del (p.Phe299fs)

https://sugi.bio/variant/rtel1-p-phe299fs

## Summary

**RTEL1 p.Phe299fs (c.897del)** is classified **Pathogenic/Likely pathogenic** in RTEL1 (ClinVar, Multiple submitters, 5 submitters; last evaluated 2025-04-17). Very rare (popmax 0.000339%, nfe); Associated with RTEL1-related disorder.

**At a glance:** Pathogenic/Likely pathogenic · review: Multiple submitters · rsID rs1555901832 · 5 submitters · 3 linked conditions · very rare (popmax 0.000339%, nfe)

## For patients & families {#patients}

This is a change in the RTEL1 gene that is considered likely disease-causing, submitted by 5 submitters, and is linked to RTEL1-related disorder.

*Reference information, not medical advice, and not a prediction for any individual. A genetic counselor or clinician can interpret what it means for you and your family.*

**Support & next steps:** [Find a genetic counselor (NSGC)](https://findageneticcounselor.nsgc.org/).

## Identity {#identity}

| Field | Value |
| --- | --- |
| Gene | [RTEL1](https://sugi.bio/atlas/gene/RTEL1/) |
| Protein change (HGVS p.) | p.Phe299fs |
| Coding change (HGVS c.) | c.897del |
| MANE Select transcript | [NM_001283009](https://www.ncbi.nlm.nih.gov/nuccore/NM_001283009) |
| dbSNP | [rs1555901832](https://www.ncbi.nlm.nih.gov/snp/rs1555901832/) |
| Variant type | Deletion |
| Location | chr20:63674071-63674071 (GRCh38) |
| ClinVar | [VCV558110](https://www.ncbi.nlm.nih.gov/clinvar/variation/558110/) |

**All HGVS expressions:** `LRG_1149:g.21262del`, `LRG_1149t1:c.969del`, `LRG_1149t2:c.897del`, `LRG_1149t3:c.897del`, `NC_000020.10:g.62305424del`, `NC_000020.11:g.63674071del`, `NG_033901.1:g.21262del`, `NM_001283009.2:c.897del`, `NM_001283010.1:c.228del`, `NM_016434.4:c.897del`, `NM_032957.4:c.969delC`, `NM_032957.5:c.969del`, `NR_037882.1:n.1724del`

## Computational & population evidence {#evidence}

**Concordance:** 1 independent predictor **concordant** with the ClinVar classification.

- **Missense predictors (AlphaMissense/REVEL/SaProt) do not apply** to this variant type — they score amino-acid substitutions only. For non-missense variants the computational signal comes from conservation (below), not from a missing predictor score.
- Conservation: phyloP 2.659, GERP -0.007, phastCons 0.851 — highly conserved position (PP3-type support)
- Molecular consequence: **frameshift** — a predicted loss-of-function variant. Gene population constraint: LOEUF 0.661, pLI 1.271e-13. *Descriptive; not an applied PVS1 code.*
- Nonsense-mediated decay: the premature termination codon is **in exon 10 of 35**, so the transcript is predicted to undergo NMD.
- SpliceAI: **not assessed** — the release is built from a substitutions-only source, so it holds no deletion variants. That is a property of the dataset, not of the variant, and is not evidence against a splicing effect.
- Repeat context: **simple_repeat** (GCAGGGTGAGCCCCACCCGGAGTTCAGCACGGACTCCCCCAGCCCAGGTGCGTTCATAGCCAGACTGCTTGGTCCTGAGGCCTGCGCTGCT). The alignment of this deletion is ambiguous inside a repeating unit, so the same change can be written several ways and a frequency lookup keyed on one representation can miss another. *A qualifier on how reliably this variant can be called and counted — not a pathogenicity signal.*
- Population frequency (gnomAD v4.1): grpmax **0.000339%** (nfe) · FAF95 7.9e-05% · FAF99 5.4e-05% · 4/1,179,740 in the highest group · 4/1,613,058 alleles overall — very rare (popmax 0.000339%, nfe).

*Computational predictors are not independent (ClinGen Variant Classification guidance): AlphaMissense (Cheng et al. 2023) carries the ACMG weight for missense and conservation (phyloP/GERP/phastCons) for non-missense; REVEL (Pejaver-2022 calibrated strength bands) and SaProt (Su et al. 2023, structure-aware, ClinVar-independent protein language model, raw LLR) are shown as orthogonal agreement signals, not additive. For frequency, the gnomAD v4.1 grpmax filtering allele frequency (FAF95) is ClinGen's designated BA1/BS1 input (gnomAD v4 guidance v3.0, June 2025); BA1/BS1 thresholds are disease-specific, not a blanket 5%. Predictions, not a clinical determination.*

## Gene constraint & dosage {#gene-context}

**RTEL1** population constraint: LOEUF 0.661, pLI 1.271e-13, missense-Z -1.5797. *Lower LOEUF and higher pLI indicate a gene that tolerates loss-of-function poorly; ClinGen dosage is the curated haploinsufficiency call.*

Curated gene–disease validity (ClinGen):

- **pulmonary fibrosis and/or bone marrow failure, Telomere-related, 3** — Definitive (SD)

## Protein context {#protein}

Residue **299** lies in the 'disordered' region.

AlphaFold model confidence (whole protein): pLDDT 72.64, 40% of residues very-high.

**3 experimental structure(s)** (PDB): [7WU8](https://www.rcsb.org/structure/7WU8), [8P8H](https://www.rcsb.org/structure/8P8H), [8YA8](https://www.rcsb.org/structure/8YA8).

## What this gene does {#gene-function}

*Describes the biological roles of RTEL1 (the gene this variant disrupts) — not effects measured for this specific variant. A damaging variant is expected to affect these functions and pathways; the degree depends on the variant.*

**How this variant is thought to act:** RTEL1's established molecular role includes DNA helicase activity. p.Phe299fs falls in the disordered region.


### Pathways affected {#pathways}

RTEL1 participates in **3 Reactome pathways** (⚕ = disease pathway):

| Pathway (Reactome) | Evidence |
| --- | --- |
| [Resolution of D-loop Structures through Synthesis-Dependent Strand Annealing (SDSA)](https://reactome.org/content/detail/R-HSA-5693554) | curated |
| [Telomere Extension By Telomerase](https://reactome.org/content/detail/R-HSA-171319) | curated |
| [Cytosolic iron-sulfur cluster assembly](https://reactome.org/content/detail/R-HSA-2564830) | electronic |

### Molecular function & processes (GO — experimentally supported) {#go}

**Molecular function:** DNA helicase activity, ATP binding.

**Biological process:** telomere maintenance, regulation of double-strand break repair via homologous recombination, telomeric loop disassembly, positive regulation of telomere capping, positive regulation of telomere maintenance via telomere lengthening, negative regulation of t-circle formation.

## Clinical significance {#significance}

**Pathogenic/Likely pathogenic** — review status Multiple submitters *(criteria provided, multiple submitters, no conflicts)*, last evaluated 2025-04-17.

**Submitter consensus:** conflicting (4 Likely pathogenic, 1 Pathogenic).

**Submission history:** 5 submissions (2018–2025); classifications have differed over time.

### Submitter classifications {#submitters}

| Submitter | Classification | Review | Method | Date |
| --- | --- | --- | --- | --- |
| PreventionGenetics, part of Exact Sciences | Likely pathogenic | criteria provided, single submitter | clinical testing | 2023-09-28 |
| Baylor Genetics | Likely pathogenic | criteria provided, single submitter | clinical testing | 2023-11-20 |
| GeneDx | Likely pathogenic | criteria provided, single submitter | clinical testing | 2024-03-26 |
| Counsyl | Likely pathogenic | no assertion criteria provided | clinical testing | 2018-04-27 |
| Labcorp Genetics (formerly Invitae), Labcorp | Pathogenic | criteria provided, single submitter | clinical testing | 2025-04-17 |

## Associated conditions {#conditions}

[RTEL1-related disorder](https://sugi.bio/atlas/disease/rtel1-related-disorder/), [dyskeratosis congenita, autosomal recessive 5](https://sugi.bio/atlas/disease/dyskeratosis-congenita-autosomal-recessive-5/), [pulmonary fibrosis and/or bone marrow failure, Telomere-related, 3](https://sugi.bio/atlas/disease/pulmonary-fibrosis-and-or-bone-marrow-failure-telomere-related-3/).

**Reported phenotype names (ClinVar):** RTEL1-related disorder, Dyskeratosis congenita, autosomal recessive 5, Pulmonary fibrosis and/or bone marrow failure, Telomere-related, 3, not provided, RTEL1-related condition, RTEL1-related disorders, PULMONARY FIBROSIS AND/OR BONE MARROW FAILURE SYNDROME, TELOMERE-RELATED, 3, none provided.

## Similar variants {#similar}

Related RTEL1 variant pages (same residue, condition, or type): [RTEL1 p.Phe299Leu](/variant/rtel1-p-phe299leu), [RTEL1 c.1236_1266+47del](/variant/rtel1-c-1236-1266-plus-47del), [RTEL1 p.Arg733fs](/variant/rtel1-p-arg733fs), [RTEL1 p.Arg879fs](/variant/rtel1-p-arg879fs), [RTEL1 p.Arg986fs](/variant/rtel1-p-arg986fs), [RTEL1 p.Asn637fs](/variant/rtel1-p-asn637fs), [RTEL1 p.Gln1187fs](/variant/rtel1-p-gln1187fs), [RTEL1 p.Glu981fs](/variant/rtel1-p-glu981fs).

### Data sources & attribution {#sources}

ClinVar (NCBI — public domain, built 2026-10-14); gnomAD v4.1 (Broad Institute, built 2026-10-06); AlphaMissense (Cheng et al. 2023, © Google DeepMind — CC BY 4.0, built 2026-01-27); REVEL (Ioannidis et al. 2016 — ODbL, built 2026-07-13); SaProt (Su et al. 2023 — MIT, built 2026-10-14); SpliceAI (Illumina — free for non-commercial use, built 2026-10-13); CADD (Rentzsch et al. 2019, University of Washington — free for non-commercial use, built 2026-10-10); Conservation (phyloP/phastCons/GERP) (UCSC hg38 470-way mammal (Hiller Lab) + Ensembl Compara, built 2026-07-12); gnomAD Non-coding Constraint (Gnocchi) (Chen et al. 2024, Broad Institute — CC0, built 2026-10-11); gnomAD Regional Missense Constraint (Broad Institute — CC0, built 2026-10-13); Pangolin (Zeng & Li 2022 — CC BY 4.0, built 2026-10-11); Repeat regions (UCSC — RepeatMasker, TRF, segmental duplications, built 2026-10-11); ClinGen (ClinGen, built 2026-09-22); UniProt (CC BY 4.0); Reactome / GO (CC BY 4.0, built 2026-09-23); MaveDB (per-record license, built 2026-10-11); CIViC (CC0, built 2026-09-22); Orphanet (Orphanet, built 2026-06-12)

*Primary record: NCBI ClinVar (variation 558110). Classifications reflect these databases as of the page's build date and may change. Free reference use — not medical advice; consult the primary submitters and a clinician.*