Is ACSF3 p.Val460fs (c.1378dup) pathogenic?

ACSF3 p.Val460fs (c.1378dup) is classified Pathogenic/Likely pathogenic in ACSF3 (ClinVar, Multiple submitters, 5 submitters; last evaluated 2025-12-30). Very rare (popmax 0.00127%, nfe); Associated with combined malonic and methylmalonic acidemia.

What condition is associated with ACSF3 p.Val460fs (c.1378dup)?

ACSF3 p.Val460fs (c.1378dup) is associated with combined malonic and methylmalonic acidemia (ClinVar).

How common is ACSF3 p.Val460fs (c.1378dup) in the general population?

ACSF3 p.Val460fs (c.1378dup) is very rare (popmax 0.00127%, nfe) (gnomAD).

How is Combined malonic and methylmalonic acidemia inherited?

Typically Autosomal dominant, Autosomal recessive (Orphanet). A genetic counselor can assess individual risk for a family.

ACSF3 p.Val460fs

c.1378dup · rs751342087 · VCV426372

Pathogenic/Likely pathogenic Multiple submitters

Classification

Pathogenic/Likely pathogenic

ClinVar

Review

Multiple submitters ★★☆☆

ClinVar · 5 submitters

Consequence

frameshift

predicted LoF

gnomAD v4.1

Rare

very rare (popmax 0.00127%, nfe)

Conditions

combined malonic and methylmalonic acidemia

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function
NMD	predicted	premature termination codon in exon 9 of 11
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP 0.79	GERP -2.7, phastCons 0.28
Overall
CADD	21.0	PHRED · no single calibrated threshold — expert panels disagree
Region caveats
Repeat context	tandem	TAACCAGAGCCCCTTTTCCTCAGGGGACACCGTGGTGTTTAAGGATGGCCAGT simple repeat · ambiguous alignment · confidence, not pathogenicity

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Population frequency

gnomAD v4.1 · exomes + genomes

Grpmax group 0.00127% European (non-Finnish) · 15/1,179,910 alleles

Filtering AF 0.000763% ClinGen BA1/BS1 input FAF95, joint · FAF99 0.000605%

Overall 0.00093% 15/1,613,566 alleles · very rare

Rarity supports pathogenicity (ACMG PM2); frequency above a disease-specific BA1/BS1 threshold argues against it. A variant frequent in one ancestry group can be near-absent in others, so a single global figure can mislead.

Variant & gene context

Gene: ACSF3
Protein: p.Val460fs
Coding: c.1378dup
MANE Select: NM_001243279
dbSNP: rs751342087
Type: Duplication
Location: chr16:89145276 (GRCh38)
Gene constraint: LOEUF 1.715 · pLI <0.01 · ClinGen HI gene assoc. with recessive phenotype (gnomAD)
Structure: AlphaFold pLDDT 86.58

Full ACSF3 gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Disease context

combined malonic and methylmalonic acidemia — disease report on Sugi Atlas → Associated genes, phenotypes, clinical trials & treatments

For Combined malonic and methylmalonic acidemia (Orphanet):

Inheritance: Autosomal dominant, Autosomal recessive
Onset: All ages
Prevalence: 1-9 / 100 000 (United States)

Similar variants

ACSF3 p.Val460_Phe461insTer Likely pathogenic ★ same residue
ACSF3 p.Val460= Likely benign ★ same residue
ACSF3 p.Ala253fs Pathogenic/Likely pathogenic ★★ same condition
ACSF3 p.His526fs Likely pathogenic ★★ same condition
ACSF3 p.Leu522fs Likely pathogenic ★★ same condition
ACSF3 p.Lys444Ter Pathogenic/Likely pathogenic ★★ same condition
ACSF3 p.Val484fs Likely pathogenic ★★ same condition
ACSF3 p.Val516fs Pathogenic/Likely pathogenic ★★ same condition

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/acsf3-p-val460fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown