Is ANK2 p.Ser1879fs (c.5635_5638del) pathogenic?

ANK2 p.Ser1879fs (c.56355638del) is classified Pathogenic in ANK2 (ClinVar, Single submitter, 1 submitter; last evaluated 2023-07-17). Associated with neurodevelopmental disorder.

What condition is associated with ANK2 p.Ser1879fs (c.5635_5638del)?

ANK2 p.Ser1879fs (c.5635_5638del) is associated with neurodevelopmental disorder (ClinVar).

ANK2 p.Ser1879fs

c.5635_5638del · VCV3376711

Pathogenic Single submitter

Classification

Pathogenic

ClinVar

Review

Single submitter ★☆☆☆

ClinVar · 1 submitter

Consequence

frameshift

predicted LoF

gnomAD v4.1

Rare

Conditions

neurodevelopmental disorder

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function in a haploinsufficient gene (ClinGen)
NMD	predicted	premature termination codon in exon 38 of 46
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP 0.047	GERP -5.3, phastCons 0.001
Region caveats
Repeat context	tandem	GCAAAAACTGAAAGGCACTCTCCTGTGTCATCATCAAGTAAAACTGAGAAACACTCACCTGTATCACCCTCT simple repeat · ambiguous alignment · confidence, not pathogenicity

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Variant & gene context

Gene: ANK2
Protein: p.Ser1879fs
Coding: c.5635_5638del
MANE Select: NM_001148
Type: Deletion
Location: chr4:113354250 (GRCh38)
Gene constraint: LOEUF 0.271 · pLI 1.00 · ClinGen HI 3/3 (gnomAD)
Residue 1879: the 'disordered' region; the 'repeat-rich region' region

Full ANK2 gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Disease context

neurodevelopmental disorder — disease report on Sugi Atlas → Associated genes, phenotypes, clinical trials & treatments

Similar variants

ANK2 p.Leu3438fs Pathogenic ★ same condition
ANK2 p.Met1988Thr Uncertain significance ★★ ⚠ same condition
ANK2 p.Asp3180fs Pathogenic ★ same condition
ANK2 p.Glu1460Ter Pathogenic ★ same condition
ANK2 p.Gly2083fs Pathogenic ★ same condition
ANK2 p.Ala1027Asp Uncertain significance ★ same condition
ANK2 p.Arg1305Ter Conflicting classifications of pathogenicity ★ ⚠ same condition
ANK2 p.Gly3456fs Pathogenic/Likely pathogenic ★★ same type

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/ank2-p-ser1879fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown