Is BRCA1 p.Asn1043fs (c.3129_3138del) pathogenic?

BRCA1 p.Asn1043fs (c.31293138del) is classified Pathogenic in BRCA1 (ClinVar, Expert panel, 3 submitters; last evaluated 2016-09-08). Very rare (popmax 0.0011%, sas); Associated with breast-ovarian cancer, familial, susceptibility to, 1.

What condition is associated with BRCA1 p.Asn1043fs (c.3129_3138del)?

BRCA1 p.Asn1043fs (c.3129_3138del) is associated with breast-ovarian cancer, familial, susceptibility to, 1 (ClinVar).

How common is BRCA1 p.Asn1043fs (c.3129_3138del) in the general population?

BRCA1 p.Asn1043fs (c.3129_3138del) is very rare (popmax 0.0011%, sas) (gnomAD).

How is Hereditary breast and/or ovarian cancer syndrome inherited?

Typically Autosomal dominant (Orphanet). A genetic counselor can assess individual risk for a family.

BRCA1 p.Asn1043fs

c.3129_3138del · rs730881462 · VCV182111

Pathogenic Expert panel

Classification

Pathogenic

ClinVar

Review

Expert panel ★★★☆

ClinVar · 3 submitters

Consequence

frameshift

predicted LoF

gnomAD v4.1

Rare

very rare (popmax 0.0011%, sas)

Conditions

breast-ovarian cancer, familial, susceptibility to, 1

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function in a haploinsufficient gene (ClinGen)
NMD	predicted	premature termination codon in exon 10 of 23
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP 0.99	GERP -0.051, phastCons 0.62
Region caveats
Repeat context	tandem	ACTGGAACCTACTTCATTAAT simple repeat · ambiguous alignment · confidence, not pathogenicity

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Population frequency

gnomAD v4.1 · exomes + genomes

Grpmax group 0.0011% South Asian · 1/91,078 alleles

Overall 6.84e-05% 1/1,461,670 alleles · very rare

Rarity supports pathogenicity (ACMG PM2); frequency above a disease-specific BA1/BS1 threshold argues against it. A variant frequent in one ancestry group can be near-absent in others, so a single global figure can mislead.

Variant & gene context

Gene: BRCA1
Protein: p.Asn1043fs
Coding: c.3129_3138del
MANE Select: NM_007294
dbSNP: rs730881462
Type: Deletion
Location: chr17:43092393 (GRCh38)
Gene constraint: LOEUF 0.885 · pLI <0.01 · ClinGen HI 3/3 (gnomAD)
Structure: AlphaFold pLDDT 41.99 · 33 PDB
Residue 1043: a UniProt-annotated variant site (in fancs)

Full BRCA1 gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Disease context

breast-ovarian cancer, familial, susceptibility to, 1 — disease report on Sugi Atlas → Associated genes, phenotypes, clinical trials & treatments

For Hereditary breast and/or ovarian cancer syndrome (Orphanet):

Inheritance: Autosomal dominant
Onset: Adult, Elderly

Similar variants

BRCA1 c.302-2del Pathogenic ★★★ same condition
BRCA1 c.4358_4484del Pathogenic ★★★ same condition
BRCA1 c.442-22_442-13del Pathogenic ★★★ same condition
BRCA1 c.4484+1del Pathogenic ★★★ same condition
BRCA1 c.5277+1_5277+6del Pathogenic ★★★ same condition
BRCA1 c.5278-2del Pathogenic ★★★ same condition
BRCA1 c.5333-36_5406+400del Pathogenic ★★★ same condition
BRCA1 c.5470_5477del Pathogenic ★★★ same condition

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/brca1-p-asn1043fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown