Is CCDC8 p.Ala353fs (c.1057del) pathogenic?

CCDC8 p.Ala353fs (c.1057del) is classified Likely pathogenic in CCDC8 (ClinVar, Single submitter, 1 submitter; last evaluated 2024-11-06). Very rare (popmax 0.000254%, nfe); Associated with 3M syndrome 3.

What condition is associated with CCDC8 p.Ala353fs (c.1057del)?

CCDC8 p.Ala353fs (c.1057del) is associated with 3M syndrome 3 (ClinVar).

How common is CCDC8 p.Ala353fs (c.1057del) in the general population?

CCDC8 p.Ala353fs (c.1057del) is very rare (popmax 0.000254%, nfe) (gnomAD).

CCDC8 p.Ala353fs

c.1057del · VCV3374708

Likely pathogenic Single submitter

Classification

Likely pathogenic

ClinVar

Review

Single submitter ★☆☆☆

ClinVar · 1 submitter

Consequence

frameshift

predicted LoF

gnomAD v4.1

Rare

very rare (popmax 0.000254%, nfe)

Conditions

3M syndrome 3

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function
NMD	escapes	premature termination codon in the last exon (1 of 1) — the truncated protein is likely expressed. PVS1 input, not an applied code
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP -8.6	GERP -2.5
Overall
CADD	20.8	PHRED · no single calibrated threshold — expert panels disagree
Region caveats
Repeat context	tandem	CCCTGGTCAGCTGGGGCCCCTGCCCTCTGATTATCTGCAGCCTCTTCCCTCTGATTATCTGCAGCCTCTGAC simple repeat · ambiguous alignment · confidence, not pathogenicity

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Population frequency

gnomAD v4.1 · exomes + genomes

Grpmax group 0.000254% European (non-Finnish) · 3/1,179,690 alleles

Filtering AF 6.8e-05% ClinGen BA1/BS1 input FAF95, joint · FAF99 1.9e-05%

Overall 0.000248% 4/1,612,516 alleles · very rare

Ancestry group	Frequency	1 in
Remaining individualsnot grpmax-eligible	0.0016%	62,434
European (non-Finnish)grpmax	0.000254%	393,230

Remaining individuals shows a higher raw frequency than the grpmax group above it. gnomAD excludes bottlenecked groups — Finnish, Ashkenazi Jewish, Amish and “Remaining individuals” — from grpmax, because founder effects make their frequencies unrepresentative for filtering. The table is sorted by frequency, so an excluded group can sit above the grpmax row.

Rarity supports pathogenicity (ACMG PM2); frequency above a disease-specific BA1/BS1 threshold argues against it. A variant frequent in one ancestry group can be near-absent in others, so a single global figure can mislead.

Variant & gene context

Gene: CCDC8
Protein: p.Ala353fs
Coding: c.1057del
MANE Select: NM_032040
Type: Deletion
Location: chr19:46411754 (GRCh38)
Gene constraint: LOEUF 1.796 · pLI <0.01 · ClinGen HI gene assoc. with recessive phenotype (gnomAD)
Structure: AlphaFold pLDDT 46.83 · 1 PDB
Residue 353: the 'disordered' region

Full CCDC8 gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Disease context

3M syndrome 3 — disease report on Sugi Atlas → Associated genes, phenotypes, clinical trials & treatments

Similar variants

CCDC8 p.Gln327fs Pathogenic/Likely pathogenic ★★ same condition
CCDC8 p.Glu337_Arg344del Uncertain significance ★★ same condition
CCDC8 p.Ala323fs Likely pathogenic ★ same condition
CCDC8 p.Asp247fs Likely pathogenic ★ same condition
CCDC8 p.Gln68fs Likely pathogenic ★ same condition
CCDC8 p.Gly95fs Likely pathogenic ★ same condition
CCDC8 p.Ser108fs Likely pathogenic ★ same condition
CCDC8 p.Asn270fs Uncertain significance ★ same condition

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/ccdc8-p-ala353fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown