CCDC82 p.Ser69fs
c.205del · rs2496617365 · VCV2571812
Computational evidence
| Protein change | ||
| Missense predictors do not apply to this variant type; conservation carries the signal. | ||
| Consequence | frameshift | predicted loss-of-function |
|---|---|---|
| NMD | predicted | premature termination codon in exon 4 of 10 |
| Splicing | ||
| SpliceAI | — | not assessed · substitutions only |
| Constraint at this position | ||
| Conservation | phyloP -0.22 | GERP 1.1 |
| Region caveats | ||
| Repeat context | tandem | ACTATCAAGCTCTTCATCACTATCAAACTTCATC simple repeat · ambiguous alignment · confidence, not pathogenicity |
Predicted loss-of-function is descriptive, not an applied PVS1 code.
Population frequency
No gnomAD frequency available for this variant. This is missing data, not an absence: the variant may or may not be present in gnomAD. Rarity (ACMG PM2) and BA1/BS1 cannot be assessed for it.
Variant & gene context
- Gene
- CCDC82
- Protein
- p.Ser69fs
- Coding
- c.205del
- MANE Select
- NM_024725
- dbSNP
- rs2496617365
- Type
- Deletion
- Location
- chr11:96384543 (GRCh38)
- Gene constraint
- LOEUF 1.06 · pLI <0.01 (gnomAD)
- Structure
- AlphaFold pLDDT 64.94
- Residue 69
- the 'disordered' region
Similar variants
- CCDC82 p.Phe61fs Pathogenic ★ same type
- CCDC82 p.Cys424fs Uncertain significance ★ same type
- CCDC82 p.Asp125fs Uncertain significance same type
Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →
Cite Sugi Variant
Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/ccdc82-p-ser69fs (accessed [today's date]).
Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown