Is CDSN p.Ser153del (c.447_449del) pathogenic?

CDSN p.Ser153del (c.447449del) is classified Benign in CDSN (ClinVar, Single submitter, 1 submitter; last evaluated 2026-02-04). Common (popmax 25.5%, nfe) — too common for a highly-penetrant pathogenic allele.

CDSN p.Ser153del

Q: How common is CDSN p.Ser153del (c.447_449del) in the general population?

CDSN p.Ser153del (c.447_449del) is common (popmax 25.5%, nfe) — too common for a highly-penetrant pathogenic allele (gnomAD).

c.447_449del · rs34182778 · VCV1673182

Benign Single submitter

Classification

Benign

ClinVar

Review

Single submitter ★☆☆☆

ClinVar · 1 submitter

gnomAD v4.1

Common

common (popmax 25.5%, nfe) — too common for a highly-penetrant pathogenic allele

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP 1.4	phastCons 0.004
Overall
CADD	1.971	PHRED · no single calibrated threshold — expert panels disagree
Region caveats
Repeat context	tandem	GCTGCTGCTGCTCGAATGAAAGCT simple repeat · ambiguous alignment · confidence, not pathogenicity

Population frequency

gnomAD v4.1 · exomes + genomes

Grpmax group 25.5% European (non-Finnish) · 300,361/1,179,550 alleles

Filtering AF 25.4% ClinGen BA1/BS1 input FAF95, joint · FAF99 25.4%

Overall 23.5% 378,688/1,613,468 alleles · common

Ancestry group	Frequency	1 in
Amishnot grpmax-eligible	27%	4
European (non-Finnish)grpmax	25.5%	4
Remaining individualsnot grpmax-eligible	23.4%	4
African / African-American	21.9%	5
South Asian	19.7%	5
East Asian	18.9%	5
Ashkenazi Jewishnot grpmax-eligible	16%	6
Middle Eastern	14%	7
Finnishnot grpmax-eligible	13%	8
Admixed American	11.3%	9

Amish shows a higher raw frequency than the grpmax group above it. gnomAD excludes bottlenecked groups — Finnish, Ashkenazi Jewish, Amish and “Remaining individuals” — from grpmax, because founder effects make their frequencies unrepresentative for filtering. The table is sorted by frequency, so an excluded group can sit above the grpmax row.

Rarity supports pathogenicity (ACMG PM2); frequency above a disease-specific BA1/BS1 threshold argues against it. A variant frequent in one ancestry group can be near-absent in others, so a single global figure can mislead.

Variant & gene context

Gene: CDSN
Protein: p.Ser153del
Coding: c.447_449del
MANE Select: NM_001264
dbSNP: rs34182778
Type: Deletion
Location: chr6:31117166 (GRCh38)
Gene constraint: LOEUF 0.77 · pLI 0.08 (gnomAD)
Structure: AlphaFold pLDDT 38.13
Residue 153: a UniProt-annotated variant site (sequence variant); the 'disordered' region

Full CDSN gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Similar variants

CDSN p.Ser195fs Likely pathogenic ★ same type
CDSN p.Asn527fs Uncertain significance ★ same type
CDSN p.Ser455fs Uncertain significance ★ same type
PSORS1C1 c.-229+1133_-229+1145delinsATGGACTGTC Uncertain significance ★ same type
CDSN p.Gly249fs Pathogenic same type

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/cdsn-p-ser153del (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown