Is CNOT3 p.Ser412del (c.1224CAG[2]) pathogenic?

CNOT3 p.Ser412del (c.1224CAG[2]) is classified Uncertain significance in CNOT3 (ClinVar, Single submitter, 1 submitter; last evaluated 2023-04-01). Very rare (popmax 0.000434%, nfe).

How common is CNOT3 p.Ser412del (c.1224CAG[2]) in the general population?

CNOT3 p.Ser412del (c.1224CAG[2]) is very rare (popmax 0.000434%, nfe) (gnomAD).

CNOT3 p.Ser412del

c.1224CAG[2] · rs1456346597 · VCV2571055

Uncertain significance Single submitter

Classification

Uncertain significance

ClinVar

Review

Single submitter ★☆☆☆

ClinVar · 1 submitter

gnomAD v4.1

Rare

very rare (popmax 0.000434%, nfe)

Computational evidence

Protein change
Missense predictors do not apply to this variant type.
Splicing
SpliceAI	—	not assessed · substitutions only
Region caveats
Repeat context	tandem	AGCGGAGGCGGAGGCGGCAGC simple repeat · ambiguous alignment · confidence, not pathogenicity

Population frequency

gnomAD v4.1 · exomes + genomes

Grpmax group 0.000434% European (non-Finnish) · 5/1,150,930 alleles

Filtering AF 0.000127% ClinGen BA1/BS1 input FAF95, joint · FAF99 9.3e-05%

Overall 0.000426% 6/1,408,942 alleles · very rare

Ancestry group	Frequency	1 in
Remaining individualsnot grpmax-eligible	0.00166%	60,192
European (non-Finnish)grpmax	0.000434%	230,186

Remaining individuals shows a higher raw frequency than the grpmax group above it. gnomAD excludes bottlenecked groups — Finnish, Ashkenazi Jewish, Amish and “Remaining individuals” — from grpmax, because founder effects make their frequencies unrepresentative for filtering. The table is sorted by frequency, so an excluded group can sit above the grpmax row.

Rarity supports pathogenicity (ACMG PM2); frequency above a disease-specific BA1/BS1 threshold argues against it. A variant frequent in one ancestry group can be near-absent in others, so a single global figure can mislead.

Variant & gene context

Gene: CNOT3
Protein: p.Ser412del
Coding: c.1224CAG[2]
MANE Select: NM_014516
dbSNP: rs1456346597
Type: Microsatellite
Location: chr19:54148475 (GRCh38)
Gene constraint: LOEUF 0.057 · pLI 1.00 · ClinGen HI 0/3 (gnomAD)
Structure: AlphaFold pLDDT 68.53 · 6 PDB
Residue 412: the 'disordered' region

Full CNOT3 gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Similar variants

CNOT3 p.Asn276fs Pathogenic ★★ same type
CNOT3 p.Val660fs Pathogenic ★★ same type
CNOT3 p.Asp630_Ser631insTer Pathogenic ★ same type
CNOT3 p.Ile571del Likely pathogenic ★ same type
CNOT3 p.Lys50del Likely pathogenic ★ same type
CNOT3 p.245SH[3] Uncertain significance ★ same type
CNOT3 p.Asp285del Uncertain significance ★ same type
CNOT3 p.Gly402_Ser403insGlyGly Conflicting classifications of pathogenicity ★ same type

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/cnot3-p-ser412del (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown