Is DOCK6 p.Leu206fs (c.616_617del) pathogenic?

DOCK6 p.Leu206fs (c.616617del) is classified Pathogenic in DOCK6 (ClinVar, Single submitter, 1 submitter; last evaluated 2025-05-22). Very rare (popmax 0.00017%, nfe).

How common is DOCK6 p.Leu206fs (c.616_617del) in the general population?

DOCK6 p.Leu206fs (c.616_617del) is very rare (popmax 0.00017%, nfe) (gnomAD).

DOCK6 p.Leu206fs

c.616_617del · rs1321312835 · VCV2069357

Pathogenic Single submitter

Classification

Pathogenic

ClinVar

Review

Single submitter ★☆☆☆

ClinVar · 1 submitter

Consequence

frameshift

predicted LoF

gnomAD v4.1

Rare

very rare (popmax 0.00017%, nfe)

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function
NMD	predicted	premature termination codon in exon 6 of 48
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP 0.29	GERP -2.5, phastCons 0.98

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Population frequency

gnomAD v4.1 · exomes + genomes

Grpmax group 0.00017% European (non-Finnish) · 2/1,179,858 alleles

Filtering AF 2.8e-05% ClinGen BA1/BS1 input FAF95, joint · FAF99 1.1e-05%

Overall 0.000137% 2/1,461,564 alleles · very rare

Rarity supports pathogenicity (ACMG PM2); frequency above a disease-specific BA1/BS1 threshold argues against it. A variant frequent in one ancestry group can be near-absent in others, so a single global figure can mislead.

Variant & gene context

Gene: DOCK6
Protein: p.Leu206fs
Coding: c.616_617del
MANE Select: NM_020812
dbSNP: rs1321312835
Type: Microsatellite
Location: chr19:11250977 (GRCh38)
Gene constraint: LOEUF 0.87 · pLI <0.01 (gnomAD)
Structure: AlphaFold pLDDT 77.78 · 7 PDB

Full DOCK6 gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Similar variants

DOCK6 p.Leu207fs Pathogenic/Likely pathogenic ★★ same type
DOCK6 p.Lys1928fs Pathogenic ★★ same type
DOCK6 p.Ser1511fs Likely pathogenic ★★ same type
DOCK6 p.Asp1804_Ser1805insTer Likely pathogenic ★ same type
DOCK6 c.5938_5939+1del Uncertain significance ★ same type
DOCK6 p.Ile1399del Uncertain significance ★ same type
DOCK6 c.2815-95CCCCACCCACAGCCCTTCAAG[3] Likely benign ★ same type
DOCK6 c.309-12_309-10del Likely benign ★ same type

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/dock6-p-leu206fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown