DRD4 p.Arg271fs
c.810_824delinsA · VCV3779291
Uncertain significance
Single submitter
Classification
Uncertain significance
ClinVar
Review
Single submitter ★☆☆☆
ClinVar · 1 submitter
Consequence
frameshift
predicted LoF
gnomAD v4.1
Rare
Conditions
1
DRD4-related disorder
Computational evidence
| Protein change | ||
| Missense predictors do not apply to this variant type; conservation carries the signal. | ||
| Consequence | frameshift | predicted loss-of-function |
|---|---|---|
| NMD | predicted | premature termination codon in exon 3 of 4 |
| Splicing | ||
| SpliceAI | — | not assessed · substitutions only |
| Constraint at this position | ||
| Conservation | phyloP 0.055 | GERP -1.6 |
| Region caveats | ||
| Repeat context | tandem | CGCCCCCCGCGCCCGGCCTCCCCCAGGACCCCTGCGGCCCCGACTGTG simple repeat · ambiguous alignment · confidence, not pathogenicity |
Predicted loss-of-function is descriptive, not an applied PVS1 code.
Variant & gene context
- Gene
- DRD4
- Protein
- p.Arg271fs
- Coding
- c.810_824delinsA
- MANE Select
- NM_000797
- Type
- Indel
- Location
- chr11:640059 (GRCh38)
- Gene constraint
- LOEUF 1.952 · pLI <0.01 (gnomAD)
- Structure
- AlphaFold pLDDT 78.06 · 2 PDB
- Residue 271
- the '4 x 16 aa approximate tandem repeats of [pa]-a-p-g-l-p-[pqr]-[dg]-p-c-g-p-d-c-a-p' region; a UniProt-annotated variant site (in allele d4.2)
Disease context
DRD4-related disorder
Similar variants
- DRD4 p.Arg271Gln Uncertain significance ★ ⚠ same residue
- DRD4 p.Ala79fs Benign/Likely benign ★★ same condition
- DRD4 p.Ala36Val Uncertain significance ★ ⚠ same condition
- DRD4 p.Cys372Tyr Uncertain significance ⚠ same condition
- DRD4 p.Pro246His Uncertain significance ⚠ same condition
- DRD4 c.285+7C>T Likely benign same condition
- DRD4 p.22ASAG[1] Benign same condition
- DRD4 p.Ala228= Likely benign same condition
Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →
Cite Sugi Variant
Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/drd4-p-arg271fs (accessed [today's date]).
Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown