Is DRD4 p.Cys262fs (c.786_871del) pathogenic?

DRD4 p.Cys262fs (c.786871del) is classified Likely benign in DRD4 (ClinVar, Single submitter, 1 submitter; last evaluated 2024-07-01). Ultra-rare (popmax 0.0905%, amr).

How common is DRD4 p.Cys262fs (c.786_871del) in the general population?

DRD4 p.Cys262fs (c.786_871del) is ultra-rare (popmax 0.0905%, amr) (gnomAD).

DRD4 p.Cys262fs

c.786_871del · VCV4910063

Likely benign Single submitter

Classification

Likely benign

ClinVar

Review

Single submitter ★☆☆☆

ClinVar · 1 submitter

Consequence

frameshift

predicted LoF

gnomAD v4.1

Rare

ultra-rare (popmax 0.0905%, amr)

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function
NMD	predicted	premature termination codon in exon 3 of 4
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP -0.4	GERP -1.7
Region caveats
Repeat context	tandem	CGCCCCCCGCGCCCGGCCTCCCCCAGGACCCCTGCGGCCCCGACTGTG simple repeat · ambiguous alignment · confidence, not pathogenicity

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Population frequency

gnomAD v4.1 · exomes + genomes

Grpmax group 0.0905% Admixed American · 17/18,782 alleles

Filtering AF 0.0576% ClinGen BA1/BS1 input FAF95, joint · FAF99 0.0473%

Overall 0.0273% 314/1,148,850 alleles · ultra-rare exomes 257/1,035,148 · genomes 57/113,702 · joint denominator

Ancestry group	Frequency	1 in
Admixed Americangrpmax	0.0905%	1,105
South Asian	0.0685%	1,459
East Asian	0.0586%	1,705
Finnishnot grpmax-eligible	0.0322%	3,108
European (non-Finnish)	0.0254%	3,937
African / African-American	0.0174%	5,749
Remaining individualsnot grpmax-eligible	0.0142%	7,041
Ashkenazi Jewishnot grpmax-eligible	0.00625%	15,996

Rarity supports pathogenicity (ACMG PM2); frequency above a disease-specific BA1/BS1 threshold argues against it. A variant frequent in one ancestry group can be near-absent in others, so a single global figure can mislead.

Variant & gene context

Gene: DRD4
Protein: p.Cys262fs
Coding: c.786_871del
MANE Select: NM_000797
Type: Deletion
Location: chr11:640034 (GRCh38)
Gene constraint: LOEUF 1.952 · pLI <0.01 (gnomAD)
Structure: AlphaFold pLDDT 78.06 · 2 PDB
Residue 262: the 'disordered' region; the '4 x 16 aa approximate tandem repeats of [pa]-a-p-g-l-p-[pqr]-[dg]-p-c-g-p-d-c-a-p' region

Full DRD4 gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Similar variants

DRD4 p.Gln255fs Uncertain significance ★★ same type
DRD4 p.Ala79fs Benign/Likely benign ★★ same type
DRD4 p.Pro18fs Uncertain significance ★ same type
DRD4 p.Pro265_Pro280del Uncertain significance ★ same type
DRD4 p.Thr247_Pro249del Likely benign ★ same type
DRD4 p.Gly275fs Likely benign same type
DRD4 p.Ser284_Pro299del Benign same type

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/drd4-p-cys262fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown