Is ELN p.Pro578fs (c.1733del) pathogenic?

ELN p.Pro578fs (c.1733del) is classified Pathogenic/Likely pathogenic in ELN (ClinVar, Multiple submitters, 2 submitters; last evaluated 2025-01-14). No gnomAD frequency available for this variant; Associated with supravalvular aortic stenosis.

What condition is associated with ELN p.Pro578fs (c.1733del)?

ELN p.Pro578fs (c.1733del) is associated with supravalvular aortic stenosis (ClinVar).

How common is ELN p.Pro578fs (c.1733del) in the general population?

ELN p.Pro578fs (c.1733del) is no gnomAD frequency available for this variant (gnomAD).

ELN p.Pro578fs

c.1733del · rs727503782 · VCV163394

Pathogenic/Likely pathogenic Multiple submitters

Classification

Pathogenic/Likely pathogenic

ClinVar

Review

Multiple submitters ★★☆☆

ClinVar · 2 submitters

Consequence

frameshift

predicted LoF

gnomAD v4.1

Not reported

no gnomAD frequency available for this variant

Conditions

supravalvular aortic stenosis

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function; NMD-escape possible for C-terminal truncations
Splicing
SpliceAI	—	not looked up on this page · why
Constraint at this position
Conservation	phyloP -0.43	GERP -3.5, phastCons 0.035
Region caveats
Repeat context	tandem	TTGGTGCTGGCGTCCCTGGACTTGGAG simple repeat · ambiguous alignment · confidence, not pathogenicity

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Population frequency

dbSNP / gnomAD

No gnomAD frequency available for this variant. This is missing data, not an absence: the variant may or may not be present in gnomAD. Rarity (ACMG PM2) and BA1/BS1 cannot be assessed for it.

Variant & gene context

Gene: ELN
Protein: p.Pro578fs
Coding: c.1733del
dbSNP: rs727503782
Type: Deletion
Location: chr7:74060486 (GRCh38)

Full ELN gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Disease context

supravalvular aortic stenosis — disease report on Sugi Atlas → Associated genes, phenotypes, clinical trials & treatments

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/eln-p-pro578fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown