RYR3 — 1945 ClinVar variants

All ClinVar germline RYR3 variants across every classification, each assembled from ClinVar, gnomAD, AlphaMissense, conservation and more. 621 flagged for review →

1 Pathogenic · 51 Conflicting · 94 Benign · 36 Benign/Likely benign · 566 Likely benign · 1197 Uncertain significance

Full RYR3 gene report on Sugi Atlas → Gene function, pathways, protein structure, constraint & interactions

⚑ Evidence disagreements 621

Variants where the independent computational evidence doesn't line up with the clinical picture — a QC signal for a second look, not a reclassification.

Predictors vs ClinVar 1

ClinVar calls these pathogenic, but the computational predictors lean tolerated — the highest-value review flag.

RYR3 p.Gln2083Pro Pathogenic Single submitter
hydrops fetalis

Predictors agree, ClinVar conflicts 24

ClinVar submitters conflict, but the independent predictors unanimously agree — a QC review flag, not a reclassification.

RYR3 p.Ala4626Val Conflicting Single submitter
Epileptic encephalopathy
RYR3 p.Ala614Thr Conflicting Single submitter
Epileptic encephalopathy
RYR3 p.Arg1140His Conflicting Single submitter
Epileptic encephalopathy
RYR3 p.Arg1798Gln Conflicting Single submitter
Epileptic encephalopathy
RYR3 p.Asn2497Ser Conflicting Single submitter
Epileptic encephalopathy
RYR3 p.Asp3103Gly Conflicting Single submitter
Epileptic encephalopathy
RYR3 p.Asp4740His Conflicting Single submitter
RYR3 p.Glu3596Asp Conflicting Single submitter
Epileptic encephalopathy
RYR3 p.Glu6Gly Conflicting Single submitter
Epileptic encephalopathy
RYR3 p.Gly1786Ser Conflicting Single submitter
Epileptic encephalopathy
RYR3 p.Gly4Ala Conflicting Single submitter
congenital myopathy 20
RYR3 p.Ile1395Val Conflicting Single submitter
Epileptic encephalopathy
RYR3 p.Ile2417Val Conflicting Single submitter
Epileptic encephalopathy
RYR3 p.Ile4260Val Conflicting Single submitter
Epileptic encephalopathy
RYR3 p.Lys1031Met Conflicting Single submitter
Epileptic encephalopathy
RYR3 p.Lys1864Arg Conflicting Single submitter
Epileptic encephalopathy
RYR3 p.Lys916Thr Conflicting Single submitter
congenital portosystemic shunt
RYR3 p.Met2070Val Conflicting Single submitter
congenital myopathy 20
RYR3 p.Ser2347Leu Conflicting Single submitter
Epileptic encephalopathy
RYR3 p.Thr1693Met Conflicting Single submitter
Epileptic encephalopathy
RYR3 p.Thr2269Met Conflicting Single submitter
Epileptic encephalopathy
RYR3 p.Thr4590Ile Conflicting Single submitter
Epileptic encephalopathy
RYR3 p.Val1112Ile Conflicting Single submitter
Epileptic encephalopathy
RYR3 p.Asp667Gly Conflicting No assertion criteria
congenital myopathy 20

Predictors lean, ClinVar uncertain 461

ClinVar classifies these uncertain (VUS), but the independent predictors unanimously lean one way — a triage signal for review, not a reclassification. · showing the 150 best-reviewed of 461

RYR3 p.Ala1179Thr Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ala1331Thr Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ala2151Val Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ala3947Thr Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ala3968Thr Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ala448Thr Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ala4594Val Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ala4650Thr Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ala938Ser Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Arg1042Cys Uncertain significance Multiple submitters
developmental and epileptic encephalopathy
RYR3 p.Arg1075Gln Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Arg1575Cys Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Arg1641His Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Arg1822Gln Uncertain significance Multiple submitters
RYR3 p.Arg1861Gln Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Arg2463Ser Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Arg2560Gln Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Arg259Gln Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Arg2781Trp Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Arg2980Leu Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Arg3073Cys Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Arg3503Cys Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Arg3503His Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Arg3755Gln Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Arg3755Trp Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Arg4537Cys Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Arg4862His Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Arg491Pro Uncertain significance Multiple submitters
RYR3 p.Asn2701Lys Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Asn4334Asp Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Asp1920Glu Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Asp3116Asn Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Cys1525Tyr Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Glu1547Ala Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Glu1943Lys Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Glu3449Gly Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Glu3610Val Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Gly1125Ser Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Gly1664Ala Uncertain significance Multiple submitters
Inborn genetic diseases
RYR3 p.Gly1715Ala Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Gly1786Asp Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Gly2186Cys Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Gly4134Arg Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Gly4222Arg Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Gly649Arg Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.His1273Gln Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.His3845Gln Uncertain significance Multiple submitters
RYR3 p.His386Arg Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.His563Pro Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ile1874Val Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ile2278Thr Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ile2617Val Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ile3367Val Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ile3634Thr Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ile4268Met Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Leu1461Phe Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Leu4184Phe Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Lys1681Arg Uncertain significance Multiple submitters
RYR3-related Epileptic encephalopathy
RYR3 p.Met1159Val Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Met1421Val Uncertain significance Multiple submitters
RYR3 p.Met1503Ile Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Met3268Val Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Phe2871Leu Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Pro1267Leu Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ser1135Gly Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ser1477Arg Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ser1516Arg Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ser209Pro Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ser4317Asn Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ser54Leu Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Thr1433Ala Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Thr1946Met Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Thr2689Ser Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Thr3096Met Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Thr4590Ser Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Val1407Leu Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Val1415Met Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Val1725Met Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Val1803Ile Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Val186Ile Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Val2076Met Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Val2682Met Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Val2739Met Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Val4123Met Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Val4265Ala Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Val4587Ala Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ala108Val Uncertain significance Single submitter
RYR3 p.Ala1116Thr Uncertain significance Single submitter
RYR3 p.Ala1157Val Uncertain significance Single submitter
RYR3 p.Ala1331Ser Uncertain significance Single submitter
RYR3 p.Ala1467Thr Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Ala1533Val Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Ala1579Pro Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Ala1616Ser Uncertain significance Single submitter
RYR3 p.Ala1618Gly Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Ala1760Val Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Ala2313Thr Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Ala2354Val Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Ala260Val Uncertain significance Single submitter
RYR3 p.Ala27Asp Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Ala3060Ser Uncertain significance Single submitter
RYR3 p.Ala309Val Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Ala3661Val Uncertain significance Single submitter
RYR3 p.Ala371Thr Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Ala3832Thr Uncertain significance Single submitter
RYR3 p.Ala3839Thr Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Ala3987Val Uncertain significance Single submitter
RYR3 p.Ala4336Thr Uncertain significance Single submitter
RYR3 p.Ala4726Val Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Ala505Val Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg1018Cys Uncertain significance Single submitter
RYR3 p.Arg1028Cys Uncertain significance Single submitter
RYR3 p.Arg1028His Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg1034Gly Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg1042His Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg1289Cys Uncertain significance Single submitter
RYR3 p.Arg1375Lys Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg1489Gln Uncertain significance Single submitter
RYR3 p.Arg1489Trp Uncertain significance Single submitter
RYR3 p.Arg1744Gln Uncertain significance Single submitter
RYR3 p.Arg1987Gln Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg2001Gln Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg2025Cys Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg2031Ser Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg2095His Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg2102Gln Uncertain significance Single submitter
RYR3 p.Arg2371Cys Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg2415Ser Uncertain significance Single submitter
RYR3 p.Arg2488Leu Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg270Trp Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg287Trp Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg3194Pro Uncertain significance Single submitter
RYR3 p.Arg3207Ser Uncertain significance Single submitter
RYR3 p.Arg3212Lys Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg3411Gln Uncertain significance Single submitter
RYR3 p.Arg3485Gln Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg3620Gly Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg3620Trp Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg3776Cys Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg3776His Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg3982Trp Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg402Cys Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg4043His Uncertain significance Single submitter
RYR3 p.Arg4375Gln Uncertain significance Single submitter
RYR3 p.Arg4693Cys Uncertain significance Single submitter
RYR3 p.Arg4746His Uncertain significance Single submitter
RYR3 p.Arg4862Cys Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg643Trp Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg895Gln Uncertain significance Single submitter
RYR3 p.Asn1362Thr Uncertain significance Single submitter

Predictors split 135

The independent predictors disagree with each other — read with care.

RYR3 p.Ala1570Thr Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ala1579Thr Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ala2284Thr Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ala2420Val Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ala4568Pro Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Arg1240His Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Arg1514Cys Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Arg2224His Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Arg287Gln Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Arg2980Gln Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Arg321Gln Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Arg3982Gln Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Asp2722Asn Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Gln2982Arg Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Glu3119Lys Likely benign Multiple submitters
Epileptic encephalopathy
RYR3 p.Glu4700Lys Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Gly1412Ala Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.His1709Tyr Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.His2437Tyr Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.His4609Arg Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ile4604Thr Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Leu2339Arg Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Leu3392Phe Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Leu3565Val Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Met198Val Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ser3120Leu Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ser3964Leu Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Thr2508Met Uncertain significance Multiple submitters
Epileptic encephalopathy
RYR3 p.Ala1336Pro Uncertain significance Single submitter
congenital myopathy 20
RYR3 p.Ala1446Ser Uncertain significance Single submitter
RYR3 p.Ala2202Thr Uncertain significance Single submitter
primary ovarian failure
RYR3 p.Ala2363Thr Uncertain significance Single submitter
RYR3 p.Ala2562Ser Uncertain significance Single submitter
RYR3 p.Ala27Thr Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Ala2909Thr Uncertain significance Single submitter
RYR3 p.Ala3256Val Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Ala3636Thr Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Ala84Val Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg1200Cys Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg140Trp Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg1518His Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg1575His Uncertain significance Single submitter
RYR3 p.Arg2224Cys Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg2456Cys Uncertain significance Single submitter
RYR3 p.Arg2456His Likely benign Single submitter
Epileptic encephalopathy
RYR3 p.Arg2487Gln Uncertain significance Single submitter
RYR3 p.Arg2669Cys Uncertain significance Single submitter
RYR3 p.Arg2781Gln Conflicting Single submitter
Epileptic encephalopathy
RYR3 p.Arg321Trp Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg336Gln Conflicting Single submitter
Epileptic encephalopathy
RYR3 p.Arg3562Cys Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg412Trp Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg4478Cys Likely benign Single submitter
Epileptic encephalopathy
RYR3 p.Arg467His Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg491Cys Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg491His Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg529Cys Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Arg529His Uncertain significance Single submitter
RYR3 p.Arg794His Uncertain significance Single submitter
RYR3 p.Arg869Gln Uncertain significance Single submitter
RYR3 p.Asn3814Ser Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Asn3975Thr Uncertain significance Single submitter
RYR3 p.Asn4164Ile Uncertain significance Single submitter
RYR3 p.Asn608Ser Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Asp1408Asn Uncertain significance Single submitter
RYR3 p.Asp1491Ala Uncertain significance Single submitter
RYR3 p.Asp1585Asn Uncertain significance Single submitter
RYR3 p.Asp3574Asn Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Asp3795Gly Conflicting Single submitter
Epileptic encephalopathy
RYR3 p.Asp4276Gly Uncertain significance Single submitter
RYR3 p.Gln1524Arg Uncertain significance Single submitter
RYR3 p.Gln401Leu Uncertain significance Single submitter
RYR3 p.Glu2276Lys Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Glu3167Gly Uncertain significance Single submitter
RYR3 p.Glu3297Asp Uncertain significance Single submitter
RYR3 p.Glu3730Lys Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Glu3985Lys Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Glu4026Lys Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Glu4382Ala Uncertain significance Single submitter
RYR3 p.Glu4589Val Uncertain significance Single submitter
RYR3 p.Glu4700Gln Uncertain significance Single submitter
RYR3 p.Glu4700Gly Uncertain significance Single submitter
RYR3 p.Glu71Gln Uncertain significance Single submitter
RYR3 p.Gly2761Ser Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Gly833Asp Uncertain significance Single submitter
RYR3 p.Gly962Ser Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.His1560Tyr Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.His2437Gln Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.His2624Tyr Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Ile1495Phe Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Ile152Leu Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Ile2190Thr Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Ile2856Met Uncertain significance Single submitter
RYR3 p.Ile447Met Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Ile489Thr Uncertain significance Single submitter
RYR3 p.Ile885Val Uncertain significance Single submitter
RYR3 p.Leu2471Phe Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Leu2541Val Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Leu3558Val Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Leu379Pro Uncertain significance Single submitter
RYR3 p.Leu865Val Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Lys1465Gln Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Lys2516Arg Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Lys3332Gln Uncertain significance Single submitter
RYR3 p.Lys335Arg Uncertain significance Single submitter
RYR3 p.Lys955Arg Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Met1215Val Uncertain significance Single submitter
RYR3 p.Met3100Thr Uncertain significance Single submitter
RYR3 p.Pro1528Thr Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Pro1800Thr Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Pro2336Arg Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Pro3575Leu Uncertain significance Single submitter
RYR3 p.Pro4384Leu Benign Single submitter
Epileptic encephalopathy
RYR3 p.Ser1356Gly Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Ser1587Thr Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Ser2548Leu Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Ser3391Phe Uncertain significance Single submitter
RYR3 p.Ser556Leu Uncertain significance Single submitter
RYR3 p.Ser583Leu Uncertain significance Single submitter
RYR3 p.Thr235Met Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Thr2994Ala Uncertain significance Single submitter
RYR3 p.Thr3002Met Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Thr3761Ala Uncertain significance Single submitter
RYR3 p.Thr3762Ser Uncertain significance Single submitter
RYR3 p.Thr3763Ala Uncertain significance Single submitter
RYR3 p.Tyr1591Cys Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Tyr2616Cys Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Tyr810His Uncertain significance Single submitter
RYR3 p.Val2949Met Uncertain significance Single submitter
RYR3 p.Val3435Asp Uncertain significance Single submitter
RYR3-related disorder
RYR3 p.Val3474Phe Uncertain significance Single submitter
RYR3 p.Val3876Leu Uncertain significance Single submitter
Epileptic encephalopathy
RYR3 p.Val4021Met Uncertain significance Single submitter
RYR3 p.Pro2259Ser Uncertain significance No assertion criteria
RYR3-related disorder
RYR3 p.Ser1582Gly Uncertain significance No assertion criteria
RYR3-related disorder

All RYR3 variants

Pathogenic 1

p.Gln2083Pro Single submitter hydrops fetalis ⚠

Conflicting classifications of pathogenicity 51

c.8516-5C>T Single submitter Epileptic encephalopathy
c.9830+4C>T Single submitter Epileptic encephalopathy
p.Ala4626Val Single submitter Epileptic encephalopathy ⚠
p.Ala614Thr Single submitter Epileptic encephalopathy ⚠
p.Arg1140His Single submitter Epileptic encephalopathy ⚠
p.Arg1798Gln Single submitter Epileptic encephalopathy ⚠
p.Arg2233Gln Single submitter congenital myopathy 20
p.Arg2781Gln Single submitter Epileptic encephalopathy ⚠
p.Arg308Gln Single submitter Epileptic encephalopathy
p.Arg3271His Single submitter Epileptic encephalopathy
p.Arg336Gln Single submitter Epileptic encephalopathy ⚠
p.Asn2497Ser Single submitter Epileptic encephalopathy ⚠
p.Asp3095Gly Single submitter Epileptic encephalopathy
p.Asp3103Gly Single submitter Epileptic encephalopathy ⚠
p.Asp3795Gly Single submitter Epileptic encephalopathy ⚠
p.Asp4740His Single submitter ⚠
p.Glu3596Asp Single submitter Epileptic encephalopathy ⚠
p.Glu4455Lys Single submitter Epileptic encephalopathy
p.Glu6Gly Single submitter Epileptic encephalopathy ⚠
p.Gly1786Ser Single submitter Epileptic encephalopathy ⚠
p.Gly4Ala Single submitter congenital myopathy 20 ⚠
p.Ile1395Val Single submitter Epileptic encephalopathy ⚠
p.Ile1993Thr Single submitter Epileptic encephalopathy
p.Ile2417Val Single submitter Epileptic encephalopathy ⚠
p.Ile2746Val Single submitter Epileptic encephalopathy
p.Ile3939Val Single submitter Epileptic encephalopathy
p.Ile4260Val Single submitter Epileptic encephalopathy ⚠
p.Leu4403= Single submitter Epileptic encephalopathy
p.Lys1031Met Single submitter Epileptic encephalopathy ⚠
p.Lys1864Arg Single submitter Epileptic encephalopathy ⚠
p.Lys1933Asn Single submitter Epileptic encephalopathy
p.Lys867Glu Single submitter Epileptic encephalopathy
p.Lys916Thr Single submitter congenital portosystemic shunt ⚠
p.Met2070Val Single submitter congenital myopathy 20 ⚠
p.Met4278Thr Single submitter Epileptic encephalopathy
p.Pro3267Ser Single submitter Epileptic encephalopathy
p.Pro452Thr Single submitter Epileptic encephalopathy
p.Ser1516Asn Single submitter Epileptic encephalopathy
p.Ser2347Leu Single submitter Epileptic encephalopathy ⚠
p.Ser3078= Single submitter Epileptic encephalopathy
p.Thr1693Met Single submitter Epileptic encephalopathy ⚠
p.Thr2269Met Single submitter Epileptic encephalopathy ⚠
p.Thr3519Arg Single submitter Epileptic encephalopathy
p.Thr3566= Single submitter Epileptic encephalopathy
p.Thr4590Ile Single submitter Epileptic encephalopathy ⚠
p.Thr924Ala Single submitter Epileptic encephalopathy
p.Val1112Ile Single submitter Epileptic encephalopathy ⚠
p.Val2618Ile Single submitter Epileptic encephalopathy
p.Val2986Ile Single submitter Epileptic encephalopathy
p.Val3846Ile Single submitter Epileptic encephalopathy
p.Asp667Gly No assertion criteria congenital myopathy 20 ⚠

Benign 94

c.10600-20A>G Multiple submitters Epileptic encephalopathy
c.10816-9del Multiple submitters Epileptic encephalopathy
c.10995+18C>T Multiple submitters Epileptic encephalopathy
c.10995+19G>A Multiple submitters Epileptic encephalopathy
c.11072+8C>T Multiple submitters Epileptic encephalopathy
c.13210-13C>G Multiple submitters Epileptic encephalopathy
c.13498-13C>T Multiple submitters Epileptic encephalopathy
c.14142+27_14142+46del Multiple submitters Epileptic encephalopathy
c.14300-19T>A Multiple submitters Epileptic encephalopathy
c.14364+14A>G Multiple submitters Epileptic encephalopathy
c.1922+16C>T Multiple submitters Epileptic encephalopathy
c.2164+8C>T Multiple submitters Epileptic encephalopathy
c.2575-10T>C Multiple submitters Epileptic encephalopathy
c.279+11G>A Multiple submitters Epileptic encephalopathy
c.280-7C>G Multiple submitters Epileptic encephalopathy
c.4309-11T>C Multiple submitters Epileptic encephalopathy
c.434-5T>C Multiple submitters Epileptic encephalopathy
c.4396-10C>T Multiple submitters Epileptic encephalopathy
c.4622+14C>T Multiple submitters Epileptic encephalopathy
c.6134+9T>C Multiple submitters Epileptic encephalopathy
c.6380-15C>G Multiple submitters Epileptic encephalopathy
c.6620-3C>T Multiple submitters Epileptic encephalopathy
c.7516-8C>T Multiple submitters Epileptic encephalopathy
c.8136+9C>G Multiple submitters Epileptic encephalopathy
c.815+9A>G Multiple submitters Epileptic encephalopathy
c.*839A>G Multiple submitters Epileptic encephalopathy
p.Ala2354= Multiple submitters Epileptic encephalopathy
p.Ala3627= Multiple submitters Epileptic encephalopathy
p.Ala368= Multiple submitters Epileptic encephalopathy
p.Arg1641Cys Multiple submitters Epileptic encephalopathy
p.Arg285= Multiple submitters Epileptic encephalopathy
p.Arg4043= Multiple submitters Epileptic encephalopathy
p.Arg4478= Multiple submitters Epileptic encephalopathy
p.Asn2148= Multiple submitters Epileptic encephalopathy
p.Asp1678Gly Multiple submitters Epileptic encephalopathy
p.Asp3573= Multiple submitters Epileptic encephalopathy
p.Asp370= Multiple submitters Epileptic encephalopathy
p.Asp4706= Multiple submitters Epileptic encephalopathy
p.Gln401= Multiple submitters Epileptic encephalopathy
p.Glu1767Lys Multiple submitters Epileptic encephalopathy
p.Glu4441del Multiple submitters Epileptic encephalopathy
p.Glu4455= Multiple submitters Epileptic encephalopathy
p.Glu4704Lys Multiple submitters Epileptic encephalopathy
p.Gly2239= Multiple submitters Epileptic encephalopathy
p.Gly2270Glu Multiple submitters Epileptic encephalopathy
p.Gly2544= Multiple submitters Epileptic encephalopathy
p.Ile358Thr Multiple submitters Epileptic encephalopathy
p.Ile731Val Multiple submitters Epileptic encephalopathy
p.Ile834= Multiple submitters Epileptic encephalopathy
p.Leu1657= Multiple submitters Epileptic encephalopathy
p.Leu2563= Multiple submitters Epileptic encephalopathy
p.Leu801= Multiple submitters Epileptic encephalopathy
p.Lys3426= Multiple submitters Epileptic encephalopathy
p.Phe3604= Multiple submitters Epileptic encephalopathy
p.Phe4756= Multiple submitters Epileptic encephalopathy
p.Ser2881Thr Multiple submitters Epileptic encephalopathy
p.Ser423= Multiple submitters Epileptic encephalopathy
p.Thr2585= Multiple submitters Epileptic encephalopathy
p.Thr3229Met Multiple submitters Epileptic encephalopathy
p.Tyr2527= Multiple submitters Epileptic encephalopathy
p.Tyr3272= Multiple submitters Epileptic encephalopathy
p.Val4172= Multiple submitters Epileptic encephalopathy
p.Val494Ile Multiple submitters Epileptic encephalopathy
p.Val610Ile Multiple submitters Epileptic encephalopathy
c.10197+10C>T Single submitter Epileptic encephalopathy
c.10759-8A>G Single submitter Epileptic encephalopathy
c.1146+3G>T Single submitter Epileptic encephalopathy
c.13297-20G>A Single submitter Epileptic encephalopathy
c.1574-12C>T Single submitter Epileptic encephalopathy
c.2784-10T>G Single submitter Epileptic encephalopathy
c.2867+18del Single submitter Epileptic encephalopathy
c.2867+18dup Single submitter Epileptic encephalopathy
c.3557-7T>G Single submitter Epileptic encephalopathy
c.4308+8C>T Single submitter Epileptic encephalopathy
c.4623-9T>C Single submitter Epileptic encephalopathy
c.52-8_52-6del Single submitter Epileptic encephalopathy
c.5419-8C>G Single submitter Epileptic encephalopathy
c.5620-5C>G Single submitter Epileptic encephalopathy
c.6484-8T>A Single submitter Epileptic encephalopathy
c.8400-5C>T Single submitter Epileptic encephalopathy
c.8756-19A>G Single submitter Epileptic encephalopathy
c.9831-8G>C Single submitter Epileptic encephalopathy
p.Asn4390Asp Single submitter Epileptic encephalopathy
p.His591= Single submitter Epileptic encephalopathy
p.Ile3000Leu Single submitter Epileptic encephalopathy
p.Ile3000Val Single submitter Epileptic encephalopathy
p.Ile432Ser Single submitter Epileptic encephalopathy
p.Leu4646= Single submitter Epileptic encephalopathy
p.Lys382= Single submitter Epileptic encephalopathy
p.Lys4790= Single submitter Epileptic encephalopathy
p.Pro2768= Single submitter Epileptic encephalopathy
p.Pro4384Leu Single submitter Epileptic encephalopathy ⚠
p.Ser2706Ile Single submitter Epileptic encephalopathy
p.Ser3523= Single submitter Epileptic encephalopathy

Benign/Likely benign 36

c.10816-9T>C Multiple submitters Epileptic encephalopathy
c.11073-8A>G Multiple submitters Epileptic encephalopathy
c.11464-8C>A Multiple submitters Epileptic encephalopathy
c.13497+6C>T Multiple submitters Epileptic encephalopathy
c.1437+8G>A Multiple submitters Epileptic encephalopathy
c.1788+10G>C Multiple submitters Epileptic encephalopathy
c.2574+3A>C Multiple submitters Epileptic encephalopathy
c.6619+7C>G Multiple submitters Epileptic encephalopathy
p.Ala1116= Multiple submitters Epileptic encephalopathy
p.Ala1828= Multiple submitters Epileptic encephalopathy
p.Ala4389= Multiple submitters Epileptic encephalopathy
p.Arg1987= Multiple submitters Epileptic encephalopathy
p.Arg2852His Multiple submitters Epileptic encephalopathy
p.Arg3048Leu Multiple submitters Epileptic encephalopathy
p.Asn2042Ser Multiple submitters Epileptic encephalopathy
p.Asn2206Thr Multiple submitters Epileptic encephalopathy
p.Asn3849His Multiple submitters Epileptic encephalopathy
p.Asn426Ser Multiple submitters Epileptic encephalopathy
p.Asn898Ser Multiple submitters Epileptic encephalopathy
p.Asp1491= Multiple submitters Epileptic encephalopathy
p.Asp3253= Multiple submitters Epileptic encephalopathy
p.Glu767= Multiple submitters Epileptic encephalopathy
p.Gly1432= Multiple submitters Epileptic encephalopathy
p.Leu1564= Multiple submitters Epileptic encephalopathy
p.Leu3291= Multiple submitters Epileptic encephalopathy
p.Met3641Val Multiple submitters Epileptic encephalopathy
p.Phe1507= Multiple submitters Epileptic encephalopathy
p.Pro1537= Multiple submitters Epileptic encephalopathy
p.Pro3085Arg Multiple submitters Epileptic encephalopathy
p.Ser2609= Multiple submitters Epileptic encephalopathy
p.Ser738= Multiple submitters Epileptic encephalopathy
p.Thr207= Multiple submitters Epileptic encephalopathy
p.Thr3732= Multiple submitters Epileptic encephalopathy
p.Thr3763= Multiple submitters Epileptic encephalopathy
p.Tyr1607= Multiple submitters Epileptic encephalopathy
p.Tyr2827= Multiple submitters Epileptic encephalopathy

Likely benign 566

Showing the top 300 by review status; the full set is in the sitemap.

c.10503-6G>A Multiple submitters Epileptic encephalopathy
c.13861-4C>G Multiple submitters Epileptic encephalopathy
c.14364+10C>T Multiple submitters Epileptic encephalopathy
c.14466-7G>A Multiple submitters Epileptic encephalopathy
c.14518-19G>A Multiple submitters Epileptic encephalopathy
c.3028-9G>A Multiple submitters Epileptic encephalopathy
c.7820+7C>A Multiple submitters
c.7900-4A>G Multiple submitters Epileptic encephalopathy
c.8137-3T>C Multiple submitters Epileptic encephalopathy
c.9589+5C>T Multiple submitters Epileptic encephalopathy
c.9589+6G>A Multiple submitters Epileptic encephalopathy
c.9590-5C>T Multiple submitters Epileptic encephalopathy
p.Ala1234= Multiple submitters Epileptic encephalopathy
p.Ala1472= Multiple submitters Epileptic encephalopathy
p.Ala1785= Multiple submitters Epileptic encephalopathy
p.Ala2672= Multiple submitters Epileptic encephalopathy
p.Ala2901= Multiple submitters Epileptic encephalopathy
p.Ala3118= Multiple submitters Epileptic encephalopathy
p.Ala4678= Multiple submitters Epileptic encephalopathy
p.Ala4857= Multiple submitters Epileptic encephalopathy
p.Arg1502Leu Multiple submitters Epileptic encephalopathy
p.Arg458Gln Multiple submitters Epileptic encephalopathy
p.Arg829His Multiple submitters Epileptic encephalopathy
p.Asn1466= Multiple submitters Epileptic encephalopathy
p.Asn242Ser Multiple submitters Epileptic encephalopathy
p.Asn2604Lys Multiple submitters Epileptic encephalopathy
p.Asn3115= Multiple submitters Epileptic encephalopathy
p.Asn3323= Multiple submitters Epileptic encephalopathy
p.Asn3657= Multiple submitters Epileptic encephalopathy
p.Asp2555= Multiple submitters Epileptic encephalopathy
p.Asp3099= Multiple submitters Epileptic encephalopathy
p.Asp4155Asn Multiple submitters Epileptic encephalopathy
p.Asp4701= Multiple submitters Epileptic encephalopathy
p.Cys4709= Multiple submitters Epileptic encephalopathy
p.Gln1318= Multiple submitters Epileptic encephalopathy
p.Gln3589= Multiple submitters Epileptic encephalopathy
p.Gln3953= Multiple submitters Epileptic encephalopathy
p.Gln96= Multiple submitters Epileptic encephalopathy
p.Glu3119Lys Multiple submitters Epileptic encephalopathy ⚠
p.Glu3699= Multiple submitters Epileptic encephalopathy
p.Glu4528= Multiple submitters Epileptic encephalopathy
p.Gly1716= Multiple submitters Epileptic encephalopathy
p.Gly2795= Multiple submitters Epileptic encephalopathy
p.Gly579= Multiple submitters Epileptic encephalopathy
p.Ile1934= Multiple submitters Epileptic encephalopathy
p.Ile26= Multiple submitters Epileptic encephalopathy
p.Ile3317Thr Multiple submitters Epileptic encephalopathy
p.Ile447= Multiple submitters Epileptic encephalopathy
p.Ile4760= Multiple submitters Epileptic encephalopathy
p.Leu1203= Multiple submitters Epileptic encephalopathy
p.Leu2159= Multiple submitters Epileptic encephalopathy
p.Leu434= Multiple submitters
p.Leu844= Multiple submitters Epileptic encephalopathy
p.Pro2230= Multiple submitters Epileptic encephalopathy
p.Pro431Ala Multiple submitters Epileptic encephalopathy
p.Ser116= Multiple submitters Epileptic encephalopathy
p.Ser2130= Multiple submitters Epileptic encephalopathy
p.Ser3581= Multiple submitters Epileptic encephalopathy
p.Ser3689= Multiple submitters Epileptic encephalopathy
p.Thr1209= Multiple submitters Epileptic encephalopathy
p.Thr2585Arg Multiple submitters Epileptic encephalopathy
p.Thr3002= Multiple submitters Epileptic encephalopathy
p.Thr4154= Multiple submitters
p.Tyr1330= Multiple submitters Epileptic encephalopathy
p.Tyr1578= Multiple submitters Epileptic encephalopathy
p.Tyr2416= Multiple submitters
p.Tyr2616= Multiple submitters Epileptic encephalopathy
p.Val1294= Multiple submitters Epileptic encephalopathy
p.Val2798= Multiple submitters Epileptic encephalopathy
p.Val364= Multiple submitters Epileptic encephalopathy
c.10011+13A>G Single submitter
c.10257+13G>A Single submitter
c.10257+6dup Single submitter Epileptic encephalopathy
c.10389+10A>G Single submitter Epileptic encephalopathy
c.10390-18G>A Single submitter
c.10503-1446_10503-1445del Single submitter
c.10503-7C>T Single submitter Epileptic encephalopathy
c.10706+8C>T Single submitter Epileptic encephalopathy
c.10759-10T>C Single submitter Epileptic encephalopathy
c.10815+12T>A Single submitter
c.10815+8C>T Single submitter Epileptic encephalopathy
c.10816-6C>G Single submitter Epileptic encephalopathy
c.10816-9_10816-8del Single submitter Epileptic encephalopathy
c.10816-9T>G Single submitter Epileptic encephalopathy
c.11147-7T>C Single submitter Epileptic encephalopathy
c.11147-8A>G Single submitter Epileptic encephalopathy
c.1268+10C>T Single submitter Epileptic encephalopathy
c.1269-8G>C Single submitter Epileptic encephalopathy
c.1269-8G>T Single submitter
c.12979-6G>T Single submitter
c.13038-13C>T Single submitter
c.13209+15C>G Single submitter
c.13497+8_13497+9delinsCA Single submitter Epileptic encephalopathy
c.13498-8A>G Single submitter Epileptic encephalopathy
c.13628+7G>T Single submitter
c.13671+9T>C Single submitter Epileptic encephalopathy
c.13672-8del Single submitter Epileptic encephalopathy
c.14008-9C>T Single submitter Epileptic encephalopathy
p.Val4686= Single submitter Epileptic encephalopathy
c.14142+6AGCCCACCCACTGCGGGGCC[3] Single submitter Epileptic encephalopathy
c.14299+14T>C Single submitter
c.14364+19C>G Single submitter
c.1437+7C>T Single submitter
c.14466-7G>C Single submitter Epileptic encephalopathy
c.14466-8C>T Single submitter Epileptic encephalopathy
c.14517+15_14517+16del Single submitter
c.14517+7A>C Single submitter Epileptic encephalopathy
c.14518-7_14518-4dup Single submitter Epileptic encephalopathy
c.14518-7A>G Single submitter Epileptic encephalopathy
c.1573+20C>T Single submitter
c.1574-11_1574-9del Single submitter Epileptic encephalopathy
c.172-18C>G Single submitter
c.1922+9A>T Single submitter Epileptic encephalopathy
c.2165-16G>A Single submitter
c.2358-15A>G Single submitter
c.2574+18G>A Single submitter
c.2574+7T>A Single submitter Epileptic encephalopathy
c.2679+16C>T Single submitter
c.279+8C>G Single submitter Epileptic encephalopathy
c.280-12T>C Single submitter
c.280-5C>T Single submitter Epileptic encephalopathy
c.3028-10C>T Single submitter Epileptic encephalopathy
c.3028-8T>A Single submitter Epileptic encephalopathy
c.3176-10C>T Single submitter
c.3176-19G>A Single submitter
c.3176-5A>T Single submitter
c.3176-7A>G Single submitter Epileptic encephalopathy
c.3176-9T>C Single submitter Epileptic encephalopathy
c.3381+10T>C Single submitter Epileptic encephalopathy
c.3381+7T>A Single submitter Epileptic encephalopathy
c.3556+7C>G Single submitter Epileptic encephalopathy
c.3557-4G>T Single submitter
c.3942-5C>G Single submitter Epileptic encephalopathy
c.4143-7C>T Single submitter Epileptic encephalopathy
c.4143-8G>T Single submitter
c.4308+7G>A Single submitter Epileptic encephalopathy
c.4308+9G>A Single submitter Epileptic encephalopathy
c.433+12T>C Single submitter
c.4396-9G>A Single submitter Epileptic encephalopathy
c.4622+15C>G Single submitter
c.51+11G>A Single submitter
c.51+9C>T Single submitter Epileptic encephalopathy
c.5419-4G>A Single submitter Epileptic encephalopathy
c.5419-6T>C Single submitter Epileptic encephalopathy
c.5419-9T>A Single submitter Epileptic encephalopathy
c.5419-9T>C Single submitter
c.547-5T>C Single submitter Epileptic encephalopathy
c.5722+10C>T Single submitter Epileptic encephalopathy
c.5723-6T>G Single submitter Epileptic encephalopathy
c.5723-9G>C Single submitter Epileptic encephalopathy
c.6135-4C>G Single submitter Epileptic encephalopathy
c.6135-5C>T Single submitter Epileptic encephalopathy
c.6250-4A>G Single submitter Epileptic encephalopathy
c.6483+7G>A Single submitter Epileptic encephalopathy
c.6619+10A>C Single submitter Epileptic encephalopathy
c.6800+9A>T Single submitter Epileptic encephalopathy
c.6801-10G>A Single submitter Epileptic encephalopathy
c.6913-7C>A Single submitter Epileptic encephalopathy
c.7033+13_7033+19dup Single submitter
c.7204-4C>T Single submitter Epileptic encephalopathy
c.741-4A>C Single submitter Epileptic encephalopathy
c.741-7C>A Single submitter Epileptic encephalopathy
c.7515+13A>G Single submitter
c.7516-10C>T Single submitter Epileptic encephalopathy
c.7989+9C>G Single submitter Epileptic encephalopathy
c.816-17C>T Single submitter
c.8200-7del Single submitter Epileptic encephalopathy
c.8516-19G>A Single submitter
c.8516-8C>T Single submitter Epileptic encephalopathy
c.8584-9G>T Single submitter Epileptic encephalopathy
c.8705+17A>C Single submitter
c.8705+9A>G Single submitter Epileptic encephalopathy
c.8755+9A>G Single submitter Epileptic encephalopathy
c.8756-8T>A Single submitter
c.9055+13G>A Single submitter
c.9055+16A>G Single submitter
c.9056-7G>A Single submitter Epileptic encephalopathy
c.9137+14G>A Single submitter
c.9137+9T>A Single submitter
c.9268+8T>C Single submitter Epileptic encephalopathy
c.9589+11C>T Single submitter
c.9590-10G>T Single submitter Epileptic encephalopathy
c.9590-4G>A Single submitter Epileptic encephalopathy
c.972+19G>T Single submitter
c.972+5G>A Single submitter
c.973-1G>C Single submitter Epileptic encephalopathy
c.9919-6A>G Single submitter Epileptic encephalopathy
p.Ala1023= Single submitter
p.Ala1059= Single submitter
p.Ala1104= Single submitter Epileptic encephalopathy
p.Ala1567= Single submitter Epileptic encephalopathy
p.Ala1789= Single submitter Epileptic encephalopathy
p.Ala1856= Single submitter Epileptic encephalopathy
p.Ala1999= Single submitter Epileptic encephalopathy
p.Ala2255= Single submitter Epileptic encephalopathy
p.Ala2363= Single submitter Epileptic encephalopathy
p.Ala2410= Single submitter Epileptic encephalopathy
p.Ala2429= Single submitter Epileptic encephalopathy
p.Ala2594= Single submitter Epileptic encephalopathy
p.Ala2630= Single submitter Epileptic encephalopathy
p.Ala2681= Single submitter Epileptic encephalopathy
p.Ala2748= Single submitter Epileptic encephalopathy
p.Ala2784= Single submitter Epileptic encephalopathy
p.Ala2908= Single submitter Epileptic encephalopathy
p.Ala2955= Single submitter Epileptic encephalopathy
p.Ala3238= Single submitter Epileptic encephalopathy
p.Ala3256= Single submitter Epileptic encephalopathy
p.Ala3473= Single submitter Epileptic encephalopathy
p.Ala3805= Single submitter Epileptic encephalopathy
p.Ala3987= Single submitter Epileptic encephalopathy
p.Ala40= Single submitter Epileptic encephalopathy
p.Ala4127= Single submitter Epileptic encephalopathy
p.Ala430= Single submitter Epileptic encephalopathy
p.Ala4325= Single submitter Epileptic encephalopathy
p.Ala4460= Single submitter Epileptic encephalopathy
p.Ala4479= Single submitter Epileptic encephalopathy
p.Ala448= Single submitter Epileptic encephalopathy
p.Ala4512= Single submitter Epileptic encephalopathy
p.Ala4572= Single submitter
p.Ala4594= Single submitter Epileptic encephalopathy
p.Ala4626= Single submitter Epileptic encephalopathy
p.Ala651= Single submitter Epileptic encephalopathy
p.Ala78= Single submitter
p.Ala94= Single submitter
p.Ala943= Single submitter Epileptic encephalopathy
p.Arg1072= Single submitter Epileptic encephalopathy
p.Arg1489= Single submitter Epileptic encephalopathy
p.Arg1563= Single submitter
p.Arg16= Single submitter Epileptic encephalopathy
p.Arg166= Single submitter Epileptic encephalopathy
p.Arg1692= Single submitter
p.Arg1744= Single submitter Epileptic encephalopathy
p.Arg2001= Single submitter Epileptic encephalopathy
p.Arg2298= Single submitter
p.Arg2371= Single submitter
p.Arg2415= Single submitter Epileptic encephalopathy
p.Arg2456His Single submitter Epileptic encephalopathy ⚠
p.Arg2914= Single submitter
p.Arg4010= Single submitter Epileptic encephalopathy
p.Arg4376Gln Single submitter Epileptic encephalopathy
p.Arg4478Cys Single submitter Epileptic encephalopathy ⚠
p.Arg472= Single submitter Epileptic encephalopathy
p.Arg529= Single submitter Epileptic encephalopathy
p.Arg681= Single submitter Epileptic encephalopathy
p.Asn1246= Single submitter Epileptic encephalopathy
p.Asn1879= Single submitter Epileptic encephalopathy
p.Asn2042Thr Single submitter Epileptic encephalopathy
p.Asn2238= Single submitter Epileptic encephalopathy
p.Asn2647= Single submitter Epileptic encephalopathy
p.Asn2714= Single submitter Epileptic encephalopathy
p.Asn277= Single submitter Epileptic encephalopathy
p.Asn3075= Single submitter Epileptic encephalopathy
p.Asn3563= Single submitter Epileptic encephalopathy
p.Asn4171= Single submitter Epileptic encephalopathy
p.Asn4666= Single submitter Epileptic encephalopathy
p.Asn4690= Single submitter Epileptic encephalopathy
p.Asn4830= Single submitter Epileptic encephalopathy
p.Asn637= Single submitter
p.Asn919= Single submitter Epileptic encephalopathy
p.Asn961= Single submitter
p.Asp1678Glu Single submitter
p.Asp1739= Single submitter
p.Asp19= Single submitter Epileptic encephalopathy
p.Asp1902= Single submitter Epileptic encephalopathy
p.Asp2184= Single submitter Epileptic encephalopathy
p.Asp331= Single submitter Epileptic encephalopathy
p.Asp3838= Single submitter Epileptic encephalopathy
p.Asp3960= Single submitter Epileptic encephalopathy
p.Asp4155= Single submitter Epileptic encephalopathy
p.Asp4454= Single submitter Epileptic encephalopathy
p.Asp4578= Single submitter Epileptic encephalopathy
p.Asp4583= Single submitter Epileptic encephalopathy
p.Asp4710= Single submitter Epileptic encephalopathy
p.Asp638= Single submitter Epileptic encephalopathy
p.Asp740= Single submitter Epileptic encephalopathy
p.Cys1569= Single submitter Epileptic encephalopathy
p.Cys1815= Single submitter Epileptic encephalopathy
p.Cys353= Single submitter Epileptic encephalopathy
p.Cys4013Arg Single submitter Epileptic encephalopathy
p.Cys535= Single submitter Epileptic encephalopathy
p.Cys64= Single submitter Epileptic encephalopathy
p.Gln1969= Single submitter Epileptic encephalopathy
p.Gln2245= Single submitter
p.Gln2307Arg Single submitter Epileptic encephalopathy
p.Gln2447= Single submitter Epileptic encephalopathy
p.Gln2635= Single submitter Epileptic encephalopathy
p.Gln3235= Single submitter Epileptic encephalopathy
p.Gln3701= Single submitter
p.Gln3799= Single submitter Epileptic encephalopathy
p.Gln3951= Single submitter Epileptic encephalopathy
p.Gln4320Arg Single submitter
p.Gln4399= Single submitter Epileptic encephalopathy
p.Glu1460= Single submitter Epileptic encephalopathy
p.Glu1478= Single submitter Epileptic encephalopathy
p.Glu1479Lys Single submitter Epileptic encephalopathy
p.Glu1788= Single submitter Epileptic encephalopathy
p.Glu1948= Single submitter
p.Glu1958Lys Single submitter Epileptic encephalopathy
p.Glu2120= Single submitter
p.Glu2208= Single submitter Epileptic encephalopathy

Uncertain significance 1197

Showing the top 300 by review status; the full set is in the sitemap.

c.10758+6C>G Multiple submitters Epileptic encephalopathy
c.10995+5C>T Multiple submitters Epileptic encephalopathy
c.12978+3A>G Multiple submitters Epileptic encephalopathy
p.Ala1179Thr Multiple submitters Epileptic encephalopathy ⚠
p.Ala1331Thr Multiple submitters Epileptic encephalopathy ⚠
p.Ala1570Thr Multiple submitters Epileptic encephalopathy ⚠
p.Ala1579Thr Multiple submitters Epileptic encephalopathy ⚠
p.Ala2151Val Multiple submitters Epileptic encephalopathy ⚠
p.Ala2284Thr Multiple submitters Epileptic encephalopathy ⚠
p.Ala2420Val Multiple submitters Epileptic encephalopathy ⚠
p.Ala2594Val Multiple submitters Epileptic encephalopathy
p.Ala3122Val Multiple submitters Epileptic encephalopathy
p.Ala317Thr Multiple submitters RYR3-related Epileptic encephalopathy
p.Ala3807Glu Multiple submitters Epileptic encephalopathy
p.Ala3947Thr Multiple submitters Epileptic encephalopathy ⚠
p.Ala3968Pro Multiple submitters Epileptic encephalopathy
p.Ala3968Thr Multiple submitters Epileptic encephalopathy ⚠
p.Ala430Val Multiple submitters Epileptic encephalopathy
p.Ala4325Gly Multiple submitters Epileptic encephalopathy
p.Ala448Thr Multiple submitters Epileptic encephalopathy ⚠
p.Ala4568Pro Multiple submitters Epileptic encephalopathy ⚠
p.Ala4594Val Multiple submitters Epileptic encephalopathy ⚠
p.Ala4595Gly Multiple submitters Epileptic encephalopathy
p.Ala4650Thr Multiple submitters Epileptic encephalopathy ⚠
p.Ala536Thr Multiple submitters Epileptic encephalopathy
p.Ala651Thr Multiple submitters RYR3-related disorder
p.Ala807Val Multiple submitters Epileptic encephalopathy
p.Ala938Ser Multiple submitters Epileptic encephalopathy ⚠
p.Arg101Lys Multiple submitters RYR3-related Epileptic encephalopathy
p.Arg1042Cys Multiple submitters developmental and epileptic encephalopathy ⚠
p.Arg1075Gln Multiple submitters Epileptic encephalopathy ⚠
p.Arg1078Gln Multiple submitters Epileptic encephalopathy
p.Arg1200His Multiple submitters Epileptic encephalopathy
p.Arg1240His Multiple submitters Epileptic encephalopathy ⚠
p.Arg1404Trp Multiple submitters Epileptic encephalopathy
p.Arg1514Cys Multiple submitters Epileptic encephalopathy ⚠
p.Arg1575Cys Multiple submitters Epileptic encephalopathy ⚠
p.Arg1641His Multiple submitters Epileptic encephalopathy ⚠
p.Arg1822Gln Multiple submitters ⚠
p.Arg1861Gln Multiple submitters Epileptic encephalopathy ⚠
p.Arg2224His Multiple submitters Epileptic encephalopathy ⚠
p.Arg225His Multiple submitters Epileptic encephalopathy
p.Arg2463Ser Multiple submitters Epileptic encephalopathy ⚠
p.Arg2560Gln Multiple submitters Epileptic encephalopathy ⚠
p.Arg259Gln Multiple submitters Epileptic encephalopathy ⚠
p.Arg2781Trp Multiple submitters Epileptic encephalopathy ⚠
p.Arg287Gln Multiple submitters Epileptic encephalopathy ⚠
p.Arg2980Gln Multiple submitters Epileptic encephalopathy ⚠
p.Arg2980Leu Multiple submitters Epileptic encephalopathy ⚠
p.Arg3048Cys Multiple submitters Epileptic encephalopathy
p.Arg3073Cys Multiple submitters Epileptic encephalopathy ⚠
p.Arg3148Trp Multiple submitters Epileptic encephalopathy
p.Arg321Gln Multiple submitters Epileptic encephalopathy ⚠
p.Arg3350Gln Multiple submitters
p.Arg3355Trp Multiple submitters congenital myopathy 20
p.Arg3356Leu Multiple submitters Epileptic encephalopathy
p.Arg3450His Multiple submitters Epileptic encephalopathy
p.Arg3503Cys Multiple submitters Epileptic encephalopathy ⚠
p.Arg3503His Multiple submitters Epileptic encephalopathy ⚠
p.Arg3562His Multiple submitters Epileptic encephalopathy
p.Arg3755Gln Multiple submitters Epileptic encephalopathy ⚠
p.Arg3755Trp Multiple submitters Epileptic encephalopathy ⚠
p.Arg3982Gln Multiple submitters Epileptic encephalopathy ⚠
p.Arg4010His Multiple submitters Epileptic encephalopathy
p.Arg4053His Multiple submitters Epileptic encephalopathy
p.Arg427His Multiple submitters Epileptic encephalopathy
p.Arg4376Trp Multiple submitters Epileptic encephalopathy
p.Arg4537Cys Multiple submitters Epileptic encephalopathy ⚠
p.Arg46His Multiple submitters Epileptic encephalopathy
p.Arg4862His Multiple submitters Epileptic encephalopathy ⚠
p.Arg491Pro Multiple submitters ⚠
p.Arg634Gln Multiple submitters Epileptic encephalopathy
p.Arg788His Multiple submitters Epileptic encephalopathy
p.Asn2701Lys Multiple submitters Epileptic encephalopathy ⚠
p.Asn2794Lys Multiple submitters Epileptic encephalopathy
p.Asn2959Ser Multiple submitters Epileptic encephalopathy
p.Asn3752Ser Multiple submitters Epileptic encephalopathy
p.Asn4334Asp Multiple submitters Epileptic encephalopathy ⚠
p.Asn471Lys Multiple submitters Epileptic encephalopathy
p.Asn703Ser Multiple submitters
p.Asp10Glu Multiple submitters Epileptic encephalopathy
p.Asp1645Glu Multiple submitters Epileptic encephalopathy
p.Asp1920Glu Multiple submitters Epileptic encephalopathy ⚠
p.Asp2722Asn Multiple submitters Epileptic encephalopathy ⚠
p.Asp3116Asn Multiple submitters Epileptic encephalopathy ⚠
p.Asp3243Tyr Multiple submitters congenital myopathy 20
p.Asp3599Gly Multiple submitters RYR3-related Epileptic encephalopathy
p.Asp4349Tyr Multiple submitters Epileptic encephalopathy
p.Asp4799Glu Multiple submitters Epileptic encephalopathy
p.Cys1525Tyr Multiple submitters Epileptic encephalopathy ⚠
p.Cys3965Ser Multiple submitters Epileptic encephalopathy
p.Cys4146Phe Multiple submitters Epileptic encephalopathy
p.Gln1318Glu Multiple submitters Epileptic encephalopathy
p.Gln1551Arg Multiple submitters Epileptic encephalopathy
p.Gln2832His Multiple submitters RYR3-related disorder
p.Gln2982Arg Multiple submitters Epileptic encephalopathy ⚠
p.Gln3340Lys Multiple submitters Epileptic encephalopathy
p.Gln3346Arg Multiple submitters Epileptic encephalopathy
p.Gln356Arg Multiple submitters Epileptic encephalopathy
p.Glu1113Lys Multiple submitters Epileptic encephalopathy
p.Glu1547Ala Multiple submitters Epileptic encephalopathy ⚠
p.Glu1943Lys Multiple submitters Epileptic encephalopathy ⚠
p.Glu3248Gln Multiple submitters Epileptic encephalopathy
p.Glu3449Gly Multiple submitters Epileptic encephalopathy ⚠
p.Glu3610Val Multiple submitters Epileptic encephalopathy ⚠
p.Glu3970Asp Multiple submitters Epileptic encephalopathy
p.Glu4573Gln Multiple submitters RYR3-related Epileptic encephalopathy
p.Glu4700Lys Multiple submitters Epileptic encephalopathy ⚠
p.Gly1125Ser Multiple submitters Epileptic encephalopathy ⚠
p.Gly1412Ala Multiple submitters Epileptic encephalopathy ⚠
p.Gly1664Ala Multiple submitters Inborn genetic diseases ⚠
p.Gly1715Ala Multiple submitters Epileptic encephalopathy ⚠
p.Gly1786Asp Multiple submitters Epileptic encephalopathy ⚠
p.Gly2186Cys Multiple submitters Epileptic encephalopathy ⚠
p.Gly4134Arg Multiple submitters Epileptic encephalopathy ⚠
p.Gly4222Arg Multiple submitters Epileptic encephalopathy ⚠
p.Gly649Arg Multiple submitters Epileptic encephalopathy ⚠
p.Gly722Ala Multiple submitters Epileptic encephalopathy
p.His1273Gln Multiple submitters Epileptic encephalopathy ⚠
p.His1709Tyr Multiple submitters Epileptic encephalopathy ⚠
p.His1821Tyr Multiple submitters Epileptic encephalopathy
p.His2437Tyr Multiple submitters Epileptic encephalopathy ⚠
p.His3845Gln Multiple submitters ⚠
p.His386Arg Multiple submitters Epileptic encephalopathy ⚠
p.His4609Arg Multiple submitters Epileptic encephalopathy ⚠
p.His563Pro Multiple submitters Epileptic encephalopathy ⚠
p.Ile1495Val Multiple submitters Epileptic encephalopathy
p.Ile152Val Multiple submitters Epileptic encephalopathy
p.Ile1874Val Multiple submitters Epileptic encephalopathy ⚠
p.Ile2047Val Multiple submitters Epileptic encephalopathy
p.Ile2278Thr Multiple submitters Epileptic encephalopathy ⚠
p.Ile236Met Multiple submitters Epileptic encephalopathy
p.Ile2617Val Multiple submitters Epileptic encephalopathy ⚠
p.Ile3367Val Multiple submitters Epileptic encephalopathy ⚠
p.Ile3634Thr Multiple submitters Epileptic encephalopathy ⚠
p.Ile3825Asn Multiple submitters Epileptic encephalopathy
p.Ile4206Thr Multiple submitters Epileptic encephalopathy
p.Ile4268Met Multiple submitters Epileptic encephalopathy ⚠
p.Ile4604Thr Multiple submitters Epileptic encephalopathy ⚠
p.Ile665Thr Multiple submitters Epileptic encephalopathy
p.Leu1461Phe Multiple submitters Epileptic encephalopathy ⚠
p.Leu1499Phe Multiple submitters Epileptic encephalopathy
p.Leu2339Arg Multiple submitters Epileptic encephalopathy ⚠
p.Leu2558Ile Multiple submitters Epileptic encephalopathy
p.Leu2948Pro Multiple submitters Epileptic encephalopathy
p.Leu3222Val Multiple submitters Epileptic encephalopathy
p.Leu3392Phe Multiple submitters Epileptic encephalopathy ⚠
p.Leu3499Met Multiple submitters congenital myopathy 20
p.Leu3565Val Multiple submitters Epileptic encephalopathy ⚠
p.Leu3716Phe Multiple submitters congenital myopathy 20
p.Leu4184Phe Multiple submitters Epileptic encephalopathy ⚠
p.Lys1681Arg Multiple submitters RYR3-related Epileptic encephalopathy ⚠
p.Lys2601Arg Multiple submitters Epileptic encephalopathy
p.Lys3920Gln Multiple submitters congenital myopathy 20
p.Lys4579Arg Multiple submitters Epileptic encephalopathy
p.Lys949Arg Multiple submitters Epileptic encephalopathy
p.Met1159Ile Multiple submitters Epileptic encephalopathy
p.Met1159Val Multiple submitters Epileptic encephalopathy ⚠
p.Met1421Val Multiple submitters ⚠
p.Met1503Ile Multiple submitters Epileptic encephalopathy ⚠
p.Met1531Ile Multiple submitters RYR3-related Epileptic encephalopathy
p.Met1555Ile Multiple submitters Epileptic encephalopathy
p.Met198Val Multiple submitters Epileptic encephalopathy ⚠
p.Met2145Ile Multiple submitters Epileptic encephalopathy
p.Met2925Val Multiple submitters Epileptic encephalopathy
p.Met3268Val Multiple submitters Epileptic encephalopathy ⚠
p.Met958Val Multiple submitters Epileptic encephalopathy
p.Phe2871Leu Multiple submitters Epileptic encephalopathy ⚠
p.Phe3265Leu Multiple submitters Epileptic encephalopathy
p.Pro1110Thr Multiple submitters Epileptic encephalopathy
p.Pro1267Leu Multiple submitters Epileptic encephalopathy ⚠
p.Pro1870Leu Multiple submitters Epileptic encephalopathy
p.Pro1945Leu Multiple submitters Epileptic encephalopathy
p.Pro3552Ala Multiple submitters Epileptic encephalopathy
p.Pro4543Ser Multiple submitters
p.Ser1135Gly Multiple submitters Epileptic encephalopathy ⚠
p.Ser1477Arg Multiple submitters Epileptic encephalopathy ⚠
p.Ser1516Arg Multiple submitters Epileptic encephalopathy ⚠
p.Ser209Pro Multiple submitters Epileptic encephalopathy ⚠
p.Ser3120Leu Multiple submitters Epileptic encephalopathy ⚠
p.Ser3964Leu Multiple submitters Epileptic encephalopathy ⚠
p.Ser4317Asn Multiple submitters Epileptic encephalopathy ⚠
p.Ser54Ala Multiple submitters Epileptic encephalopathy
p.Ser54Leu Multiple submitters Epileptic encephalopathy ⚠
p.Thr1243Met Multiple submitters Epileptic encephalopathy
p.Thr1433Ala Multiple submitters Epileptic encephalopathy ⚠
p.Thr1946Met Multiple submitters Epileptic encephalopathy ⚠
p.Thr2508Met Multiple submitters Epileptic encephalopathy ⚠
p.Thr2619Ala Multiple submitters Epileptic encephalopathy
p.Thr2661Met Multiple submitters Epileptic encephalopathy
p.Thr2689Ser Multiple submitters Epileptic encephalopathy ⚠
p.Thr3096Met Multiple submitters Epileptic encephalopathy ⚠
p.Thr4590Ser Multiple submitters Epileptic encephalopathy ⚠
p.Trp2524Arg Multiple submitters
p.Tyr2743Cys Multiple submitters Epileptic encephalopathy
p.Val1407Leu Multiple submitters Epileptic encephalopathy ⚠
p.Val1415Met Multiple submitters Epileptic encephalopathy ⚠
p.Val1492Ile Multiple submitters Epileptic encephalopathy
p.Val1714Ala Multiple submitters Epileptic encephalopathy
p.Val1725Met Multiple submitters Epileptic encephalopathy ⚠
p.Val1803Ile Multiple submitters Epileptic encephalopathy ⚠
p.Val1803Leu Multiple submitters Epileptic encephalopathy
p.Val186Ile Multiple submitters Epileptic encephalopathy ⚠
p.Val2076Met Multiple submitters Epileptic encephalopathy ⚠
p.Val2279Met Multiple submitters congenital myopathy 20
p.Val2592Met Multiple submitters Epileptic encephalopathy
p.Val2682Met Multiple submitters Epileptic encephalopathy ⚠
p.Val2739Met Multiple submitters Epileptic encephalopathy ⚠
p.Val4123Met Multiple submitters Epileptic encephalopathy ⚠
p.Val4265Ala Multiple submitters Epileptic encephalopathy ⚠
p.Val4420Ile Multiple submitters Epileptic encephalopathy
p.Val4587Ala Multiple submitters Epileptic encephalopathy ⚠
p.Val65Ile Multiple submitters Epileptic encephalopathy
c.10258-3C>A Single submitter Epileptic encephalopathy
c.10503-21C>T Single submitter congenital myopathy 20
c.10816-10T>A Single submitter
c.10816-3del Single submitter Epileptic encephalopathy
c.10995+6G>A Single submitter Epileptic encephalopathy
c.11164+1G>A Single submitter Epileptic encephalopathy
c.11165-1G>A Single submitter Epileptic encephalopathy
c.1146+3G>A Single submitter Epileptic encephalopathy
c.11568+5T>C Single submitter Epileptic encephalopathy
c.11569-3T>C Single submitter Epileptic encephalopathy
c.13628+3G>A Single submitter Epileptic encephalopathy
c.13670_13671+3dup Single submitter Epileptic encephalopathy
c.13860+1G>A Single submitter Epileptic encephalopathy
c.14007+4T>C Single submitter Epileptic encephalopathy
c.14142+4A>G Single submitter Epileptic encephalopathy
c.14299+4T>C Single submitter Epileptic encephalopathy
c.1438-3C>T Single submitter Epileptic encephalopathy
c.1573+4A>G Single submitter Epileptic encephalopathy
c.1788+4G>A Single submitter Epileptic encephalopathy
c.2574+5G>T Single submitter Epileptic encephalopathy
c.2679+1G>T Single submitter Epileptic encephalopathy
c.2679+3A>G Single submitter Epileptic encephalopathy
c.2867+3A>T Single submitter Epileptic encephalopathy
c.354+4A>G Single submitter Epileptic encephalopathy
c.354+5G>A Single submitter Epileptic encephalopathy
c.3556+5A>C Single submitter Epileptic encephalopathy
c.4309-3C>G Single submitter Epileptic encephalopathy
c.4396-5C>T Single submitter
c.5861-3C>T Single submitter Epileptic encephalopathy
c.6135-7A>T Single submitter
c.6913-157C>T Single submitter
c.7821-5C>G Single submitter
c.7899+6G>A Single submitter Epileptic encephalopathy
c.7899+8T>C Single submitter
c.7990-3T>C Single submitter Epileptic encephalopathy
c.815+6G>A Single submitter Epileptic encephalopathy
c.8400-3T>C Single submitter
c.8816+5G>A Single submitter Epileptic encephalopathy
c.9056-2A>G Single submitter Epileptic encephalopathy
c.972+6G>C Single submitter Epileptic encephalopathy
c.9830+5G>A Single submitter Epileptic encephalopathy
p.Ala108Val Single submitter ⚠
p.Ala1116Thr Single submitter ⚠
p.Ala1157Val Single submitter ⚠
p.Ala1331Ser Single submitter ⚠
p.Ala1336Pro Single submitter congenital myopathy 20 ⚠
p.Ala1446Ser Single submitter ⚠
p.Ala1467Thr Single submitter Epileptic encephalopathy ⚠
p.Ala1533Val Single submitter Epileptic encephalopathy ⚠
p.Ala1567Val Single submitter Epileptic encephalopathy
p.Ala1579Pro Single submitter Epileptic encephalopathy ⚠
p.Ala1616Ser Single submitter ⚠
p.Ala1618Gly Single submitter Epileptic encephalopathy ⚠
p.Ala1760Val Single submitter Epileptic encephalopathy ⚠
p.Ala1825Val Single submitter
p.Ala2141fs Single submitter Epileptic encephalopathy
p.Ala2202Thr Single submitter primary ovarian failure ⚠
p.Ala2255Val Single submitter
p.Ala2313Thr Single submitter Epileptic encephalopathy ⚠
p.Ala2354Val Single submitter Epileptic encephalopathy ⚠
p.Ala2363Thr Single submitter ⚠
p.Ala2410Val Single submitter Epileptic encephalopathy
p.Ala2420Thr Single submitter
p.Ala2530Ser Single submitter Epileptic encephalopathy
p.Ala2530Val Single submitter
p.Ala2562Ser Single submitter ⚠
p.Ala256Thr Single submitter Epileptic encephalopathy
p.Ala2570Val Single submitter
p.Ala260Val Single submitter ⚠
p.Ala27Asp Single submitter Epileptic encephalopathy ⚠
p.Ala27Thr Single submitter Epileptic encephalopathy ⚠
p.Ala2836Pro Single submitter Epileptic encephalopathy
p.Ala2840Gly Single submitter Epileptic encephalopathy
p.Ala2909Thr Single submitter ⚠
p.Ala2951Ser Single submitter
p.Ala2955Val Single submitter
p.Ala2996Val Single submitter Epileptic encephalopathy
p.Ala3060Ser Single submitter ⚠
p.Ala309Val Single submitter Epileptic encephalopathy ⚠
p.Ala3189Asp Single submitter
p.Ala3226Gly Single submitter
p.Ala3256Thr Single submitter
p.Ala3256Val Single submitter Epileptic encephalopathy ⚠
p.Ala3338= Single submitter
p.Ala3369Val Single submitter
p.Ala3494Thr Single submitter
p.Ala3627Val Single submitter Epileptic encephalopathy