KMT2D p.Pro548fs
c.1643del · rs2498458491 · VCV2445213
Computational evidence
| Protein change | ||
| Missense predictors do not apply to this variant type; conservation carries the signal. | ||
| Consequence | frameshift | predicted loss-of-function in a haploinsufficient gene (ClinGen) |
|---|---|---|
| NMD | predicted | premature termination codon in exon 11 of 55 |
| Splicing | ||
| SpliceAI | — | not assessed · substitutions only |
| Constraint at this position | ||
| Conservation | phyloP 0.075 | GERP 0.64, phastCons 0.7 |
| Region caveats | ||
| Repeat context | tandem | TCCTCAGGTGGTGGGGACGGGGCGATTCCTCAGGTGGTGGGGACAGGGGTGAC simple repeat · ambiguous alignment · confidence, not pathogenicity |
Predicted loss-of-function is descriptive, not an applied PVS1 code.
Population frequency
No gnomAD frequency available for this variant. This is missing data, not an absence: the variant may or may not be present in gnomAD. Rarity (ACMG PM2) and BA1/BS1 cannot be assessed for it.
Variant & gene context
- Gene
- KMT2D
- Protein
- p.Pro548fs
- Coding
- c.1643del
- MANE Select
- NM_003482
- dbSNP
- rs2498458491
- Type
- Deletion
- Location
- chr12:49052040 (GRCh38)
- Gene constraint
- LOEUF 0.141 · pLI 1.00 · ClinGen HI 3/3 (gnomAD)
- Residue 548
- a UniProt-annotated variant site (in kabuk1); the 'disordered' region; the '15 x 5 aa repeats of s/p-p-p-e/p-e/a' region
Similar variants
- KMT2D c.3907-2_3907-1del Pathogenic ★★ same condition
- KMT2D p.Ala3808fs Pathogenic/Likely pathogenic ★★ same condition
- KMT2D p.Arg2460fs Pathogenic ★★ same condition
- KMT2D p.Arg4666fs Pathogenic/Likely pathogenic ★★ same condition
- KMT2D p.Arg845fs Pathogenic ★★ same condition
- KMT2D p.Asn5480fs Pathogenic ★★ same condition
- KMT2D p.Asp1876fs Pathogenic/Likely pathogenic ★★ same condition
- KMT2D p.Gln3796fs Pathogenic ★★ same condition
Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →
Cite Sugi Variant
Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/kmt2d-p-pro548fs (accessed [today's date]).
Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown