LDB3 p.Ala436Pro
c.1305_1306delinsCC · rs2132481671 · VCV1329288
Uncertain significance
Single submitter
Classification
Uncertain significance
ClinVar
Review
Single submitter ★☆☆☆
ClinVar · 1 submitter
gnomAD v4.1
Not reported
no gnomAD frequency available for this variant
Conditions
1
cardiomyopathy
Computational evidence
| Protein change | ||
| Missense predictors do not apply to this variant type; conservation carries the signal. | ||
| Splicing | ||
| SpliceAI | — | not assessed · substitutions only |
|---|---|---|
| Constraint at this position | ||
| Conservation | phyloP -2.8 | GERP -1.5 |
| Regional constraint | o/e 0.95 | unconstrained · MANE · 64 kb · p 0.14 · regional, not allelic |
| Region caveats | ||
| Repeat context | tandem | CCTACACCCCCTCCCCTGCCCCTG simple repeat · ambiguous alignment · confidence, not pathogenicity |
Population frequency
dbSNP / gnomAD
No gnomAD frequency available for this variant. This is missing data, not an absence: the variant may or may not be present in gnomAD. Rarity (ACMG PM2) and BA1/BS1 cannot be assessed for it.
Variant & gene context
- Gene
- LDB3
- Protein
- p.Ala436Pro
- Coding
- c.1305_1306delinsCC
- MANE Select
- NM_007078
- dbSNP
- rs2132481671
- Type
- Indel
- Location
- chr10:86716400 (GRCh38)
- Gene constraint
- LOEUF 0.864 · pLI <0.01 (gnomAD)
- Structure
- AlphaFold pLDDT 61.98 · 2 PDB
- Residue 436
- the 'disordered' region
Similar variants
- LDB3 p.Ala436Ser Uncertain significance ★ ⚠ same residue
- LDB3 p.Ala436fs Likely benign ★ same residue
- LDB3 p.Ala147Thr Pathogenic/Likely pathogenic ★★ same condition
- LDB3 p.Ala165Val Pathogenic/Likely pathogenic ★★ same condition
- LDB3 p.Ala389Thr Uncertain significance ★★ ⚠ same condition
- LDB3 p.Ala501Val Uncertain significance ★★ ⚠ same condition
- LDB3 p.Arg404Gln Uncertain significance ★★ ⚠ same condition
- LDB3 p.Arg559Gln Uncertain significance ★★ ⚠ same condition
Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →
Cite Sugi Variant
Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/ldb3-p-ala436pro (accessed [today's date]).
Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown