Is LDB3 p.Ser440fs (c.1318_1319del) pathogenic?

LDB3 p.Ser440fs (c.13181319del) is classified Likely benign in LDB3 (ClinVar, Single submitter, 1 submitter; last evaluated 2018-02-09). Very rare (popmax 0.00578%, amr).

How common is LDB3 p.Ser440fs (c.1318_1319del) in the general population?

LDB3 p.Ser440fs (c.1318_1319del) is very rare (popmax 0.00578%, amr) (gnomAD).

LDB3 p.Ser440fs

c.1318_1319del · VCV4908484

Likely benign Single submitter

Classification

Likely benign

ClinVar

Review

Single submitter ★☆☆☆

ClinVar · 1 submitter

Consequence

frameshift

predicted LoF

gnomAD v4.1

Rare

very rare (popmax 0.00578%, amr)

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function
NMD	predicted	premature termination codon in exon 10 of 14
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP 4.1	GERP 1.2, phastCons 0.99
Overall
CADD	22.9	PHRED · no single calibrated threshold — expert panels disagree
Region caveats
Repeat context	tandem	CCTACACCCCCTCCCCTGCCCCTG simple repeat · ambiguous alignment · confidence, not pathogenicity

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Population frequency

gnomAD v4.1 · exomes + genomes

Grpmax group 0.00578% Admixed American · 3/51,944 alleles

Filtering AF 0.0016% ClinGen BA1/BS1 input FAF95, joint · FAF99 0.000942%

Overall 0.00123% 19/1,547,034 alleles · very rare exomes 17/1,405,638 · genomes 2/141,396 · joint denominator

Ancestry group	Frequency	1 in
Admixed Americangrpmax	0.00578%	17,315
Finnishnot grpmax-eligible	0.00508%	19,673
South Asian	0.00472%	21,201
Ashkenazi Jewishnot grpmax-eligible	0.0035%	28,552
Remaining individualsnot grpmax-eligible	0.00333%	30,036
European (non-Finnish)	0.000524%	190,813

Rarity supports pathogenicity (ACMG PM2); frequency above a disease-specific BA1/BS1 threshold argues against it. A variant frequent in one ancestry group can be near-absent in others, so a single global figure can mislead.

Variant & gene context

Gene: LDB3
Protein: p.Ser440fs
Coding: c.1318_1319del
MANE Select: NM_007078
Type: Deletion
Location: chr10:86716412 (GRCh38)
Gene constraint: LOEUF 0.864 · pLI <0.01 (gnomAD)
Structure: AlphaFold pLDDT 61.98 · 2 PDB
Residue 440: the 'disordered' region

Full LDB3 gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Similar variants

LDB3 p.Ser440= Likely benign ★★ same residue
LDB3 p.Ser440Pro Likely benign ★ ⚠ same residue
LDB3 c.860-22_860-12del Uncertain significance ★★ same type
LDB3 p.Glu483_Ala485del Uncertain significance ★★ same type
LDB3 p.Val676fs Uncertain significance ★★ same type
LDB3 p.Ala434_Pro449del Benign ★★ same type
LDB3 c.1086-247_1231+2del Pathogenic ★ same type
LDB3 p.Ala319fs Likely pathogenic ★ same type

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/ldb3-p-ser440fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown