Is LDB3 p.Ser448fs (c.1343del) pathogenic?

LDB3 p.Ser448fs (c.1343del) is classified Pathogenic in LDB3 (ClinVar, Single submitter, 1 submitter; last evaluated 2023-12-02). No gnomAD frequency available for this variant; Associated with myofibrillar myopathy 4.

What condition is associated with LDB3 p.Ser448fs (c.1343del)?

LDB3 p.Ser448fs (c.1343del) is associated with myofibrillar myopathy 4 (ClinVar).

How common is LDB3 p.Ser448fs (c.1343del) in the general population?

LDB3 p.Ser448fs (c.1343del) is no gnomAD frequency available for this variant (gnomAD).

LDB3 p.Ser448fs

Q: How is Late-onset distal myopathy, Markesbery-Griggs type inherited?

Typically Autosomal dominant (Orphanet). A genetic counselor can assess individual risk for a family.

c.1343del · rs2492808478 · VCV2699041

Pathogenic Single submitter

Classification

Pathogenic

ClinVar

Review

Single submitter ★☆☆☆

ClinVar · 1 submitter

Consequence

frameshift

predicted LoF

gnomAD v4.1

Not reported

no gnomAD frequency available for this variant

Conditions

myofibrillar myopathy 4

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function
NMD	predicted	premature termination codon in exon 10 of 14
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP 2.8	GERP 1.3, phastCons 0.94
Region caveats
Repeat context	tandem	CCTACACCCCCTCCCCTGCCCCTG simple repeat · ambiguous alignment · confidence, not pathogenicity

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Population frequency

dbSNP / gnomAD

No gnomAD frequency available for this variant. This is missing data, not an absence: the variant may or may not be present in gnomAD. Rarity (ACMG PM2) and BA1/BS1 cannot be assessed for it.

Variant & gene context

Gene: LDB3
Protein: p.Ser448fs
Coding: c.1343del
MANE Select: NM_007078
dbSNP: rs2492808478
Type: Deletion
Location: chr10:86716438 (GRCh38)
Gene constraint: LOEUF 0.864 · pLI <0.01 (gnomAD)
Structure: AlphaFold pLDDT 61.98 · 2 PDB

Full LDB3 gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Disease context

myofibrillar myopathy 4 — disease report on Sugi Atlas → Associated genes, phenotypes, clinical trials & treatments

For Late-onset distal myopathy, Markesbery-Griggs type (Orphanet):

Inheritance: Autosomal dominant
Onset: Adult
Prevalence: <1 / 1 000 000 (Worldwide)

Similar variants

LDB3 c.860-22_860-12del Uncertain significance ★★ same condition
LDB3 p.Glu483_Ala485del Uncertain significance ★★ same condition
LDB3 p.Val676fs Uncertain significance ★★ same condition
LDB3 c.1086-247_1231+2del Pathogenic ★ same condition
LDB3 p.Ala319fs Likely pathogenic ★ same condition
LDB3 p.Arg559fs Pathogenic ★ same condition
LDB3 p.Gln81fs Pathogenic ★ same condition
LDB3 p.Gly131fs Pathogenic ★ same condition

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/ldb3-p-ser448fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown